Method for optimizing LuxI / R quorum sensing system performance in escherichia coli based on AlkL transporter
By cloning fatty acid transporter genes, etc. into pCOLADuet-1 vector and transforming them into E. coli, AlkL is used to optimize the LuxI/R population sensing system, and the problem of insufficient system performance in the existing technology has been solved, and a significant improvement in strength, sensitivity and uniformity has been achieved.
Patent Information
- Application Number
- CN202311666367.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-06
- Publication Date
- 2025-06-06
AI Technical Summary
The prior art is difficult to optimize the performance of the LuxI/R population sensing system in E. coli, resulting in insufficient system strength, sensitivity and expression uniformity.
By cloning the fatty acid transporter gene, the repressor gene of the population sensing system, the target protein gene, the promoter Plux and the promoter Ptet onto the pCOLADuet-1 vector, the first plasmid is formed and transformed into the E. coli MG1655 strain, the performance of the LuxI/R population sensing system is optimized using the fatty acid transporter AlkL.
The intensity, sensitivity and expression uniformity of the population sensing system have been significantly improved, so that the fluorescence intensity generated by engineering E. coli after the exogenous addition of signal molecules is increased by 2-3 times.
Smart Images

Figure CN120099049A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of quorum sensing system performance, and in particular to a method for optimizing the performance of a LuxI / R quorum sensing system in Escherichia coli based on an AlkL transporter protein. Background Art
[0002] Escherichia coli is widely used in the fields of enzyme engineering, metabolic engineering and pharmaceutical engineering, and is the most commonly used strain in genetic engineering. At present, the genetic modification strategy commonly used in Escherichia coli is mainly to carry out static regulation through gene overexpression and gene knockout. Although these strategies have improved the production performance of strains to a certain extent, they cannot usually balance the growth of strains and the synthesis of target products. In addition, although the inducible promoter commonly used in Escherichia coli can achieve the balance of growth and production to a certain extent, it is restricted in large-scale production process because the inducer is expensive and toxic. Therefore, it is necessary to develop a dynamic control element with wide adaptability to adapt to different industrial production processes.
[0003] Quorum sensing is a system in which microorganisms regulate the expression of related genes. Its inducer is a signal molecule secreted by the microorganism itself. Therefore, as the microorganism grows, the population density continues to increase, and the concentration of the inducer also accumulates. When the concentration of the inducer reaches a threshold, the related genes are induced to express. The quorum sensing systems in different microorganisms are different. Take the LuxI / LuxR system in Vibrio fischeri as an example: as the cell density continues to increase, the signal molecule acyl homoserine lactone (AHL) synthesized by the signal molecule synthase LuxI continues to increase. AHL freely enters and exits the cell along the concentration gradient and continues to accumulate inside and outside the cell. When the AHL concentration reaches a certain threshold, AHL will bind to the signal molecule binding protein LuxR to form a LuxR-AHL dimer. This dimer can serve as a promoter P lux activator, thereby activating the lux Controlled transcription of genes.
[0004] With the development and demand of industrial production, how to optimize the performance of LuxI / R quorum sensing system in Escherichia coli has become an urgent problem to be solved. Summary of the invention
[0005] Based on this, it is necessary to address the technical problem of low performance of the existing technology for optimizing the LuxI / R quorum sensing system in Escherichia coli, and propose a method for optimizing the performance of the LuxI / R quorum sensing system in Escherichia coli based on the AlkL transporter protein.
[0006] Provided is a method for optimizing the performance of a LuxI / R quorum sensing system in Escherichia coli based on an AlkL transporter, the method comprising:
[0007] The fatty acid transporter gene, the repressor protein gene of the quorum sensing system, the target protein gene, and the promoter P lux and promoter P tet The promoter for controlling the expression of the target protein gene is selected from P lux The promoter controlling the expression of the repressor protein gene and the fatty acid transporter gene is selected from P tet ;
[0008] The first plasmid was transformed into Escherichia coli MG1655 strain to construct an engineered Escherichia coli containing an autoinduction system.
[0009] The method for optimizing the performance of the LuxI / R quorum sensing system in Escherichia coli based on the AlkL transporter protein proposed in the present invention is to synthesize the fatty acid transporter gene, the repressor protein gene of the quorum sensing system, the target protein gene, the promoter P lux and promoter P tet The first plasmid was constructed by assembling and cloning into the pCOLADuet-1 vector, wherein the promoter controlling the expression of the target protein gene was selected from P lux The promoter controlling the expression of the repressor protein gene and the fatty acid transporter gene is selected from P tet The first plasmid is transformed into the Escherichia coli MG1655 strain to construct an engineered Escherichia coli containing an autoinduction system, which can use the fatty acid transport protein AlkL to optimize the performance of the LuxI / R quorum sensing system heterologously expressed in Escherichia coli, including the strength, sensitivity and uniformity of expression of the quorum sensing system. BRIEF DESCRIPTION OF THE DRAWINGS
[0010] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0011] in:
[0012] Figure 1 A flowchart of a method for optimizing the performance of a LuxI / R quorum sensing system in Escherichia coli based on an AlkL transporter in one embodiment;
[0013] Figure 2 This is a first experimental data diagram for optimizing the performance of the LuxI / R quorum sensing system in Escherichia coli based on the AlkL transporter in one embodiment;
[0014] Figure 3 A second experimental data diagram for optimizing the performance of the LuxI / R quorum sensing system in Escherichia coli based on the AlkL transporter in one embodiment;
[0015] Figure 4 This is a third experimental data diagram for optimizing the performance of the LuxI / R quorum sensing system in Escherichia coli based on the AlkL transporter in one embodiment. DETAILED DESCRIPTION
[0016] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by technicians in the technical field of the present application; the terms used in the specification of the application herein are only for the purpose of describing specific embodiments and are not intended to limit the present application; the terms "including" and "having" and any variations thereof in the specification and claims of the present application and the above-mentioned drawings are intended to cover non-exclusive inclusions. The terms "first", "second", etc. in the specification and claims of the present application or the above-mentioned drawings are used to distinguish different objects, not to describe a specific order.
[0017] Reference to "embodiments" herein means that a particular feature, structure, or characteristic described in conjunction with the embodiments may be included in at least one embodiment of the present application. The appearance of the phrase in various locations in the specification does not necessarily refer to the same embodiment, nor is it an independent or alternative embodiment that is mutually exclusive with other embodiments. It is explicitly and implicitly understood by those skilled in the art that the embodiments described herein may be combined with other embodiments.
[0018] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0019] See also Figure 1 As shown, Figure 1 A schematic flow chart of a method for optimizing the performance of the LuxI / R quorum sensing system in Escherichia coli based on the AlkL transporter provided in one embodiment of the present invention includes the following steps:
[0020] Step S101: Genes of fatty acid transporters, repressor proteins of quorum sensing systems, target proteins, and promoters P lux and promoter P tet The promoter for controlling the expression of the target protein gene is selected from P luxThe promoter controlling the expression of the repressor protein gene and the fatty acid transporter gene is selected from P tet ;
[0021] Wherein, the target protein gene may be a red fluorescent protein gene.
[0022] Step S201: transforming the first plasmid into Escherichia coli MG1655 strain to construct an engineered Escherichia coli containing an autoinduction system.
[0023] Among them, the fatty acid transporter gene is AlkL, the repressor protein gene of the quorum sensing system is luxR, and the target protein gene is mcherry, P lux It is a promoter that responds to the quorum sensing system.
[0024] In one embodiment, the first plasmid is pCOLADuet-P tet _luxR_AlkL-P lux _mcherry.
[0025] Specifically, after step S201, by adding exogenous signal molecules for testing, the fluorescence intensity of the engineered Escherichia coli in the constructed quorum sensing system is 2-3 times that of the control group. In addition, the sensitivity and expression uniformity of the expression system are improved. Figure 2 As shown, AlkL enhances the strength, sensitivity, and expression uniformity of the Lux system.
[0026] P lux The nucleotide sequence is shown in SEQ ID NO 1 below;
[0027] SEQ ID NO 1:acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa
[0028] The nucleotide sequence of AlkL is shown in SEQ ID NO 2;
[0029] SEQ ID NO 2:
[0030] TTAGAAAACGTAGCTCGCGCCCAGGCTCAGGATGAACGGATCAACTTCGATTTTGGTGCTAACCGGAACCGGGCCCAGGGTGCCGGTAACATCGGTTTTGAACGGGATGTAACGAACATCGCTGTTCAGCATCCAGCTGTTGCCCAGATCGTAACGCAGGCCAACCTGGAACGCCGGCGCCCATTTATCTTTGATATCGAAAGAGCTCAGCGCGCCATCGGTTTTATCGAAGAACAGAACACGACCAACACCAACGCCAACGTACGGGTACAGACGTTCGAAAGAATCGTAGTGGTACTGCAGGCTCAGGATCGCCGGGCCGTAATCAACTTCGCTAACACGGCCCAGAGAAGAGATGCTTTTTTCACCCTGGAATTTCGCACGCGCCGGAACGCCAACGAAGAAATCAACCGCGATGTTGCTGCTAACGAAGTACGCGATATCGAAGGTCAGGGTGGTATCGTTACCGATGCTAACATCCGCGTTCGGCAGCGCGCCGCCGCCAACGTTCAGATCGCCCAGTTCTTCGCCAACGTAAACTTTGCTGAAGTTGAAGCTCGCAACCCAATCGCCCTGGTTGTAGCCCGCGCTTTTCGCCGGGTAGTTTTCGTTCGCCCACGCGGTCGCCGCGCCCAGAACGAAGTTCGCAACCAGAACCGGCATCGCGATAACTTTGTAGTTGCTGAAGCTCAT
[0031] The nucleotide sequence of mcherry is shown in SEQ ID NO 3;
[0032] SEQ ID NO3:
[0033] ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGATGAACTATACAAATAA
[0034] The nucleotide sequence of luxR is shown in SEQ ID NO 4;
[0035] SEQ ID NO4:
[0036] TTAGTTTTTGAAGTACGGGCAATCGATCGCGCCGGTCAGGATCGCTTTGCTGATGCTCTGGCAGCGGTTGGTGGTGTTCAGTTTCATCTGCGCGTTGGTCAGGTGGAAGGTAACGGTACGTTCGCTGCAGCCCAGGATTTTAGAGATATCCCAGCTGGATTTGCCTTCGCACGCCCACGCCAGGCATTCTTTTTCACGTTTGGTCAGGTCGTTGTTGCTTTTGTTGTTCGCGATGTTGATTTTACGGTAGTTATCAACCAGGCTCGGAACGATCAGCGGGATGTTCATGCACGCGTGCAGGAACAGAGAATCGATGTAGTTGTCTTTTTCGCTGTGCGCGAAGCTCAGCATGCCGAAGCCGTTGTTCGCGGTGTGGATCGGGAAGCTGAAACCGGTGATCAGGCCGCTGGTTTTCGCTTCTTTGATAACGTTCGGGGATTTTTTGTTAACCGCGTTGTTTTCGAAGATGTTCCAGTTGATCGGGCTGTGGTTGCTGTTAGAGTAGTCCACGATCGGATCGTATTTGATCAGGTTCGCATCATCGTAGTACTGACGCCATTTTTTCGGGTAGTTGTCCAGGATGCTGATGTCGCTTTTCACCATGCTGTGCGGGTAGATGATCGCCAGCAGGTAGTATTCGCAGTGAACCATTTTGGTCATATCAGACAGGCACTGGTTGATATCGTTGTTGCTGCGGCACGCTTTGATTTTGTTGATGATACGGTAGGTATCATCCGCGTTGATGTTTTTCAT
[0037] P tet The nucleotide sequence of [P] is shown in SEQ ID NO 5;
[0038] SEQ ID NO5:
[0039] Tctctatcactgatagggatgtcaatctctatcactgataggga
[0040] The method for optimizing the performance of the LuxI / R quorum sensing system in Escherichia coli based on the AlkL transporter proposed in this embodiment is to transform the fatty acid transporter gene, the repressor protein gene of the quorum sensing system, the target protein gene, and the promoter P lux and promoter P tet The promoter for controlling the expression of the target protein gene is selected from P lux The promoter controlling the expression of the repressor protein gene and the fatty acid transporter gene is selected from P tet The first plasmid is transformed into the Escherichia coli MG1655 strain to construct an engineered Escherichia coli containing an autoinduction system, which can use the fatty acid transport protein AlkL to optimize the performance of the LuxI / R quorum sensing system heterologously expressed in Escherichia coli, including the strength, sensitivity and uniformity of expression of the quorum sensing system.
[0041] In one embodiment, the method for optimizing the performance of the LuxI / R quorum sensing system in Escherichia coli based on the AlkL transporter protein further comprises:
[0042] Step S201: Repressor protein gene, target protein gene, promoter P apFAB65 , promoter P lux , cloned into the pCOLADuet-1 vector to construct a second plasmid, wherein the promoter controlling the expression of the repressor protein gene is selected from P apFAB65 , the promoter controlling the expression of the target protein gene is selected from P lux ;
[0043] Step S202: constructing a third plasmid using the fatty acid transport protein and the pACYCDuet vector, wherein the promoter for controlling the expression of the fatty acid transport protein gene is selected from an arabinose-inducible promoter;
[0044] Step S203: construct a fourth plasmid by inducing the molecular synthetase and the pUC19 vector, wherein the promoter for inducing the expression of the molecular synthetase is P tet ;
[0045] Step S204: co-transform the second plasmid, the third plasmid and the fourth plasmid into Escherichia coli.
[0046] Among them, the induced molecule synthase is LuxI.
[0047] In one embodiment, the second plasmid is pCOLADuet-P apFAB65 _luxR-P lux _mcherry.
[0048] In one embodiment, the third plasmid is pACYCDuet-Para_BAD _AlkL.
[0049] In one embodiment, the fourth plasmid is pUC19-P tet _LuxI.
[0050] Specifically, Figure 3 As shown, it can be known that AlkL can relieve the inhibitory effect of the repressor protein luxR on the system.
[0051] P apFAB65 The nucleotide sequence is shown in SEQ ID NO 6;
[0052] SEQ ID NO 6:
[0053] Ttgacatcaggaaaatttttctgtataatgtgtggat
[0054] P ara_BAD The nucleotide sequence is shown in SEQ ID NO 7;
[0055] SEQ ID NO 7:
[0056]
[0057] The nucleotide sequence of LuxI is shown in SEQ ID NO 8;
[0058] SEQ ID NO 8:
[0059] ATGACCATCATGATCAAAAAATCTGATTTCCTGGCGATCCCGAGCGAAGAATACAAAGGCATCCTGAGCCTGCGTTACCAGGTTTTCAAACAGCGTCTGGAATGGGATCTGGTTGTTGAAAACAACCTGGAAAGCGATGAATACG ATAACAGCAACGCGGAATACATCTACGCGTGCGATGATACCGAAAACGTTAGCGGCTGCTGGCGTCTGCTGCCGACCACCGGCGATTACATGCTGAAAAGCGTTTTCCCGGAACTGCTGGGCCAGCAGAGCGCGCCGAAAGATCCG AACATCGTTGAACTGAGCCGTTTCGCGGTTGGCAAAAACAGCAGCAAAATCAACAACAGCGCGAGCGAAATCACCATGAAACTGTTCGAAGCGATCTACAAACACGCGGTTAGCCAGGGCATCACCGAATACGTTACCGTTACCA GCACCGCGATCGAACGTTTCCTGAAACGTATCAAAGTTCCGTGCCACCGTATCGGCGATAAAGAAATCCACGTTCTGGGCGATACCAAAAGCGTTGTTCTGAGCATGCCGATCAACGAACAGTTCAAAAAAGCGGTTCTGAACTAA
[0060] The method for optimizing the performance of the LuxI / R quorum sensing system in Escherichia coli based on the AlkL transporter proposed in this embodiment can transform the repressor protein gene, the target protein gene, the promoter P apFAB65 , promoter P lux , cloned into the pCOLADuet-1 vector to construct a second plasmid, wherein the promoter controlling the expression of the repressor protein gene is selected from P apFAB65 , the promoter controlling the expression of the target protein gene is selected from P luxThen, the third plasmid is constructed by using the fatty acid transporter and the pACYCDuet vector, wherein the promoter controlling the expression of the fatty acid transporter gene is selected from the arabinose inducible promoter, thereby constructing the fourth plasmid by inducing the molecular synthetase and the pUC19 vector, wherein the promoter for inducing the expression of the molecular synthetase is P tet Finally, the second plasmid, the third plasmid and the fourth plasmid are co-transformed into Escherichia coli, and the fatty acid transport protein AlkL can be used to weaken the inhibition of the Lux system by the LuxR repressor protein.
[0061] In one embodiment, the method for optimizing the performance of the LuxI / R quorum sensing system in Escherichia coli based on the AlkL transporter protein further comprises:
[0062] Step 301: The repressor protein gene, fatty acid transporter gene, target protein gene, promoter P tet and promoter P lux , cloned into the pCOLADuet-1 vector to form the fifth plasmid, wherein the promoter controlling the expression of the target protein gene is selected from P lux , the promoter controlling the expression of the repressor protein gene and the fatty acid transporter gene is selected from P tet ;
[0063] Step 302: constructing a sixth plasmid by using the inducible molecular synthetase and the vector pACYCDuet, wherein the RBS controlling the inducible molecular synthetase is selected as RBS1;
[0064] Step 303: constructing a seventh plasmid by using the inducible molecule synthetase and the vector pACYCDuet, wherein the RBS controlling the inducible molecule synthetase is selected as RBS2;
[0065] Step 304: constructing an eighth plasmid by using the inducible molecule synthetase and the vector pACYCDuet, wherein the RBS controlling the inducible molecule synthetase is selected as RBS3;
[0066] Step 305: The sixth plasmid, the seventh plasmid and the eighth plasmid are respectively transformed into the chassis cells containing the fifth plasmid to obtain a quorum sensing system induced by different cell concentrations.
[0067] Specifically, the sixth plasmid is transformed into the chassis cells containing the fifth plasmid, the seventh plasmid is transformed into the chassis cells containing the fifth plasmid, and the eighth plasmid is transformed into the chassis cells containing the fifth plasmid, thereby obtaining three quorum sensing systems induced by different cell concentrations. Figure 4 As shown, the effect diagram of the quorum sensing system induced by different cell concentrations, the flow chart and the comparison diagram with the stable phase promoter.
[0068] In one embodiment, the fifth plasmid is pCOLADuet-P tet _luxR_AlkL-P lux _mcherry.
[0069] In one embodiment, the sixth plasmid is pACYCDuet-P apFAB65 _RBS1_luxI, the seventh plasmid is pACYCDuet-P apFAB65 _RBS2_luxI.
[0070] In one embodiment, the eighth plasmid is pACYCDuet-P apFAB65 _RBS3_luxI.
[0071] The nucleotide sequence of the RBS1 is shown in SEQ ID NO 9;
[0072] SEQ ID NO 9: AAGGTGCGACA
[0073] The nucleotide sequence of the RBS2 is shown in SEQ ID NO 10;
[0074] SEQ ID NO 10: AAATGTCCCAAA
[0075] The nucleotide sequence of the RBS3 is shown in SEQ ID NO 11;
[0076] SEQ ID NO 11: AAATGTCCCAAA
[0077] The method for optimizing the performance of the LuxI / R quorum sensing system in Escherichia coli based on the AlkL transporter proposed in this embodiment is to transform the repressor protein gene, the fatty acid transporter protein gene, the target protein gene, the promoter P tet and promoter P lux , cloned into the pCOLADuet-1 vector to form the fifth plasmid, wherein the promoter controlling the expression of the target protein gene is selected from P lux , the promoter controlling the expression of the repressor protein gene and the fatty acid transporter gene is selected from P tetThen, the sixth plasmid is constructed by inducing molecular synthetase and vector pACYCDuet, wherein the RBS controlling the inducible molecular synthetase is selected as RBS1, and the seventh plasmid is constructed by inducing molecular synthetase and vector pACYCDuet, wherein the RBS controlling the inducible molecular synthetase is selected as RBS2, and then the eighth plasmid is constructed by inducing molecular synthetase and vector pACYCDuet, wherein the RBS controlling the inducible molecular synthetase is selected as RBS3, and finally the sixth plasmid, the seventh plasmid and the eighth plasmid are respectively transformed into chassis cells containing the fifth plasmid to obtain a quorum sensing system induced by different cell concentrations, and the quorum sensing system activated by different cell concentrations can be constructed by adjusting the amount of LuxI in the LuxI / R quorum sensing system in Escherichia coli.
[0078] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.
Claims
1. A method for optimizing the performance of LuxI / R quorum sensing system in Escherichia coli based on AlkL transporter. It is characterized in that The method for optimizing the performance of the LuxI / R quorum sensing system in Escherichia coli based on the AlkL transporter protein comprises: The fatty acid transporter gene, the repressor protein gene of the quorum sensing system, the target protein gene, and the promoter P lux and promoter P tet The promoter for controlling the expression of the target protein gene is selected from P lux The promoter controlling the expression of the repressor protein gene and the fatty acid transporter gene is selected from P tet ; The first plasmid was transformed into Escherichia coli MG1655 strain to construct an engineered Escherichia coli containing an autoinduction system.
2. The method for optimizing the performance of LuxI / R quorum sensing system in Escherichia coli based on AlkL transporter according to claim 1, It is characterized in that The method for optimizing the performance of the LuxI / R quorum sensing system in Escherichia coli based on the AlkL transporter protein also includes: The repressor protein gene, target protein gene, and promoter P apFAB65 , promoter P lux , cloned into the pCOLADuet-1 vector to construct a second plasmid, wherein the promoter controlling the expression of the repressor protein gene is selected from P apFAB65 , the promoter controlling the expression of the target protein gene is selected from P lux ; A third plasmid is constructed by using the fatty acid transporter and the pACYCDuet vector, wherein the promoter for controlling the expression of the fatty acid transporter gene is selected from an arabinose-inducible promoter; The fourth plasmid was constructed by inducing the molecular synthetase and the pUC19 vector, wherein the promoter for inducing the expression of the molecular synthetase was P tet ; The second plasmid, the third plasmid and the fourth plasmid are co-transformed into Escherichia coli.
3. The method for optimizing the performance of LuxI / R quorum sensing system in Escherichia coli based on AlkL transporter according to claim 2, It is characterized in that The third plasmid is pACYCDuet-P ara_BAD _AlkL.
4. The method for optimizing the performance of LuxI / R quorum sensing system in Escherichia coli based on AlkL transporter according to claim 2, It is characterized in that The fourth plasmid is pUC19-P tet _LuxI.
5. The method for optimizing the performance of LuxI / R quorum sensing system in Escherichia coli based on AlkL transporter according to claim 1, It is characterized in that The method for optimizing the performance of the LuxI / R quorum sensing system in Escherichia coli based on the AlkL transporter protein also includes: The repressor protein gene, fatty acid transporter protein gene, target protein gene, promoter P tet and promoter P lux , cloned into the pCOLADuet-1 vector to form the fifth plasmid, wherein the promoter controlling the expression of the target protein gene is selected from P lux , the promoter controlling the expression of the repressor protein gene and the fatty acid transporter gene is selected from P tet ; The sixth plasmid is constructed by using the inducible molecular synthetase and the vector pACYCDuet, wherein the RBS controlling the inducible molecular synthetase is selected as RBS1; The seventh plasmid is constructed by inducible molecular synthetase and vector pACYCDuet, wherein the RBS controlling the inducible molecular synthetase is selected as RBS2; The eighth plasmid is constructed by inducible molecular synthetase and vector pACYCDuet, wherein the RBS controlling the inducible molecular synthetase is selected as RBS3; The sixth plasmid, the seventh plasmid and the eighth plasmid are respectively transformed into the chassis cells containing the fifth plasmid to obtain a quorum sensing system induced by different cell concentrations.
6. The method for optimizing the performance of LuxI / R quorum sensing system in Escherichia coli based on AlkL transporter according to claim 5, It is characterized in that The sixth plasmid is pACYCDuet-P apFAB65 _RBS1_luxI, the seventh plasmid is pACYCDuet-P apFAB65 _RBS2_luxI.
7. The method for optimizing the performance of LuxI / R quorum sensing system in Escherichia coli based on AlkL transporter according to claim 5, It is characterized in that The eighth plasmid is pACYCDuet-P apFAB65 _RBS3_luxI.