Membrane protein sec61 alpha gene and dsrna in pest control

Abstract

The application belongs to the field of biotechnology and agricultural pest control, and particularly relates to a membrane protein Sec61 alpha gene and application of dsRNA of the membrane protein Sec61 alpha gene in pest control. After cloning and sequencing of the Sec61 alpha gene of Locusta migratoria, the sequence of the Sec61 alpha gene of SEQ ID NO:1 is obtained; then the gene fragment of SEQ ID NO:2 is selected for synthesis of double-stranded RNA (dsRNA). After the dsRNA of the gene is injected into the body cavity of the Locusta migratoria, specific Sec61 alpha genes can be silenced, and the Locusta migratoria stops feeding and successively dies before molting. The application provides a new specific molecular target for pest control based on RNA interference, and has very important application value.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and agricultural pest control, specifically involving the application of the membrane protein Sec61α gene and its dsRNA in pest control. Background Technology

[0002] Nucleic acid biopesticides utilize the dsRNA of pests or pathogens themselves to silence the transcriptional level of target genes, thereby inhibiting the growth and development of pests or pathogens and achieving the purpose of pest and disease control. Compared with traditional pesticides, nucleic acid biopesticides have advantages such as strong insecticidal specificity, a wide range of target selection, and being green and safe. Nucleic acid biopesticides have become the core products of the "third revolution in the history of pesticide development." However, the research and development of nucleic acid biopesticides urgently needs to overcome the bottleneck of screening for highly efficient and specific insecticidal dsRNA targets. Membrane proteins play a very important role in many life activities of organisms, such as cell proliferation and differentiation, energy conversion, signal transduction, and substance transport. It is estimated that approximately 60% of drug targets are membrane proteins.

[0003] The migratory locust (Locusta migratoria) is an intercontinental agricultural pest, mainly distributed across Asia, Europe, Africa, and Australia. It is characterized by its explosive, gregarious, and migratory nature; once it occurs, it not only affects a wide area but also spreads rapidly and causes severe damage. Sec61α is a membrane protein, and currently, there are no reports on RNA interference techniques for pest control using the Sec61α gene. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to overcome the shortcomings of the prior art and provide the application of the membrane protein Sec61α gene and its dsRNA in pest control.

[0005] To achieve the above objectives, the technical solution of the present invention is as follows:

[0006] The first aspect of this invention is a locust membrane protein Sec61α gene, the nucleotide sequence of which is shown in SEQ ID NO: 1. This sequence was obtained by searching a locust transcriptome database, and the open reading frame of this sequence is 1431 bp, encoding 476 amino acids.

[0007] The second aspect of the present invention is a locust membrane protein Sec61α gene fragment, the nucleotide sequence of which is shown in SEQ ID NO: 2.

[0008] The third aspect of the present invention is a dsRNA of the locust membrane protein Sec61α gene, which is synthesized using the locust membrane protein Sec61α gene fragment described in the second aspect.

[0009] The fourth aspect of the present invention is a method for synthesizing dsRNA of the locust membrane protein Sec61α gene as described in the third aspect, comprising the following steps: designing an upstream primer as shown in SEQ ID NO: 3 and a downstream primer as shown in SEQ ID NO: 4 according to the sequence SEQ ID NO: 1, and then obtaining the product as shown in SEQ ID NO: 2 by PCR amplification, which is then purified, transcribed and synthesized into dsRNA.

[0010] The fifth aspect of the present invention is the application of the dsRNA of the locust membrane protein Sec61α gene described in the third aspect in pest control.

[0011] Furthermore, dsRNA can be prepared into sprayable insecticides or baits, or transferred into the plant bodies ingested by pests.

[0012] Furthermore, the pest is the locust.

[0013] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0014] The present invention provides a novel specific molecular target for RNA interference-based pest control, which has significant application value. When the dsRNA of the locust membrane protein Sec61α gene is injected into the body cavity of the locust, it can specifically silence the mRNA expression of the locust membrane protein Sec61α gene, causing the locust to stop feeding and die one after another before molting. Attached Figure Description

[0015] Figure 1 Effect of 5-instar locusts injected with dsRNA synthesized by SEQ ID NO:2 on the expression of Sec61α gene mRNA (where **P<0.005).

[0016] Figure 2 Effect of 5-instar locusts injected with dsRNA synthesized by SEQ ID NO:2 on locust phenotype (left side is control injected with dsGFP, right side is dsRNA synthesized by SEQ ID NO:2, i.e. dsLmSec61α). Detailed Implementation

[0017] To facilitate understanding of the present invention, a more comprehensive description will be given below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0018] Example 1: Obtaining the full-length cDNA sequence and gene fragment of the locust membrane protein Sec61α gene

[0019] Based on the transcriptome database of locusts, bioinformatics methods were used to search for the cDNA sequence of the locust membrane protein Sec61α gene. The full-length cDNA sequence of the locust membrane protein Sec61α gene was obtained. Primers were designed using Primer Premier 5.0 software to verify the full-length cDNA sequence, and the sequence was synthesized at Shanghai Bioengineering Co., Ltd. Four healthy, uniformly sized, and 50% male and 50% female nymphs of the locust were selected and frozen in liquid nitrogen. RNA was extracted according to the TaKaRa RNAiso Plus kit, and the extracted RNA was reverse transcribed into first-strand cDNA using the HiScript III qRT SuperMix (Nanjing Novizan Biotechnology Co., Ltd.) instructions. Using this cDNA as a template, and with the designed primers, the full-length cDNA sequence of the Sec61α gene was amplified by PCR. The obtained product was purified, cloned, and transformed into E. coli, and then sent to Shanghai Bioengineering Co., Ltd. for sequencing. The sequence is SEQ ID NO: 1.

[0020] Example 2: Synthesis of dsRNA from the locust membrane protein Sec61α gene

[0021] 1) Design of dsRNA primers for the locust membrane protein Sec61α gene

[0022] Based on the sequence of the locust membrane protein Sec61α gene obtained in Example 1 (SEQ ID NO: 1), dsRNA primers were designed using Primer Premier 5.0 software. The primer sequences are SEQ ID NO: 3 and SEQ ID NO: 4, respectively, and both the upstream and downstream primers carry the T7 promoter sequence. All primers were synthesized by Shanghai Bioengineering Co., Ltd.

[0023] 2) Synthesis of dsRNA in the locust membrane protein Sec61α gene

[0024] Using the upstream and downstream primers of SEQ ID NO: 3 and SEQ ID NO: 4, PCR amplification was performed on the cDNA template of Example 1. The amplified PCR product, with the sequence of SEQ ID NO: 2, was purified using the FastPure Gel DNA Extraction Mini Kit (Vazyme) and then purified according to T7 RiboMAX. TM The Express RNAi System (Promega) kit instructions state that dsRNA (i.e., dsLmSec61α) was synthesized in vitro via transcription. Quantification was performed using a NanoDROP 2000 (Thermo Scientific) to achieve a final concentration of 2 μg / μL. Storage was then carried out at -80°C.

[0025] Example 3: Experiment on lethality of 5th instar locusts by dsRNA of the locust membrane protein Sec61α gene

[0026] 1) Injection of locust membrane protein Sec61α gene dsRNA

[0027] Fifth instar nymphs of uniform size and health status, selected on the third day, were injected with the dsRNA synthesized in Example 2. A 25 μl microsyringe was used for injection; excessive force was avoided during injection. The injection point was the junction of the second and third abdominal segments on the lateral side, following the direction of blood flow, avoiding the spiracles. The injection volume of dsRNA was 10 μg, and a control group of dsGFP (10 μg) was also included. Each group consisted of 10 nymphs, with 3 biological replicates, for a total of 30 nymphs. After injection, the nymphs were placed in a 1L beaker in an artificial climate chamber (light:dark time = 14h:10h, temperature 30±2℃, humidity 60%), provided with fresh wheat seedlings and appropriate light, and sprayed with water to maintain humidity.

[0028] 2) Detection of Sec61α gene silencing in 5th instar locust membrane protein

[0029] Total RNA was extracted from nymphs injected with dsGFP and dsLmSec61α 24 h later. Four biological replicates were obtained from both the control and dsLmSec61α groups, with three nymphs per replicate. The RNA was reverse transcribed into first-strand cDNA, and the relative expression levels of the target gene (LmSec61α) and the housekeeping gene (β-actin) were detected using RT-qPCR to calculate the silencing efficiency. Results showed that compared to the control group, the expression of the LmSec61α gene was significantly reduced in the dsLmSec61α group. Figure 1 ).

[0030] 3) Observation of the phenotype of 5th instar locusts after dsRNA injection

[0031] Fifth-instar nymphs injected with dsRNA, and those in the dsGFP-injected control group, began molting 7 days later and all successfully molted into adults. After molting, the nymphs exhibited normal morphology and vitality. In the dsLmSec61α-injected treatment group, all 30 nymphs died before molting, exhibiting the following phenotypes: Figure 2 As shown: the intestines have significantly atrophied.

[0032] The above description is only for better explaining the embodiments of the present invention and is not intended to limit them. Any modifications or equivalent substitutions that do not depart from the spirit and scope of the present invention shall fall within the scope of the present invention.

[0033] SEQ ID NO: 1

[0034]

[0035] SEQ ID NO:2

[0036] MGIKFLEVIKPFCSILPEIAKPERKIQFREKVLWTAITLFIFLVCCQIPLFGIMSSDSADPFYWIRVILASNRGTLMELGISPIVTSGLIMQLLAGAKIIEVGDTPKDRALFNGAQKLFGMVITVGQAIVYVMTGMYGDPSEIGAGVCLLIIIQLFVAGLIVLLLDELLQKGYGLGSGISLFIATNICETIVWKAFSPTTVNTGRGTEFEGAVIALFHLLATRQDKVRALREAFYRQNLPNLMNLLATILVFAIVIYFQGFRVDLPIKSARYRGQYSSYPIKLFYTSNIPIILQSALVSNLYVISQMLAVKFTGNFFVNLLGVWADVGGGGPARAYPVGGLCYYLSPPENIMHILEDPVHALLYIIFMLGSCAFFSKTWIDVSGSSAKDVAKQLKEQQMVMRGHRDNSMIRELNRYIPTAAAFGGLCIGALSVLADFLGAIGSGTGILLAVTIIYQYFEIFVKEQSDMGSMSTLLF

[0037] SEQ ID NO:3

[0038] AGATTGGTGCTGGAGTTT

[0039] SEQ ID NO:4

[0040] CATCAAACATTCCCATTATC

[0041] SEQ ID NO:5

[0042] AGATTGGTGCTGGAGTTTGCCTTTTGATCATAATTCAGCTTTTTGTCGCTGGACTTATAGTCCTTTTGCTCGATGAACTTCTGCAGAAAGGGTATGGACTTGGATCTGGAATTTCACTGTTCATTGCGACAAATATATGTGAAACAATAGTGTGGAAGGCCTTCAGTCCAACTACTGTGAATACAGGACGTGGTACAGAATTTGAAGGAGCTGTGATTGCCCTGTTTCACTTACTGGCAACACGTCAGGACAAAGTTCGAGCCTTAAGGGAAGCATTCTATAGGCAAAACCTGCCTAACCTGATGAATCTGCTTGCAACTATTCTTGTTTTTGCCATTGTAATTTACTTCCAGGGCTTCAGGGTGGATCTGCCAATCAAATCTGCTCGCTATAGAGGCCAGTACAGCAGCTATCCAATAAAGCTGTTTTATACATCAAACATTCCCATTATC

Claims

1. A dsRNA of the locust membrane protein Sec61α gene, characterized in that, The dsRNA sequence was synthesized using a fragment of the membrane protein Sec61α gene, as shown in SEQ ID NO:

5.

2. The application of the dsRNA of the locust membrane protein Sec61α gene as described in claim 1 in the control of locusts.

3. The application of the dsRNA of the locust membrane protein Sec61α gene according to claim 2 in the control of locusts, characterized in that, dsRNA can be prepared into spray insecticides or baits, or transferred into the plant bodies of pests that feed on it.

Images