Application of CIDEC gene in preparation of medicine for treating cancer

By constructing an RNAi lentiviral interference system of CIDEC gene, regulating lipid droplets and apoptosis-related proteins in NSCLC cells, the problem of difficulty in effectively treating NSCLC in the existing technology is solved, and the significant impact on NSCLC cell proliferation, migration and apoptosis is achieved, and a new therapeutic strategy is provided.

CN120099010APending Publication Date: 2025-06-06AFFILIATED HOSPITAL OF NANTONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510111620.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-01-23
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The prior art is difficult to effectively utilize the CIDEC gene in the treatment of non-small cell lung cancer (NSCLC), especially in inhibiting cancer cell migration, invasion and promoting apoptosis.

Method used

By constructing an RNAi lentiviral interference system of the CIDEC gene, interfering or overexpressing the CIDEC gene, we can prepare drugs for the treatment of NSCLC, regulate the morphology and number of lipid droplets in non-small cell lung cancer cells, and affect the expression of TAG components and apoptosis-related proteins.

Benefits of technology

It has achieved a significant impact on the proliferation, apoptosis, migration and invasion capabilities of NSCLC cells, reduced the migration and invasion capabilities of cancer cells, promoted apoptosis, and provided a new therapeutic strategy, with high clinical application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099010A_ABST
    Figure CN120099010A_ABST
Patent Text Reader

Abstract

The invention discloses application of a CIDEC gene in preparation of a medicine for treating cancers, and relates to the technical field of biological medicines. According to the application of the CIDEC gene disclosed by the invention in preparation of medicines for treating cancers, the nucleotide sequence of the CIDEC gene is as shown in SEQ ID NO. 1. A stably transfected cell strain of an overexpressed CIDEC gene is constructed, and verification shows that after overexpressing of CIDEC, the proliferation activity of non-small cell lung cancer cells is reduced, the migration ability is reduced, the invasion ability is reduced, and apoptosis is accelerated; lipid droplets with larger diameters are increased, and the lipid droplets are obviously gathered and fused; small lipid droplets in cytoplasm are reduced; and most TAG components are obviously increased. A nude mouse subcutaneous transplantation tumor model is constructed, and verification shows that the size and the weight of a nude mouse in-vivo tumor after overexpression of the CIDEC are obviously lower than those of a control group. The invention provides a new strategy and direction for the treatment of non-small cell lung cancer, and has extremely high clinical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and more specifically, relates to the application of CIDEC gene in preparing medicine for treating cancer. Background Art

[0002] Lung cancer is a heterogeneous disease and the most common tumor disease in the world. It is divided into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), of which NSCLC accounts for 85%. Current treatments for NSCLC usually include surgery, radiotherapy, chemotherapy, immunotherapy, and molecular targeted therapy, which can be used alone or in combination. Although 25% of patients are still suitable for radical surgery when diagnosed at an early stage, the overall prognosis of complete resection is still not optimistic.

[0003] Lipid droplets are a type of organelle that consists of a monolayer of phospholipid membranes that wrap neutral lipids to store excess lipids and provide cellular energy. Neutral lipids include triacylglycerol (TAG) and sterol esters (SE). The number and size of LDs reflect the level of neutral lipid storage in cells. Compared with normal cells, cancer cells exhibit higher metabolic activity, increased lipid uptake and synthesis, and therefore have the significant characteristic of containing a large number of cellular LDs. The surface of lipid droplets contains a variety of proteins. Although LDs have the function of organelles, their biosynthesis, degradation, and other behaviors are essentially dependent on their associated proteins.

[0004] The CIDE (cell death-inducing DFF45-like effector) family is an important lipid droplet protein involved in the formation and stability of lipid droplets. It consists of three members: CIDEA, CIDEB, and CIDEC. They have significant homology with the DFF subunit DFF 45 at the N-terminus, so they are called the cell death-inducing DFF45-like effector family. CIDEC (also known as FSP27, CIDE-3) is a lipid droplet binding protein discovered in the family in recent years. It has two domains, the N-terminal and C-terminal. The N-terminal domain has the same DFF45 homology with the family members and is found to be closely related to the caspase-dependent apoptosis process, while its C-terminal domain is related to lipid accumulation and is necessary for lipid droplet growth. In recent years, many studies have found that CIDEC plays an important role in various metabolic diseases through lipid energy metabolism, autophagy, apoptosis, mitochondrial damage and other pathways. Studies have shown that FSP27 / CIDEC is specifically highly expressed in the livers of mice and alcoholic hepatitis patients after chronic alcohol diet. This high expression aggravates ethanol-induced hepatocyte damage through mitochondrial damage and lipid metabolism imbalance. Other studies have shown that growth hormone activates the transcription and feedback loop that damages PPARγ through the MEK / ERK pathway, thereby downregulating the expression of FSP2 and stimulating fat decomposition in adipose tissue, explaining the role of CIDEC in growth hormone-induced diabetes. Previous studies on CIDE family molecules have focused on adipocytes and metabolic diseases. The latest study found that CIDEC has an open reading frame consisting of 238 amino acids located in the 3p25 region, which is a chromosomal region associated with high-frequency loss of heterozygosity in many tumors, including NSCLC. Studies have shown that CIDEC interacts with lipopolysaccharide-induced tumor necrosis factor LITAF through amino acids 1-145 of the N-terminal domain to promote apoptosis of non-small cell lung cancer cells. This suggests that CIDEC may play an important role in tumor prevention, but its role in NSCLC has not been studied yet. Summary of the invention

[0005] In view of the above problems existing in the prior art, the technical problem to be solved by the present invention is to provide an RNAi lentiviral interference system of the CIDEC gene. Another technical problem to be solved by the present invention is to provide an application of the RNAi lentiviral interference system of the CIDEC gene for preparing a drug for treating non-small cell lung cancer.

[0006] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0007] The use of CIDEC gene in preparing a drug for treating cancer, wherein the nucleotide sequence of the CIDEC gene is shown as SEQ ID NO.1.

[0008] Application of CIDEC gene in preparing medicine for treating lung cancer.

[0009] Application of CIDEC gene in preparing medicine for treating non-small cell lung cancer.

[0010] The drug for treating non-small cell lung cancer is a drug that inhibits the migration and invasion capabilities of non-small cell lung cancer cells.

[0011] The drug for treating non-small cell lung cancer is a drug that promotes apoptosis of non-small cell lung cancer cells.

[0012] The drug for treating non-small cell lung cancer is a drug for inhibiting the proliferation of non-small cell lung cancer cells.

[0013] Application of CIDEC gene in regulating the morphology and number of lipid droplets in non-small cell lung cancer cells.

[0014] Application of CIDEC gene in regulating TAG components in non-small cell lung cancer cells.

[0015] Application of CIDEC gene in preparing medicine for treating tumor.

[0016] Application of CIDEC gene in regulating tumor volume and weight.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] 1) The CIDEC gene / protein disclosed in the present invention is a target for precision treatment of non-small cell lung cancer, and is used to prepare drugs for treating non-small cell lung cancer and for preparing drugs for treating tumors. It provides a new strategy and direction for the treatment of non-small cell lung cancer, has extremely high clinical application value, and is expected to bring better treatment effects to patients with non-small cell lung cancer.

[0019] 2) The present invention constructed a stable cell line overexpressing the CIDEC gene, and detected the effects of CIDEC on the proliferation, apoptosis, invasion and migration of NSCLC cell lines by CCK8, flow cytometry, Transwell chamber and scratch assay. The results showed that compared with the control group (Vec group), the proliferation activity, migration ability and invasion ability of non-small cell lung cancer cells overexpressing CIDEC decreased, and the apoptosis was accelerated.

[0020] 3) The present invention constructs a stable cell line overexpressing the CIDEC gene, and verifies the mechanism by which CIDEC affects the progression of NSCLC and the potential factors regulated by it by Oil Red O staining, BODIPY fluorescence staining, and liquid chromatography-mass spectrometry; and verifies the effect of CIDEC expression intervention on potential target genes by Western blot technology. On this basis, the correlation between CIDEC, potential target genes, and the malignant biological behavior of NSCLC is deeply explored at the cellular level. The results show that after overexpression of CIDEC, the number of larger diameter lipid droplets in non-small cell lung cancer cells increases, and the lipid droplets are obviously aggregated and fused; the number of small lipid droplets in the cytoplasm decreases; most of the TAG components are significantly increased, and the total amount increases by about 35.83%.

[0021] 4) The present invention used H1299 cells with stable overexpression of CIDEC and A549 cells with stable silencing of CIDEC to construct a nude mouse subcutaneous transplant tumor model, and verified the effect of CIDEC expression intervention on the tumor-forming ability of nude mice by observing the growth, tumor volume, weight and immunohistochemical staining of nude mouse transplant tumors. The results showed that the tumor size and weight (average weight of 606.8 mg) of the H1299-CIDEC-OE group were significantly lower than those of the H1299-Vec group (average weight of 1245.2 mg). BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The scatter plot of the expression level of CIDEC gene in TCGA database and GTEx database (A), Western Blot detection of CIDEC protein expression in lung cancer cell line and normal lung epithelial cell line and statistical graph (Figure BC);

[0023] Figure 2 This is the sequencing result diagram of the lentiviral interference shuttle vector;

[0024] Figure 3 Figure 1 shows the fluorescence observation of infection efficiency under a microscope, the verification of the overexpression efficiency of CIDEC-OE lentivirus and the silencing efficiency of shCIDEC lentivirus by Western blot (A is the green fluorescence observed in H1299 cells 72 hours after virus infection, B is the green fluorescence observed in A549 cells 72 hours after virus infection, C is the protein expression level and statistical graph of overexpressed CIDEC in H1299 and H1975 cells detected by Western Blot, and D is the protein expression level and gray value statistical graph of silenced CIDEC in A549 and PC9 cells detected by Western Blot);

[0025] Figure 4The effect of CIDEC expression intervention on the proliferation ability of NSCLC cells detected by CCK-8 experiment (A and B are the lung cancer cell proliferation abilities of CIDEC-OE group and Vec group of H1299 cells and H1975 cells detected by CCK-8 experiment, and C and D are the cell proliferation abilities of shCIDEC#3 group and shNC group of A549 cells and PC9 cells detected by CCK-8 experiment);

[0026] Figure 5 Figure 2 is the effect of CIDEC expression intervention on apoptosis of NSCLC cells detected by flow cytometry (A is the statistical diagram of cell apoptosis in CIDEC-OE and Vec groups of H1299 cells and H1975 cells detected by flow cytometry, and the corresponding total apoptotic cells; B is the statistical diagram of cell apoptosis in shCIDEC#3 and shNC groups of A549 cells and PC9 detected by flow cytometry, and the corresponding total apoptotic cells);

[0027] Figure 6 The figure is the effect of CIDEC expression intervention on apoptosis-related proteins in lung cancer cells detected by Western Blot (AB is the expression and statistical graph of apoptosis-related proteins in CIDEC-OE group and Vec group of H1299 cells detected by Western Blot experiment, CD is the expression and gray value statistical graph of apoptosis-related proteins in shCIDEC#3 group and shNC group of A549 cells detected by Western Blot experiment);

[0028] Figure 7 The effect of CIDEC expression intervention on NSCLC cell migration detected by scratch experiment (A is the cell migration rate and statistical graph of CIDEC-OE group and Vec group of H1299 and H1975 cells detected by cell scratch experiment, and B is the cell migration rate and statistical graph of shCIDEC#3 group and shNC group of A549 and PC9 cells detected by cell scratch experiment);

[0029] Figure 8 The figure shows the effect of CIDEC expression intervention on the invasion and migration of NSCLC cells detected by Transwell chamber experiment (AB is the number of cells passing through the chamber and the statistical graph of CIDEC-OE group and Vec group of H1299 cells and H1975 cells detected by Transwell chamber experiment, CD is the number of cells passing through the chamber and the statistical graph of shCIDEC#3 group and shNC group of A549 cells and PC9 cells detected by Transwell chamber experiment);

[0030] Fig. 9Oil Red O staining shows the morphology of intracellular lipid droplets (Figure AB shows the lipid droplets and local magnifications of the CIDEC-oe group and vec group of H1299 cells and H1975 cells stained with Oil Red O, and Figure CD shows the lipid droplets and local magnifications of the shCIDEC#3 group and shNC group of A549 cells and PC9 cells stained with Oil Red O);

[0031] Fig.10 The distribution diagram of lipid droplets after CIDEC overexpression was detected by BODIPY493 / 503 lipid droplet fluorescence staining (A is BODIPY493 / 503 fluorescence staining showing lipid droplets in the CIDEC-oe group and vec group of H1299 cells, and Figure B is BODIPY493 / 503 fluorescence staining showing lipid droplets in the CIDEC-oe group and vec group of H1975 cells, where DAPI is cell nucleus staining and BODIPY is lipid droplet staining);

[0032] Fig.11 Figure 1 is the lipidomics result after LC / MS detection of overexpression of CIDEC (A is a Heatmap showing the relative content of TAG in H1299-Vec cells and H1299-CIDEC-OE cells (n=3), B is the relative quantification of the top 10 significant TAGs in H1299-Vec cells and H1299-CIDEC-OE cells detected by targeted lipidomics, C is the relative total quantification of TAG, DAG and FFA in H1299-Vec cells and H1299-CIDEC-OE cells detected by targeted lipidomics, D is the Western blot detection of ATGL protein levels in CIDEC-OE group and Vec group of H1299 cells and shNC group and shCIDEC#3 group of A549 cells, EF is the gray value statistical diagram of ATGL protein level);

[0033] Fig.12 The figures are the growth curves of the subcutaneous transplanted tumors in nude mice and the comparison of their terminal sizes and weights (A and D are schematic diagrams of the tumor sizes of each group on the 28th day, B and E are line graphs showing the tumor volume-time growth curves measured every 3 days after the tumors became visible to the naked eye on the 10th day, and C and F are statistical graphs of the tumor weights of each group on the 28th day). DETAILED DESCRIPTION

[0034] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described below in conjunction with specific embodiments. Unless otherwise specified in the following embodiments, the technical means used are conventional means well known to those skilled in the art.

[0035] The non-small cell lung cancer cell lines A549, PC9, NCI-H1299, and NCI-H1975 used in the following examples were derived from the cell bank of the Chinese Academy of Sciences, and the normal human bronchial epithelial tissue BEAS-2B cell line was purchased from Wuhan Saiweier Biotechnology Co., Ltd.

[0036] Example 1

[0037] 1. Total cell protein extraction

[0038] Prepare protein lysis buffer and place on ice for later use; remove cells (A549 cell line, PC9 cell line, NCI-H1299 cell line, NCI-H1975 cell line, BEAS-2B cell line) from the incubator, wash twice with PBS on ice, add an appropriate amount of protein lysis buffer (about 150-200μL / well for 6-well plate) according to the cell volume, lyse on ice for 30 minutes, and perform subsequent operations on ice; scrape the cells with a scraper and collect the lysis buffer into a pre-cooled EP tube; pre-cool the low-temperature centrifuge in advance, centrifuge at 12000g and 4℃ for 20 minutes. Transfer the supernatant to a new EP tube, take 5μL and determine the protein concentration by BCA method; add 1 / 4 volume of 5× protein loading buffer according to the volume of the supernatant, boil in a 100℃ water bath for 10 minutes, prepare the protein preparation solution, and store it in a -80℃ refrigerator.

[0039] 2. BCA method to measure protein concentration

[0040] Prepare protein standard solution: add 1.2 mL of protein preparation solution to protein standard (30 mg BCA) to prepare 25 mg / mL protein standard solution and store at -20°C.

[0041] Prepare protein working solution: dilute 25 mg / mL protein standard solution with PBS to 0.5 mg / mL protein working solution.

[0042] Prepare BCA working solution: According to the number of samples to be tested, mix solution A and solution B in the BCA kit at a ratio of 50:1, and prepare 200 μL of working solution for each sample.

[0043] Add 0, 1, 2, 4, 8, 12, 16, 18, 20 μL of protein standard solution to a 96-well plate, add PBS to make the total volume up to 20 μL, add 5 μL of protein preparation solution and 15 μL of PBS to the wells to be tested; add 200 μL of BCA working solution to each well, incubate in a 37°C oven for 30 min or at room temperature for 2 h; measure the OD value at a wavelength of 562 nm with an ordinary microplate reader; determine the standard curve (R2>0.99) and calculate the concentration of the sample to be tested based on the concentration of the standard.

[0044] 3. Western Blot

[0045] Glue preparation: Clean the glass plate and glue preparation rack and install them. Add ddH 2 Observe for 10 minutes to test for leaks. If the leak test is passed, discard the ddH 2 O, wipe clean and dry; prepare the lower gel solution according to the instructions of PAGE gel rapid preparation kit (Nanjing Novozyme) according to the target gel concentration and gel thickness; inject an appropriate amount of lower gel mixture evenly into the gel glass plate to avoid bubbles, add isopropanol to press the gel, and let it stand at room temperature for 15-30 minutes. When a refraction line appears between the alcohol and the gel, it means that it has solidified. Pour off the isopropanol and use ddH 2 O wash until odorless, absorb water with absorbent paper; add the upper glue buffer to the glass plate, insert a comb to avoid bubbles, and let it stand at room temperature for 30 minutes. After the glue solidifies, store it in 4℃ ddH 2 In O.

[0046] Electrophoresis: Clamp the glass plate on the electrophoresis rack, pour 1× electrophoresis buffer into the inner tank, make sure the inner tank is leak-proof, then add electrophoresis buffer to two-thirds of the outer tank, pull out the comb, add protein marker and calculate the required protein volume after quantification by BCA method, and then use 1× Loading Buffer to balance the loading volume. Perform electrophoresis at a constant voltage of 80V, and when the protein enters the separation gel, adjust to 120V constant voltage to continue electrophoresis, and stop electrophoresis when the bromophenol blue indicator approaches the bottom of the separation gel.

[0047] Transfer: Prepare transfer solution and pre-cool at 4°C. Remove the glass plate, cut off the upper gel and bromophenol blue part of the gel, transfer to the filter paper soaked in transfer solution, cut the PVDF membrane to the appropriate size, put it in methanol for polarization for 30-60 seconds, and then pass it through ddH 2 After rinsing and balancing, place it on the gel. Do not create bubbles between the membrane and the gel, and then cover it with filter paper and sponge pad. Clamp the transfer plate in the order of black side-sponge-filter paper-gel-PVDF membrane-filter paper-sponge-white side, put it in the transfer tank, and add ice box. Transfer the membrane on ice at a constant current of 300mA.

[0048] Immunoreaction: After the transfer, use tweezers to remove the PVDF membrane (protein side up), place it in fresh blocking solution, and block it at room temperature for 2 hours on a low-speed shaker; prepare the primary antibody with the primary antibody diluent according to the ratio in the antibody manual, add it to the antibody incubation box, and shake it in a refrigerator at 4°C overnight; on the next day, recover the primary antibody and rinse it 3 times with TBST, each time for 10 minutes, prepare the secondary antibody with the secondary antibody diluent, incubate it at room temperature for 2 hours on a low-speed shaker, and then wash it three times with TBST, each time for 10 minutes; prepare the developer in a 1:1 ratio (prepare it now and use it now), use a gel imager for exposure and development, mark and save the image.

[0049] The results are as follows Figure 1As shown in the figure, the expression level of CIDEC in lung cancer cell lines was lower than that in normal lung epithelial cells, and the relative expression in A549 and PC9 cell lines was down-regulated by about 13.9% and 14.0%, respectively, and in NCI-H1299 and NCI-H1975 cell lines by about 72.8% and 68.9%, respectively. The expression of CIDEC gene in NCI-H1299 and NCI-H1975 cell lines was lower than that in normal cells, so the subsequent experiments overexpressed CIDEC gene in NCI-H1299 and NCI-H1975 cell lines; the expression of CIDEC gene in A549 and PC9 cell lines was higher than that in normal cells, so the subsequent experiments transfected A549 and PC9 cell lines with lentivirus-mediated RNAi interference system.

[0050] Example 2

[0051] 1. Construction of RNAi lentiviral interference system of CIDEC gene

[0052] Aiming at the CIDEC gene (gene ID: 63924, protein ID: NP_001186552.1) sequence, an RNAi lentiviral interference system specifically targeting the CIDEC gene was constructed to construct a lentiviral-mediated RNAi interference system. The gene sequence of the RNAi interference system of the CIDEC gene is as follows:

[0053] CIDEC-shRNA1:5'-gagacagaagagtacttccaa-3',

[0054] CIDEC-shRNA2:5'-gtttgatctgtacaagctgaa-3',

[0055] CIDEC-shRNA3: 5'-gatacatactccctttcctat-3'.

[0056] The target sequence is as follows:

[0057] CIDEC-RNAi-1:ctctgtcttctcatgaaggttagttctcaaccttcatgagaagacagagaaaaaa,

[0058] CIDEC-RNAi-2:caaactagacatgttcgacttagttctcaagtcgaacatgtctagtttgaaaaaa,

[0059] CIDEC-RNAi-3:ctatgtatgagggaaaggataagttctctatcctttccctcatacatagaaaaaa.

[0060] 2. Construction of CIDEC gene overexpression system

[0061] The CIDEC gene sequence (shown in SEQ ID NO. 1) was constructed into the pcDNA3.1 vector using KpnI and XhoI.

[0062] 3. Preparation of lentiviral stock solution

[0063] Vector construction: The vector was linearized using restriction endonucleases BamHI and EcoRI from NEB to generate sticky ends, which were then recovered from the gel for later use.

[0064] Prepare the reaction system according to Table 1. Incubate at 98°C for 3 min in a PCR instrument and then reduce the temperature by 0.5°C every 20 s until it reaches about 25°C.

[0065] Table 1 Reaction system

[0066]

[0067] Prepare the reaction system according to Table 2 and incubate at 16°C for about 1 hour for competent cell transformation.

[0068] Table 2 Reaction system

[0069]

[0070] Culture at 37℃ overnight, pick single clones for sequencing verification. Use lentiviral interference shuttle vector with Puro resistance and GFP tag. Sequencing verification vector construction is successful ( Figure 2 ).

[0071] Endotoxin-free plasmid extraction: Inoculate the bacterial suspension of the positive clone into about 15 mL of LB medium containing 50 mg / L Amp, and culture at 37°C, 200 rpm, with shaking for about 18 hours. Collect the bacteria and extract the plasmid using the Endotoxin-free Plasmid Mini-Extraction Kit (Tian Gen: DP118).

[0072] Plasmid transfection: One day before transfection, subculture the grown 293T cells into T75 culture flasks at an appropriate ratio. Prepare for transfection when the cells grow to about 80%. Adjust the ratio of shuttle vector to auxiliary vector according to the size of the shuttle vector while keeping the total amount of vector unchanged. Mix the plasmid and transfection reagent according to the requirements of Lipo293™ (Biyuntian: C0521) transfection reagent and perform cell transfection.

[0073] Virus concentration: 18-24 hours after transfection, carefully aspirate the cell culture medium and discard it in a triangular flask, then seal it and sterilize it with high temperature and high pressure. 24h and 48h after changing the medium, aspirate the cell culture supernatant into a 50mL centrifuge tube and add fresh culture medium at the same time. At 96h, aspirate the cell culture supernatant into a 50mL centrifuge tube and discard the cells. Filter the supernatant with a 0.45μm sterile filter and transfer it to a new centrifuge tube. Concentrate and purify the lentivirus according to the PEG lentivirus purification reagent (Yinmao Shengye: P1201). Finally, dissolve the lentivirus precipitate with PBS, divide it into 200μL / tube, and store it at -80℃.

[0074] Determination of lentiviral titer: Take 10 5 293T cells were plated and infected with 0.5 μL of virus stock solution 6 hours later. Cells were harvested 48 hours later and genomic DNA was extracted.

[0075] Virus copy number detection: Take 0.1 µL of plasmid standard and genomic DNA of the sample to be tested, and use sterile water as a no-template control. Genome copy number detection: Take 0.1 µL of genomic standard and genomic DNA of the sample to be tested, and use sterile water as a no-template control.

[0076] The qPCR cycle conditions were set as follows: 95°C for 5 min; 95°C for 15 s, 60°C for 1 min, for 40 cycles.

[0077] The number of lentiviral vector copies integrated in the measured DNA sample is calibrated with the number of genomes to obtain the number of virus copies integrated per genome. Titer (IU / mL) = (C×N×D×1000) / V. Where: C = average number of virus copies integrated per genome; N = number of cells at the time of infection; D = virus dilution factor; V = volume of diluted virus added.

[0078] The titer of CIDEC-i1 gene interference lentivirus was 5×10 8 TU / mL.

[0079] The titer of CIDEC-i2 gene interference lentivirus was 5×10 8 TU / mL.

[0080] The titer of CIDEC-i3 gene interference lentivirus was 5×10 8 TU / mL.

[0081] 4. Determine the optimal MOI value

[0082] Inoculation cells: 5×10 3 / mL A549 cell line, PC9 cell line, NCI-H1299, NCI-H1975 cell line, and BEAS-2B cell line were inoculated into 96-well plates with DMEM medium containing 10% FBS in each well. Lentivirus infection experiments could be performed when the cell density reached 30-50%.

[0083] Prepare reagents: Take out the lentivirus from the -80℃ refrigerator in advance, place it on ice to slowly melt, centrifuge for 20s to allow the liquid on the tube wall to settle, and calculate the amount of virus required for each well according to the multiplicity of infection (MOI) gradient (MOI=0, 1, 5, 10, 25, 50, 100) and the formula (virus volume per well V (μL) = number of cells per well × MOI / virus liquid titer). Set up three replicate wells for each MOI value and dilute the virus liquid with DMEM basal medium (100 μL per well);

[0084] Infection: Aspirate the old culture medium of the 96-well plate, add 100 μL of DMEM containing virus solution, add an appropriate amount of Polybrene transfection enhancer, mix gently, and replace with fresh complete culture medium after culturing for eight hours;

[0085] Determine the concentration: observe the cell morphology and the presence of vacuoles under a normal microscope at 24h, 48h, and 72h, and observe the cell fluorescence under a fluorescence microscope. Select the minimum MOI value with good cell status and an infection efficiency of about 80% for subsequent formal experiments.

[0086] 5. Construction of CIDEC silencing and overexpression stable cell lines

[0087] Cell plating: digest the lung cancer cells to be infected in good condition and plate them at 2×10 5 / well in a 6-well plate, continue to culture until the cell density is about 30%-50%, and change the medium one day before infection;

[0088] Infection: Take out the virus from the -80℃ freezer, slowly thaw on ice, and centrifuge for 20 seconds. Dilute the virus solution with DMEM medium according to the MOI value, add the virus solution and Polybrene to the cells to be transfected, and shake gently to mix; overexpress the CIDEC gene in NCI-H1299 and NCI-H1975 cell lines, and transfect the lentivirus-mediated RNAi interference system in A549 and PC9 cell lines.

[0089] Removal of virus: After culturing for another eight hours, observe the cell status, remove the virus-containing medium, and replace it with fresh DMEM complete medium;

[0090] Drug screening: After 48 hours of culture, puromycin was added at a concentration of 2 μg / mL to screen stable cell lines. The screening was continued for 7-10 days. If the cell density reached 90% during the process, the cells were subcultured and the drug was added to continue the culture. After the drug screening, the fluorescence was observed under a fluorescence microscope and verified by Western Blot.

[0091] Expanded culture: After successful construction is verified by experiments, the culture is expanded and cryopreserved.

[0092] 6. Plasmid transfection

[0093] Lung cancer cells in the exponential growth phase were inoculated into 6-well plates one day before transfection, so that the cell density was about 70% when transfected the next day; lip3000 reagent was diluted with opti-MEM medium (125 μL / well of medium, 5 μL / well of lip3000 reagent), and gently blown to mix, which is called A solution; p3000 reagent was diluted with opti-MEM medium (125 μL / well of medium, 5 μL / well of p3000 reagent) and the corresponding overexpression / silencing plasmid (2.5 μg / well), and gently blown to mix, which is called B solution; A solution and B solution were mixed and allowed to stand at room temperature for 15 minutes; the cells to be transfected were gently washed twice with PBS and the medium was replaced with DMEM high-glucose basal medium; the transfection complex was added dropwise to the 6-well plate, gently shaken to mix, and placed in the incubator for continued culture; the cell state was observed 8 hours after transfection, and the medium was replaced with DMEM complete medium, and subsequent experiments could be carried out after 48-72 hours.

[0094] The results are as follows Figure 3 As shown, the green fluorescence rate reached more than 90% 72 hours after the cells were infected with the virus. Compared with the empty vector (Vec group), the CIDEC protein expression of the CIDEC overexpressing stable cell line (CIDEC-OE group) was significantly upregulated; among the three shRNAs used to silence CIDEC, compared with the control group (shNC), the protein expression of shCIDEC#2 and shCIDEC#3 decreased by about 63.9% and 85.8% (A549), 26.7% and 70.7% (PC9), and shCIDEC#3 had a higher silencing rate on CIDEC gene expression in lung cancer cells, so shCIDEC#3 was selected for subsequent experiments.

[0095] Example 3

[0096] 1. Cell proliferation (CCK-8 assay)

[0097] Digest and collect cells from each group to prepare cell suspension, and adjust the suspension density to 3×10 4 / mL; add 100 μL of cell suspension to each well of a 96-well plate, repeat 4 replicates in each group, keep the cell suspension uniform at all times when adding samples, add PBS to the outermost circle of the 96-well plate and lay a total of 5 plates in this way; after placing the well plate in an incubator and culturing for 2 hours, take the first 96-well plate and add 10 μL of CCK8 solution to each well, and culture at 37°C for 2 hours. Detect the absorbance at 450nm and 630nm on a microplate reader, which is counted as the result at 0h; at 24h, 48h, 72h and 96h, change the medium of the 96-well plate, add CCK8 solution and measure the corresponding absorbance.

[0098] The results are as follows Figure 4 As shown, compared with the control group (Vec group), the proliferation ability of the two cell lines was significantly reduced after overexpression of CIDEC; the proliferation ability of the two cell lines was significantly enhanced after silencing the CIDEC gene.

[0099] 2. Cell apoptosis (flow cytometry)

[0100] Mix 4× Binding Buffer and sterilized ddHO 2 The cell culture medium was collected into a 15 mL centrifuge tube, washed twice with 4°C PBS and the washing solution was collected. The cells were digested with trypsin without EDTA. When the cells became round and bright under the microscope, the digestion was terminated and the cells were gently blown and collected into a 15 mL centrifuge tube. Centrifuge at 1000 rpm for 5 min, remove the supernatant, resuspend the cells with 1× Binding Buffer and adjust the density to 1×10 6 / mL, take 100μL of cell suspension into a flow cytometer; add 5μL Annexin V / Alexa flour 647 and 10μL PI solution to each tube, mix gently, and set up a negative control tube (no dye), PI single staining tube (only PI solution), and Annexin V single staining tube (only Annexin V solution), incubate in the dark for 15min; add 250μL PBS and detect using a flow cytometer as soon as possible.

[0101] The results are as follows Figure 5 As shown, compared with the control group (Vec group), the apoptosis of the two cell lines increased significantly after overexpression of CIDEC. On the contrary, the apoptosis of NSCLC cells decreased significantly after inhibiting the expression of CIDEC.

[0102] 3. Western Blot detection of the effect of CIDEC expression intervention on apoptosis-related proteins in lung cancer cells

[0103] Glue preparation: Clean the glass plate and glue preparation rack and install them. Add ddH 2 Observe for 10 minutes to test for leaks. If the leak test is passed, discard the ddH 2O, wipe clean and dry; prepare the lower gel solution according to the instructions of PAGE gel rapid preparation kit (Nanjing Novozyme) according to the target gel concentration and gel thickness; inject an appropriate amount of lower gel mixture evenly into the gel glass plate to avoid bubbles, add isopropanol to press the gel, and let it stand at room temperature for 15-30 minutes. When a refraction line appears between the alcohol and the gel, it means that it has solidified. Pour off the isopropanol and use ddH 2 O wash until odorless, absorb water with absorbent paper; add the upper glue buffer to the glass plate, insert a comb to avoid bubbles, and let it stand at room temperature for 30 minutes. After the glue solidifies, store it in 4℃ ddH 2 In O.

[0104] Electrophoresis: Clamp the glass plate on the electrophoresis rack, pour 1× electrophoresis buffer into the inner tank, make sure the inner tank is leak-proof, then add electrophoresis buffer to two-thirds of the outer tank, pull out the comb, add protein marker and calculate the required protein volume after quantification by BCA method, and then use 1× Loading Buffer to balance the loading volume. Perform electrophoresis at a constant voltage of 80V, and when the protein enters the separation gel, adjust to 120V constant voltage to continue electrophoresis, and stop electrophoresis when the bromophenol blue indicator approaches the bottom of the separation gel.

[0105] Transfer: Prepare transfer solution and pre-cool at 4°C. Remove the glass plate, cut off the upper gel and bromophenol blue part of the gel, transfer to the filter paper soaked in transfer solution, cut the PVDF membrane to the appropriate size, put it in methanol for polarization for 30-60 seconds, and then pass it through ddH 2 After rinsing and balancing, place it on the gel. Do not create bubbles between the membrane and the gel, and then cover it with filter paper and sponge pad. Clamp the transfer template in the order of black side-sponge-filter paper-gel-PVDF membrane-filter paper-sponge-white side, put it in the transfer tank, and add ice box. Transfer the membrane on ice at a constant current of 300mA.

[0106] Immunoreaction: After the transfer, use tweezers to remove the PVDF membrane (protein side up), place it in fresh blocking solution, and block it at room temperature for 2 hours on a low-speed shaker; prepare the primary antibody with the primary antibody diluent according to the ratio in the antibody manual, add it to the antibody incubation box, and shake it in a refrigerator at 4°C overnight; on the next day, recover the primary antibody and rinse it 3 times with TBST, each time for 10 minutes, prepare the secondary antibody with the secondary antibody diluent, incubate it at room temperature for 2 hours on a low-speed shaker, and then wash it three times with TBST, each time for 10 minutes; prepare the developer in a 1:1 ratio (prepare it now and use it now), use a gel imager for exposure and development, mark and save the image.

[0107] The results are as follows Figure 6As shown in the figure, compared with the Vec group, after upregulating CIDEC gene expression, the expression levels of pro-apoptotic proteins Bax, cleaved caspase9 p35, and cleaved caspase9 p37 were increased, and the expression of anti-apoptotic protein Bcl-2 protein decreased; on the contrary, after downregulating CIDEC gene expression, the expression level of anti-apoptotic protein Bcl-2 increased, while the expression levels of pro-apoptotic proteins Bax, cleaved caspase9 p35, and cleaved caspase9 p37 were significantly decreased compared with the control group. The above results indicate that CIDEC promotes apoptosis of NSCLC cells and is related to the caspase9-mediated mitochondrial intrinsic apoptosis pathway.

[0108] 4. Cell migration (scratch assay)

[0109] Draw horizontal lines on the back of the 6-well plate with a marker, with 4 horizontal lines in each well; add experimental lung cancer cells to the 6-well plate, with the amount of cells just grown on the second day as the standard, and add the completed culture to continue culturing; when the cell density is about 90% or more on the second day, use a 20-200μL yellow pipette tip to draw a vertical line in the center of each well, with the line perpendicular to the bottom positioning line, gently wash 3-5 times with PBS, and add basal culture medium; take a picture under a microscope and record it as 0h, and return it to the 37℃ incubator for continued cultivation; take a picture under a microscope at 24h, and wash it twice with PBS before taking pictures; use ImageJ to calculate the area of ​​the cell-free area in the center of the scratch, convert the pixel unit into the area unit according to the ruler, and calculate and count the results: cell migration rate (%) = (0h scratch area - 24h scratch area) / 0h scratch area × 100%.

[0110] The results are as follows Figure 7 As shown, compared with the control group (Vec group), the migration ability of the two cell lines decreased after overexpression of CIDEC, while when the expression of CIDEC was inhibited, the cell migration ability of the lung cancer cell line was significantly enhanced.

[0111] 4. Cell migration and invasion (Transwell chamber assay)

[0112] Matrigel was thawed at 4°C in advance and kept on ice throughout the operation. Matrigel and DMEM basal medium were diluted at a ratio of 1:8, and 100 μL was quickly added to each well to avoid bubbles. The cells were solidified in a 37°C incubator for 2 h (this step is not required for Transwell migration experiments). The experimental cells were replaced with serum-free medium one day in advance, the cells were digested, resuspended with DMEM basal medium, and the cells were counted. The cell density was adjusted to 3×10 cells per 200 μL. 4 (migration experiment) and 5×10 4(Invasion experiment), blow thoroughly and evenly, add 200 μL of cell suspension vertically into the Transwell chamber, add 500 μL of DMEM complete medium containing 10% FBS to the outside of the chamber of the 24-well plate, and continue to culture in the incubator (migration experiment for about 48 hours, invasion experiment for about 72 hours); take out the chamber and wash it with PBS, wipe off the cells and matrix gel inside the chamber with a cotton swab, immerse and fix it with 4% paraformaldehyde for 30 minutes, and then stain it with crystal violet for 10-15 minutes; rinse the chamber with PBS twice, turn it upside down to dry, take pictures under a microscope and count them.

[0113] The results are as follows Figure 8 As shown, compared with the control group (Vec group), the invasion and migration abilities of the two cell lines were significantly decreased after overexpression of CIDEC, while when the expression of CIDEC was inhibited, the cell migration ability of lung cancer cells was significantly enhanced.

[0114] 5. Oil Red O staining

[0115] The cells were seeded into a 6-well plate and stained when the density reached about 50-60%. The culture medium was discarded and 1 mL / well of 4% paraformaldehyde was added for fixation for 30 min. The paraformaldehyde was discarded and the cells were washed 3 times with PBS, each time for 5 min. The cells were soaked in 60% isopropanol solution for 2 min and stained with 1 mL / well of Oil Red O working solution at room temperature for 10-20 min. The Oil Red O staining solution was discarded and the excess Oil Red O dye was washed away with 60% isopropanol (<5 s) and washed once with PBS. The cells were stained with hematoxylin staining solution for 1 min and washed several times with PBS until the cells turned blue. The cells were observed and photographed with an inverted microscope.

[0116] The results are as follows Fig. 9 As shown, after overexpression of CIDEC, the number of larger diameter lipid droplets in H1299 and H1975 cells increased, and the lipid droplets obviously aggregated and fused; while after silencing CIDEC, the large lipid droplets in A549 and PC9 cells disappeared, and the lipid droplets were obviously fragmented and reduced.

[0117] 6. BODIPY493 / 503 fluorescence staining

[0118] Place the coverslip in a 6-well plate using sterilized tweezers and sterilize under UV light for 30 minutes; inoculate cells in the well plate containing the coverslip and stain when the cell density reaches about 30-50%; wash twice with pre-cooled PBS, add 2 mL / well of BODIPY working solution, and incubate at 37°C in the dark for 15 minutes; discard the staining solution, wash three times with PBS, add 1 mL / well of 4% paraformaldehyde and fix at room temperature for 30 minutes; discard the paraformaldehyde, wash three times with PBS, 5 minutes each time; drop a drop of anti-fluorescence quenching sealing agent containing DAPI on the slide, take out the coverslip in the 6-well plate, and seal it upside down on the slide; take pictures using a fluorescence microscope or Zeiss confocal microscope. If pictures cannot be taken immediately, store them temporarily in a humidified box at 4°C in the dark.

[0119] The results are as follows Fig.10 As shown, after overexpression of CIDEC, the small lipid droplets in the cytoplasm of H1299 and H1975 lung cancer cell lines decreased, and the lipid droplets with larger diameters increased significantly.

[0120] 7. Lipidomics analysis based on liquid chromatography-mass spectrometry (LC-MS)

[0121] 1) Cell sample collection

[0122] Each group of stable cells was cultured in a 10 cm culture dish and collected when the density reached more than 90%. The cells were washed twice with pre-cooled HEPES solution, scraped with a scraper and collected in a 15 mL centrifuge tube, centrifuged at 4°C and 1000 rpm for 5 min, the supernatant was discarded, and the cells were resuspended and centrifuged and washed with HEPES, repeated twice, and the cell suspension was transferred to a 1.5 mL EP tube, centrifuged at 4°C and 3000 rpm for 10 min, the supernatant was fully aspirated, and the cell pellet was stored in a -80°C refrigerator.

[0123] 2) Lipid extraction

[0124] Prepare cell extractant, add 700 μL of extract to each cell sample, transfer to a 2 mL enzyme-free centrifuge tube, add 2 2.5 mm steel beads, and shake at 4 °C for 30 min; add 140 μL ddH 2 O, continue shaking at 4℃ for 15min. Centrifuge at 4℃ and 12000g for 15min, take 500μL supernatant to a new EP tube, continue to evaporate with nitrogen, and store at -80℃. When re-dissolving, add 100μL methanol re-solution to each sample and blow thoroughly to re-dissolve, centrifuge at 4℃ and 15000g for 15min, and take the supernatant for detection.

[0125] 3) Protein quantification

[0126] After the residue was evaporated with nitrogen, 300 μL NaOH (0.3M 0.1% SDS) was added to each sample. The protein was lysed in a metal bath at 65°C for 4 h. Protein was quantified using the BCA method.

[0127] 4) Targeted lipidomics

[0128] With TAGs-DAGs-FFAs as the main line, the target lipids in the samples to be tested include: triglycerides (C42:0TAG, C42:1TAG, C44:0TAG, C44:1TAG, C44:2TAG, C45:0TAG, C45:1TAG, C46:0TAG, etc.), diglycerides (C14:0DAG, C16:0DAG, C16:1DAG, C17:0DA, C18:0DAG, C18:1DAG, C18:2DAG), free fatty acids (C16:0 FA, C16:1 FA, C18:0 FA, C18:1 FA, C18:2 FA, C20:4 FA, C22:6 FA), etc. The corresponding standard curves were drawn with different concentrations of the above lipid standards for subsequent quantitative analysis. The ion range was determined using multiple reaction monitoring (MRM) scanning mode to detect positive and negative ions respectively.

[0129] The mass spectrometry data visualization software Lipidview was used to integrate the chromatographic peak areas and screen out all lipids in the analyte to obtain the peak area data matrix in the analyte, and to perform relative quantification of related lipids in targeted lipidomics.

[0130] The results are as follows Fig.11 As shown in the data, most of the TAG components in H1299 cells were significantly increased after overexpression of CIDEC, among which the top 10 increased components were: C44:0TAG (P=0.0002), C52:1TAG (P=0.0015), C54:2TAG (P=0.0018), C51:1TAG (P=0.0019), C45:1TAG (P=0.0023), C46:0TAG (P=0.0028), C50:1TAG (P=0.0028), C51:0TAG (P=0.0034), C48:1TAG (P=0.0043), and C47:1TAG (P=0.0044). After overexpression of the CIDEC gene, the total amount of TAG in the cells increased by about 35.83%, but the total amount of FFA did not decrease with the increase of TAG, but increased instead.

[0131] Example 4

[0132] 1. Prepare nude mice and cells

[0133] The 25 purchased male nude mice were randomly divided into five groups, labeled as A549-shCIDEC#2 group, A549-shCIDEC#3 group, NCH1299-CIDEC-OE group, H1299-Vec group, and A549-shNC group, with 5 mice in each group, and adaptively raised for more than 1 week. The cells in each group were expanded and cultured in T75 culture flasks. After digestion on the day of the experiment, they were resuspended and counted in PBS and the density was adjusted to 6×10 7 / mL.

[0134] 2. Inoculation of cells

[0135] Fix the nude mouse with the left hand, disinfect the axillary skin with iodine, and insert the needle into the right axillary with a 1 mL syringe. Keep the needle moving subcutaneously and slowly inject 100 μL of cell suspension (containing 6×10 6 cells), local skin papules can be seen, and the needle should be withdrawn while rotating to observe whether there is exudation, bleeding, etc. at the injection site.

[0136] 3. Observe and feed

[0137] Observe the state of the nude mice and the condition of the tumor, record the body weight every three days, and use a vernier caliper to record the size of the tumor. The volume formula of the tumor is: V = 0.52 × the longest diameter of the tumor × the shortest diameter of the tumor 2 .

[0138] 4. Obtain materials

[0139] On the 28th day, the nude mice were killed by cervical dislocation, and the tumors were collected, marked, measured, and photographed. The tumor tissues were cut, and appropriate tissues were soaked in 4% paraformaldehyde, and the rest were packaged and stored in a -80°C refrigerator.

[0140] The results are as follows Fig.12 As shown, on the 28th day, the final tumor size results showed that the tumor size and weight of the H1299-CIDEC-OE group (average weight was 606.8 mg) were significantly lower than those of the H1299-Vec group (average weight was 1245.2 mg); while the tumor size and weight of the A549-shCIDEC#2 group (average weight was 808.4 mg) were significantly higher than those of the A549-shNC group (average weight was 330.4 mg), and were similar to the A549-shCIDEC#3 group (average weight was 784.4 mg).

Claims

1. Use of the CIDEC gene in the preparation of a drug for treating cancer, wherein the nucleotide sequence of the CIDEC gene is shown in SEQ ID NO.

1.

2. Application of CIDEC gene in the preparation of drugs for treating lung cancer.

3. Application of CIDEC gene in the preparation of drugs for the treatment of non-small cell lung cancer.

4. The use according to claim 3, characterized in that: The drug for treating non-small cell lung cancer is a drug that inhibits the migration and invasion capabilities of non-small cell lung cancer cells.

5. The use according to claim 3, characterized in that: The drug for treating non-small cell lung cancer is a drug that promotes apoptosis of non-small cell lung cancer cells.

6. The use according to claim 3, characterized in that: The drug for treating non-small cell lung cancer is a drug for inhibiting the proliferation of non-small cell lung cancer cells.

7. Application of CIDEC gene in regulating the morphology and number of lipid droplets in non-small cell lung cancer cells.

8. Application of CIDEC gene in regulating TAG components in non-small cell lung cancer cells.

9. Application of CIDEC gene in the preparation of drugs for treating tumors.

10. Application of CIDEC gene in regulating tumor volume and weight.