Compositions and methods for driving T1 event diversity

Abstract

Systems and methods for generating a plurality of unique edits in a T1 seed of a plant are provided. In one example, a method includes transforming at least one expression cassette into a plant cell or plant tissue. The at least one expression cassette may comprise a nucleic acid encoding a DNA modifying enzyme; optionally, a nucleic acid encoding at least one guide RNA (gRNA); and a floral mosaic (FMOS) regulatory sequence wherein the FMOS regulatory sequence (i) mediates expression of the DNA modifying enzyme in at least one of a floral primordium cell and a floral reproductive organ, and (ii) mediates a plurality of edits in at least one of the floral primordium and the floral reproductive organ. The method may also include regenerating the plant cell or plant tissue into a TO plant having a plurality of T1 seeds, wherein the T1 seeds contain a plurality of unique edits.

Description

[0001] This application is a divisional application of an invention patent application with an application date of February 24, 2000, application number 202080016568.6, and invention name “Compositions and methods for driving T1 event diversity”.

[0002] Related Applications

[0003] This application claims priority to PCT / CN 2019 / 076062, filed on February 25, 2019, which is incorporated herein by reference in its entirety.

[0004] Sequence Listing

[0005] This application is accompanied by a sequence listing, which is designated as 81776-WO-PCT_Seq_ST25.txt, created on February 23, 2020, and is approximately 1,566 kb in size. This sequence listing is incorporated herein by reference in its entirety. This sequence listing is submitted with this application via EFS-Web and complies with 37 C.FR §1.824(a)(2)-(6) and (b). Background Art

[0006] The development of scientific methods to improve the quantity and quality of crops is a vital task. Gene editing (e.g., gene editing by targeted mutagenesis, insertion events, allele replacement, etc.) is a very important technology that is widely used to improve both the quantity and quality of various crops. There are currently many methods for editing specific gene targets, including clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated sequences (Cas) enzymes, transcription activator-like effector nucleases (TALENs), large-range nucleases, and zinc fingers. But gene editing is not always an easy task.

[0007] Editing to turn off gene function (often referred to as "knockout") can be accomplished relatively easily through genome editing. By using site-directed nucleases, such as the Cas9 enzyme and the associated CRISPR guide RNA (gRNA), small insertions or deletions ("indels") can be easily created in the coding sequence of the target gene, which often results in truncated proteins or frameshifts that produce abnormal sequences. Compared to these well-known gene knockout methods, implementing other types of editing (such as editing of alleles that cause partial loss of function or gain of function, or editing that changes the expression level of a gene or the function of a protein product) can be very labor-intensive. Many of these edits require allele replacement, which is very inefficient. Similarly, editing to delete entire exons or genes or chromosomal regions (large deletions) can be challenging because these edits may require cutting of more than one gRNA target site at the same time. Similarly, editing to introduce SNPs - for example, changing cytosine nucleotides to thymine nucleotides - can utilize "base editing" technology, but can only be performed in certain windows associated with the target site. There are only a few instances where achieving the desired editing outcome is challenging due to a lack of complete specificity or a lack of efficiency of the DNA modifying enzyme system used.

[0008] For allele replacement (sometimes also referred to as "allele swapping"), this is an editing method that utilizes homologous recombination or homology-directed repair to replace endogenous sequences in plant cells with new sequences that can be provided. Although this is fairly easy to do in yeast and many animal systems, it is very challenging in plants because DNA repair is very prone to non-homologous end joining pathways. In addition, this process requires the delivery of abundant donor DNA to the cleavage site as a template for DNA repair via homologous recombination. This delivery is not easy to accomplish, especially in plants. For this reason, allele replacement in plants is typically very expensive and labor-intensive. For example, if you want to transform a plant and perform allele replacement, you may need to generate a thousand stable transformation events to ensure that an allele exchange is produced in only one or two of these events. The efficiency is typically less than 1%, and in some cases, the efficiency is between 0% and 0.3%. Even in the best crops, strains, and construct designs, the efficiency is still very low.

[0009] The applicant believes that the cost and labor intensity of producing allele substitutions, large deletions, certain base editing, and various other editing results have become a major bottleneck in plant breeding. There are few methods to alleviate the extremely low efficiency of this process. Therefore, the present disclosure relates to at least one of these problems or additional problems.

[0010] In addition to allele replacement, another major challenge of genome editing is the time and labor required to prepare a wide variety of sequences (allele diversity of loci). For example, it is very time-consuming and expensive to produce a diversity allele array of a gene coding sequence or to produce expression diversity by modifying the regulatory region (promoter) of a gene. In many embodiments, the disclosure also relates to a cost-effective method for producing an allele series. Based on the detailed description below, these benefits and other benefits will be apparent. Summary of the invention

[0011] The present disclosure relates in particular to systems, compositions and methods for improving gene editing efficiency (e.g., for reducing the number of transformations required to produce multiple edits in plant DNA). In various embodiments, the present disclosure relates to methods for producing multiple unique edits (e.g., multiple unique allele substitutions, multiple unique base insertions, multiple unique base deletions and / or multiple unique base substitutions) in T1 seeds of a plant.

[0012] For example, these methods include transforming at least one expression cassette into a plant cell or plant tissue, wherein the at least one expression cassette comprises a nucleic acid encoding a DNA modification enzyme; a floral mosaic (FMOS) regulatory sequence; and optionally, a nucleic acid encoding at least one guide RNA (gRNA). The FMOS regulatory sequence mediates the expression of the DNA modification enzyme in at least one of the flower primordium cells and the flower reproductive organs (e.g., anthers or carpels), and mediates multiple edits in the flower primordium cells and the flower reproductive organs. The plant cells or tissues are then grown, pollinated, and a plurality of T1 seeds containing a plurality of unique edits are produced. The FMOS regulatory sequence will include a FMOS promoter, and in some embodiments, further includes a FMOS terminator.

[0013] The expression rate of the DNA modification enzyme may vary from embodiment to embodiment, but is significant in at least one of the floral primordium and the floral reproductive organ, particularly when vegetative growth is compared to mature seeds. For example, the expression rate in the floral primordium and / or the floral reproductive organ will be at least 2 times that in the leaf tissue or the shoot apical meristem (SAM), and the expression rate in the floral primordium and / or the floral reproductive organ will be at least 2 times that in the seed or callus. More typically, the expression rate will be even higher, for example, at least 10 times, at least 50 times, at least 100 times, at least 500 times or more, for example, at least 1000 times higher. In some embodiments, there will be no expression in one or both of the vegetative tissue or the seed.

[0014] Using the methods disclosed herein, multiple unique edits can be generated in T1 seeds. For example, the seeds of the T1 generation can contain at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95 unique edits.

[0015] The DNA modification enzyme selected can vary and can include, for example, a site-directed nuclease selected from the group consisting of: a meganuclease (MN); a zinc finger nuclease (ZFN); a transcription activator-like effector nuclease (TALEN); a Cas9 nuclease, a Cas12a (also referred to herein as "Cpf1") nuclease, a Cas12b nuclease, a Cas12i nuclease, a Cas12h nuclease, etc.; dCas9-FokI; dCpf1-FokI; an embedded chimeric Cas9-cytidine deaminase or chimeric Cas12a-cytidine deaminase; chimeric Cas9-adenine deaminase or chimeric Cas12a-adenine deaminase (AID); Cas9-EvolvR sequence or Cas12aEvolvR sequence (error-prone bacterial DNA polymerase I); chimeric FEN1-FokI, and Mega-TAL, nickase Cas9 (nCas9), chimeric dCas9 non-FokI nuclease and dCas12a non-FokI nuclease.

[0016] When multiple unique allele substitutions are produced, the at least one expression cassette may also include additional components including a target nucleic acid (also referred to herein as "donor DNA") to confer the desired allele. Additional features, such as a replicase (Rep or RepA) gene to drive replication of the donor DNA, may be used to assist in the replication of the donor DNA. In many instances, the donor DNA will be a component of a replicon that includes additional features, such as a long intergenic region (LIR) of a wheat dwarf virus (WDV) and a short intergenic region (SIR) derived, for example, from a wheat dwarf virus (WDV). Rep / RepA initiates rolling circle amplification of the donor DNA, which is located between the long intergenic region (LIR) and the short intergenic region (SIR) of the same virus, where genes for migration proteins and coat proteins are typically found.

[0017] In certain embodiments, the DNA modification enzyme is Cas9 nuclease or Cas12a nuclease and the at least one expression cassette includes the nucleic acid encoding gRNA. The nucleic acid encoding gRNA is operably connected to FMOS promoter or the second promoter. The at least one expression cassette may further include the target nucleic acid (donor DNA) and can be used for allele replacement editing. The at least one expression cassette may further include the replication promoter operably connected to the donor DNA to drive the replication of the donor DNA.

[0018] These methods may further include growing the T1 seeds to produce a plurality of T1 plants, measuring at least one phenotype in the plants of the T1 generation, and selecting the plants of the T1 generation based on the measured phenotypic differences driven by the unique editing. In some embodiments, these methods may include sequencing the insertion sites of the donor DNA, INDELs or SNPs in the selected plants of the T1 generation, sequencing the insertion sites of the donor DNA, INDELs or SNPs of the non-selected plants of the T1 generation, and aligning the sequences. The selected plants with the unique editing may also be crossed or selfed with plants without the unique editing to produce offspring with the unique editing.

[0019] In another embodiment, a method for producing multiple unique edits in the T1 seeds of a plant includes expressing a nucleic acid encoding a DNA modification enzyme and a nucleic acid encoding a guide RNA (gRNA) in a flower primordium cell or a flower reproductive organ. At least one of the nucleic acid encoding the DNA modification enzyme and the nucleic acid encoding the gRNA is operably linked to the FMOS promoter. The plant tissue is then regenerated into a plant having multiple T1 seeds, wherein the T1 seeds contain multiple unique edits. In this example, the method may further include delivering the donor DNA to a plant cell or plant tissue in which expression is performed, and inserting the donor DNA into the DNA of the plant, for example to produce, for example, an allele replacement with a gain of function or a functional replacement.

[0020] The present disclosure also relates to various compositions for improving gene editing efficiency. For example, one embodiment includes at least one expression cassette for producing unique editing in the T1 seeds of a plant. In this embodiment, the expression cassette includes a nucleic acid encoding a DNA modification enzyme, an optional nucleic acid encoding at least one guide RNA (gRNA) and a FMOS promoter. In another embodiment, the at least one expression cassette is contained in a vector.

[0021] In some embodiments, the present disclosure provides methods and compositions for changing the expression of a target gene in the seeds of a plant. Exemplary methods include a) transforming at least one expression cassette into a plant cell or plant tissue, wherein the at least one expression cassette comprises a nucleic acid encoding a DNA modification enzyme; a nucleic acid encoding at least one guide RNA (gRNA), wherein the at least one guide RNA targets a regulatory region of a target gene; and a floral mosaic (FMOS) regulatory sequence, wherein the FMOS regulatory sequence (i) mediates the expression of a DNA modification enzyme in at least one of a flower primordium cell and a flower reproductive organ, and (ii) mediates multiple edits in the regulatory region of a target gene in at least one of a flower primordium and a flower reproductive organ. Plant cells or plant tissues can be regenerated into a TO plant having multiple T1 seeds, wherein the T1 seeds contain multiple unique edits in the regulatory region of a target gene, thereby generating multiple target gene expression profiles.

[0022] In some embodiments, the present disclosure provides methods and compositions for generating variable knockout combinations in a gene regulatory network (GRN) having at least a first DNA encoding a first network member and a second DNA encoding a second network member. Exemplary methods include a) transforming at least one expression cassette into a plant cell or plant tissue, wherein the at least one expression cassette comprises a nucleic acid encoding a DNA modification enzyme; a nucleic acid encoding a first guide RNA (gRNA) that targets a first DNA encoding a first network member; a nucleic acid encoding a second guide RNA (gRNA) that targets a second DNA encoding a second network member; and a floral mosaic (FMOS) regulatory sequence, wherein the FMOS regulatory sequence (i) mediates the expression of a DNA modification enzyme in at least one of a flower primordium cell and a flower reproductive organ, and (ii) mediates multiple edits in at least one of a flower primordium and a flower reproductive organ. The plant cell or tissue can then be regenerated into a TO plant having multiple T1 seeds, wherein the T1 seeds contain multiple unique knockout combinations in the GRN.

[0023] In some embodiments, the present disclosure provides methods and compositions for producing multiple unique point mutations in T1 seeds of plants. Exemplary methods include a) transforming at least one expression cassette into a plant cell or plant tissue, wherein the at least one expression cassette comprises a nucleic acid encoding a catalytically inactive Cas (dCas); a nucleic acid encoding at least one guide RNA (gRNA), the guide RNA carrying an MS2 hairpin binding site; a nucleic acid encoding a deaminase; and a floral mosaic (FMOS) regulatory sequence, wherein the FMOS regulatory sequence (i) mediates the expression of a DNA modification enzyme in at least one of a flower primordium cell and a flower reproductive organ, and (ii) mediates multiple edits in at least one of a flower primordium and a flower reproductive organ. Plant cells or tissues can be regenerated into a TO plant with multiple T1 seeds, wherein the T1 seeds contain multiple unique point mutations. dCas may vary depending on the embodiment and may include, for example, an inactivated Cas9 (dCas9) or an inactivated Cas12a (dCas12a). An exemplary deaminase is an activation-induced cytidine deaminase (AID).

[0024] In other embodiments, a method for generating multiple unique point mutations in a T1 seed of a plant comprises a) transforming at least one expression cassette into a plant cell or plant tissue, wherein the at least one expression cassette comprises a nucleic acid encoding a nicking variant of Cas (nCas); a nucleic acid encoding a DNA polymerase (Pol); a nucleic acid encoding at least one guide RNA (gRNA); and a floral mosaic (FMOS) regulatory sequence, wherein the FMOS regulatory sequence (i) mediates the expression of nCas and Pol in at least one of a flower primordium cell and a flower reproductive organ, and (ii) mediates multiple edits in at least one of a flower primordium and a flower reproductive organ. The plant cell or tissue can be regenerated into a TO plant having multiple T1 seeds, wherein the T1 seeds contain multiple unique point mutations. nCas can be a nicking Cas9 (nCas9) or a cutting Cas12a (nCas12a), which can be fused to, for example, an encoded Pol. In many examples, nCas is nCas9 with a D10A mutation. In many examples, Pol is E. coli Pol, which may include at least one of the following mutations D424A, I709N, and A759R.

[0025] In some embodiments, the present disclosure provides compositions and methods for deleting large intergenic regions in T1 seeds of plants. Exemplary methods include a) transforming at least one expression cassette into a plant cell or plant tissue, wherein the at least one expression cassette comprises a nucleic acid encoding an RNA site-directed nuclease; a nucleic acid encoding at least one first guide RNA (gRNA-1); a nucleic acid encoding at least one second guide RNA (gRNA-2), wherein the gRNA-1 targets a first target sequence on a chromosome and wherein the gRNA-2 targets a second target sequence on a chromosome, wherein the first target sequence and the second target sequence are at least 0.1 Mb apart; and a floral mosaic (FMOS) regulatory sequence, wherein the FMOS regulatory sequence (i) mediates the expression of a DNA modification enzyme in at least one of a flower primordium cell and a flower reproductive organ, and (ii) mediates multiple edits in at least one of a flower primordium and a flower reproductive organ. Plant cells or tissues can be regenerated into a TO plant having multiple T1 seeds, wherein the T1 seeds contain at least one large intergenic deletion. The size of the large intergenic region may vary depending on the embodiment. For example, a large intergenic region may include at least one region in the range of at least one of 0.1-2 Mb, 0.2-1.9 Mb, 0.3-1.8 Mb, 0.4-1.7 Mb, 0.5-1.6 Mb, 0.6-1.5 Mb, 0.7-1.4 Mb, 0.7-1.3 Mb, 0.7-1.2 Mb, 0.3-1.1 Mb, 0.3-1.0 Mb, 0.4-1.0 Mb, 0.5-1.0 Mb, and 0.6-0.8 Mb. Similarly, the distance between the first target sequence and the second target sequence may vary depending on the embodiment. For example, the first target sequence and the second target sequence can be separated by at least one distance in the range of at least one of 0.1-2Mb, 0.2-1.9Mb, 0.3-1.8Mb, 0.4-1.7Mb, 0.5-1.6Mb, 0.6-1.5Mb, 0.7-1.4Mb, 0.7-1.3Mb, 0.7-1.2Mb, 0.3-1.1Mb, 0.3-1.0Mb, 0.4-1.0Mb, 0.5-1.0Mb and 0.6-0.8Mb. The nucleic acid encoding gRNA-1 is operably connected to the FMOS promoter or the second promoter, and the nucleic acid encoding gRNA-2 is operably connected to the FMOS promoter, to the second promoter, or to the third promoter.

[0026] In other embodiments, the disclosure provides additional compositions and methods for producing multiple unique edits in T1 seeds of plants. Exemplary methods include a) transforming at least one expression cassette into a plant cell or plant tissue, wherein the at least one expression cassette comprises a nucleic acid encoding an RNA site-directed nuclease; a nucleic acid encoding a guide RNA (gRNA); and a floral mosaic (FMOS) regulatory sequence comprising a FMOS promoter, wherein the FMOS regulatory sequence (i) mediates expression of the gRNA in at least one of a floral primordium cell and a floral reproductive organ, (ii) mediates multiple edits in at least one of a floral primordium and a floral reproductive organ, (iii) mediates at least two times more expression of the gRNA in at least one of a floral primordium and a floral reproductive organ than in a shoot apical meristem (SAM), at least three times more expression, at least four times more expression, at least five times more expression, and at least six times more expression, and (iv) mediates at least two times more expression of the gRNA in at least one of a floral primordium and a floral reproductive organ than in a seed, at least three times more expression, at least four times more expression, at least five times more expression, and at least six times more expression. The plant cell or tissue can be regenerated into a plant having multiple T1 seeds having multiple unique edits.

[0027] In some aspects, the disclosure provides a crop plant or seed thereof obtainable or obtained by the use or method of any one of the embodiments described herein. In some aspects, the disclosure provides a plant cell comprising at least one expression cassette as disclosed herein.

[0028] The above summary of the invention is intended to summarize certain embodiments of the present disclosure. The embodiments will be described in more detail in the tables and descriptions below. However, it will be clear that the detailed description of specific embodiments is not intended to limit the scope of the present invention.

[0029] Brief Description of Sequence Listing

[0030] SEQ ID NO: 1 is the nucleotide sequence of vector 24301.

[0031] SEQ ID NO: 2 is the nucleotide sequence of the promoter prZmAP1-01 in vector 24301.

[0032] SEQ ID NO: 3 is the nucleotide sequence of terminator tZmAP1-01 in vector 24301.

[0033] SEQ ID NO:4 is the nucleotide sequence of cCas9-02 in vector 24301.

[0034] SEQ ID NO:5 is the nucleotide sequence of rsgRNAZmADH1-01 in vector 24301.

[0035] SEQ ID NO: 6 is the nucleotide sequence of the ZmADH1 target in vector 24301.

[0036] SEQ ID NO:7 is the nucleotide sequence of rCrRNA-01 in vector 24301.

[0037] SEQ ID NO:8 is the nucleotide sequence of rTracrRNA-01 in vector 24301.

[0038] SEQ ID NO:9 is the nucleotide sequence of promoter prOsU3-01 in vector 24301.

[0039] SEQ ID NO: 10 is the nucleotide sequence of vector 24224 (control).

[0040] SEQ ID NO: 11 is the nucleotide sequence of Promoter_prCMP-04 in vector 24224.

[0041] SEQ ID NO:12 is the nucleotide sequence of terminator tNOS-05-01 in vector 24224.

[0042] SEQ ID NO:13 is the nucleotide sequence of Cas9 in vector 24224.

[0043] SEQ ID NO: 14 is the nucleotide sequence of rsgRNAZmADH1-01 in vector 24224.

[0044] SEQ ID NO: 15 is the nucleotide sequence of the ZmADH1 target in vector 24224.

[0045] SEQ ID NO: 16 is the nucleotide sequence of rCrRNA-01 in vector 24224.

[0046] SEQ ID NO: 17 is the nucleotide sequence of rTracrRNA-01 in vector 24224.

[0047] SEQ ID NO: 18 is the nucleotide sequence of promoter prOsU3-01 in vector 24224.

[0048] SEQ ID NO:19 is the nucleotide sequence of vector 24265.

[0049] SEQ ID NO: 20 is the nucleotide sequence of promoter prZmBde1-01 in vector 24265.

[0050] SEQ ID NO:21 is the nucleotide sequence of terminator tNOS-05-01 in vector 24265.

[0051] SEQ ID NO:22 is the nucleotide sequence of vector 24266.

[0052] SEQ ID NO: 23 is the nucleotide sequence of promoter prZmBde1-01 in vector 24266.

[0053] SEQ ID NO: 24 is the nucleotide sequence of terminator tZmBde1-01 in vector 24266.

[0054] SEQ ID NO:25 is the nucleotide sequence of vector 24269.

[0055] SEQ ID NO: 26 is the nucleotide sequence of promoter prZmAGO18A-01 in vector 24269.

[0056] SEQ ID NO: 27 is the nucleotide sequence of terminator tZmAGO18A-01 in vector 24269.

[0057] SEQ ID NO:28 is the nucleotide sequence of vector 24270.

[0058] SEQ ID NO: 29 is the nucleotide sequence of promoter prZmAGO5B-01 in vector 24270.

[0059] SEQ ID NO: 30 is the nucleotide sequence of terminator tZmAGO5B-01 in vector 24270.

[0060] SEQ ID NO:31 is the nucleotide sequence of vector 24289.

[0061] SEQ ID NO: 32 is the nucleotide sequence of promoter prZmAG5-02 in vector 24289.

[0062] SEQ ID NO: 33 is the nucleotide sequence of terminator tZmAG5-01 in vector 24289.

[0063] SEQ ID NO:34 is the nucleotide sequence of vector 24299.

[0064] SEQ ID NO: 35 is the nucleotide sequence of promoter prZmAG5-01 in vector 24299.

[0065] SEQ ID NO: 36 is the nucleotide sequence of terminator tZmAG5-01 in vector 24299.

[0066] SEQ ID NO: 37 is the nucleotide sequence of vector 24230.

[0067] SEQ ID NO: 38 is the nucleotide sequence of promoter prZmAGO18B-01 in vector 24230.

[0068] SEQ ID NO: 39 is the nucleotide sequence of terminator tZmAGO18B-01 in vector 24230.

[0069] SEQ ID NO:40 is the nucleotide sequence of vector 24243.

[0070] SEQ ID NO:41 is the nucleotide sequence of promoter prOsMEL1-01 in vector 24243.

[0071] SEQ ID NO:42 is the nucleotide sequence of terminator tOsMEL1-01 in vector 24243.

[0072] SEQ ID NO:43 is the nucleotide sequence of vector 24305.

[0073] SEQ ID NO:44 is the nucleotide sequence of promoter prOsMEL1-02 in vector 24305.

[0074] SEQ ID NO:45 is the nucleotide sequence of terminator tOsMEL1-01 in vector 24305.

[0075] SEQ ID NO:46 is the nucleotide sequence of vector 24306.

[0076] SEQ ID NO:47 is the nucleotide sequence of promoter prZmCoLig-01 in vector 24306.

[0077] SEQ ID NO:48 is the nucleotide sequence of terminator tZmCoLig-01 in vector 24306.

[0078] SEQ ID NO:49 is the nucleotide sequence of vector 24320.

[0079] SEQ ID NO: 50 is the nucleotide sequence of promoter prZmBde1-02 in vector 24320.

[0080] SEQ ID NO: 51 is the nucleotide sequence of terminator tZmBde1-01 in vector 24320.

[0081] SEQ ID NO:52 is the nucleotide sequence of vector 24426.

[0082] SEQ ID NO:53 is the nucleotide sequence of promoter prOsZFP-01 in vector 24426.

[0083] SEQ ID NO:54 is the nucleotide sequence of terminator tOsZFP-01 in vector 24426.

[0084] SEQ ID NO:55 is the nucleotide sequence of vector 24427.

[0085] SEQ ID NO:56 is the nucleotide sequence of promoter prZmAMS-01 in vector 24427.

[0086] SEQ ID NO:57 is the nucleotide sequence of terminator tZmAMS-01 in vector 24427.

[0087] SEQ ID NO:58 is the nucleotide sequence of vector 24428.

[0088] SEQ ID NO:59 is the nucleotide sequence of promoter prZmAMS-01 in vector 24428.

[0089] SEQ ID NO:60 is the nucleotide sequence of terminator tNOS-05-01 in vector 24428.

[0090] SEQ ID NO:61 is the nucleotide sequence of vector 24454.

[0091] SEQ ID NO:62 is the nucleotide sequence of promoter prZmExine1-01 in vector 24454.

[0092] SEQ ID NO:63 is the nucleotide sequence of terminator tZmExine1-01 in vector 244254.

[0093] SEQ ID NO:64 is the nucleotide sequence of vector 24455.

[0094] SEQ ID NO:65 is the nucleotide sequence of promoter prOsExine1-01 in vector 24455.

[0095] SEQ ID NO:66 is the nucleotide sequence of terminator tOsExine1-01 in vector 244255.

[0096] SEQ ID NO:67 is the nucleotide sequence of vector 24458.

[0097] SEQ ID NO:68 is the nucleotide sequence of promoter prZmAMS-01 in vector 24458.

[0098] SEQ ID NO:69 is the nucleotide sequence of terminator tNOS-05-01 in vector 244258.

[0099] SEQ ID NO:70 is the nucleotide sequence of vector 24459.

[0100] SEQ ID NO:71 is the nucleotide sequence of promoter prOsTBr1-01 in vector 24459.

[0101] SEQ ID NO:72 is the nucleotide sequence of terminator tOsTBr1-01 in vector 24429.

[0102] SEQ ID NO:73 is the nucleotide sequence of vector 24460.

[0103] SEQ ID NO: 74 is the nucleotide sequence of promoter prOsAP1-01 in vector 24460.

[0104] SEQ ID NO:75 is the nucleotide sequence of terminator tOsAP1-01 in vector 24460.

[0105] SEQ ID NO:76 is the nucleotide sequence of vector 24548.

[0106] SEQ ID NO: 77 is the nucleotide sequence of promoter prZmRa2-02 in vector 24548.

[0107] SEQ ID NO:78 is the nucleotide sequence of terminator tZmRa2-02 in vector 24548.

[0108] SEQ ID NO:79 is the nucleotide sequence of vector 24602.

[0109] SEQ ID NO: 80 is the nucleotide sequence of the promoter prOsCoLig-01 in vector 24602.

[0110] SEQ ID NO:81 is the nucleotide sequence of terminator tOsCoLig-01 in vector 24602.

[0111] SEQ ID NO:82 is the nucleotide sequence of vector 24688.

[0112] SEQ ID NO:83 is the nucleotide sequence of promoter prZmWUS2-01 in vector 24688.

[0113] SEQ ID NO:84 is the nucleotide sequence of terminator tZmWUS2-01 in vector 24688.

[0114] SEQ ID NO:85 is the nucleotide sequence of vector 24300.

[0115] SEQ ID NO: 86 is the nucleotide sequence of promoter prZmAGO18B-01 in vector 24300.

[0116] SEQ ID NO: 87 is the nucleotide sequence of terminator tZmAGO18B-01 in vector 24300.

[0117] SEQ ID NO:88 is the nucleotide sequence of vector 25123.

[0118] SEQ ID NO:89 is the nucleotide sequence of promoter prZmBde1-02 in vector 25123.

[0119] SEQ ID NO:90 is the nucleotide sequence of terminator tZmBde1-01 in vector 25123.

[0120] SEQ ID NO:91 is the nucleotide sequence of promoter prOsU3-1 in vector 25123.

[0121] SEQ ID NO:92 is the nucleotide sequence of intron iZmBde1-01 in vector 25123.

[0122] SEQ ID NO:93 is the nucleotide sequence of xNLS-01 in vector 25123.

[0123] SEQ ID NO:94 is the nucleotide sequence of xALS target-01 in vector 25123.

[0124] SEQ ID NO:95 is the nucleotide sequence of the ALS target in vector 25123.

[0125] SEQ ID NO:96 is the nucleotide sequence of the ALS target in vector 25123.

[0126] SEQ ID NO:97 is the nucleotide sequence of xZmALS-V2 in vector 25123 (donor DNA).

[0127] SEQ ID NO:98 is the nucleotide sequence of rsgRNAZmALS-V1 in vector 25123.

[0128] SEQ ID NO:99 is the nucleotide sequence of rCrRNA-01 in vector 25123.

[0129] SEQ ID NO:100 is the nucleotide sequence of rTracrRNA-01 in vector 25123.

[0130] SEQ ID NO:101 is the nucleotide sequence of promoter prOsU3-01 in vector 25123.

[0131] SEQ ID NO: 102 is the nucleotide sequence of Cas9 in 25123. SEQ ID NO: 103 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 1).

[0132] SEQ ID NO: 104 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 1a).

[0133] SEQ ID NO: 105 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 2).

[0134] SEQ ID NO: 106 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 2a).

[0135] SEQ ID NO: 107 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 3).

[0136] SEQ ID NO: 108 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 4).

[0137] SEQ ID NO: 109 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 5).

[0138] SEQ ID NO: 110 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 6).

[0139] SEQ ID NO: 111 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 6a).

[0140] SEQ ID NO: 112 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 7).

[0141] SEQ ID NO: 113 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 7a).

[0142] SEQ ID NO: 114 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 8).

[0143] SEQ ID NO: 115 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 9).

[0144] SEQ ID NO: 116 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 10).

[0145] SEQ ID NO: 117 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 10a).

[0146] SEQ ID NO: 118 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 12).

[0147] SEQ ID NO: 119 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 12a).

[0148] SEQ ID NO: 120 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 14).

[0149] SEQ ID NO: 121 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 14a).

[0150] SEQ ID NO: 122 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 15).

[0151] SEQ ID NO: 123 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 16).

[0152] SEQ ID NO: 124 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 16a).

[0153] SEQ ID NO: 125 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 17).

[0154] SEQ ID NO: 126 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 17a).

[0155] SEQ ID NO: 127 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 19).

[0156] SEQ ID NO: 128 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 19a).

[0157] SEQ ID NO: 129 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 19b).

[0158] SEQ ID NO: 130 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 20).

[0159] SEQ ID NO: 131 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 21).

[0160] SEQ ID NO: 132 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 21a).

[0161] SEQ ID NO: 133 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 22).

[0162] SEQ ID NO: 134 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 22a).

[0163] SEQ ID NO: 135 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 23).

[0164] SEQ ID NO: 136 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 23a).

[0165] SEQ ID NO: 137 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 23b).

[0166] SEQ ID NO: 138 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 24).

[0167] SEQ ID NO: 139 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 24a).

[0168] SEQ ID NO: 140 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 24b).

[0169] SEQ ID NO: 141 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 25).

[0170] SEQ ID NO: 142 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 25a).

[0171] SEQ ID NO: 143 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 26).

[0172] SEQ ID NO: 144 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 26a).

[0173] SEQ ID NO: 145 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 27).

[0174] SEQ ID NO: 146 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 28).

[0175] SEQ ID NO: 147 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 28a).

[0176] SEQ ID NO: 148 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 29).

[0177] SEQ ID NO: 149 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 29a).

[0178] SEQ ID NO: 150 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 30).

[0179] SEQ ID NO: 151 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 30a).

[0180] SEQ ID NO: 152 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 31).

[0181] SEQ ID NO: 153 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 32).

[0182] SEQ ID NO: 154 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 32a).

[0183] SEQ ID NO: 155 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 33).

[0184] SEQ ID NO: 156 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 33a).

[0185] SEQ ID NO: 157 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 34).

[0186] SEQ ID NO: 158 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 34a).

[0187] SEQ ID NO: 159 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 35).

[0188] SEQ ID NO: 160 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 35a).

[0189] SEQ ID NO: 161 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 36).

[0190] SEQ ID NO: 162 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 36a).

[0191] SEQ ID NO: 163 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 37).

[0192] SEQ ID NO: 164 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 37a).

[0193] SEQ ID NO: 165 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 38).

[0194] SEQ ID NO: 166 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 38a).

[0195] SEQ ID NO: 167 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 39).

[0196] SEQ ID NO: 168 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 39a).

[0197] SEQ ID NO: 169 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 40).

[0198] SEQ ID NO: 170 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 40a).

[0199] SEQ ID NO: 171 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 41).

[0200] SEQ ID NO: 172 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 42).

[0201] SEQ ID NO: 173 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 42a).

[0202] SEQ ID NO: 174 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 43).

[0203] SEQ ID NO: 175 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 44).

[0204] SEQ ID NO: 176 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 44a).

[0205] SEQ ID NO: 177 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 45).

[0206] SEQ ID NO: 178 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 45a).

[0207] SEQ ID NO: 179 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 46).

[0208] SEQ ID NO: 180 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 47).

[0209] SEQ ID NO: 181 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 47a).

[0210] SEQ ID NO: 182 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 48).

[0211] SEQ ID NO: 183 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 49).

[0212] SEQ ID NO: 184 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 49a).

[0213] SEQ ID NO: 185 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 50).

[0214] SEQ ID NO: 186 is the nucleotide sequence of vector AR-SDN2_REP_NoCut.

[0215] SEQ ID NO: 187 is the nucleotide sequence of vector AR-SDN2_REP_2Cuts.

[0216] SEQ ID NO: 188 is the nucleotide sequence of vector AR-SDN2_REP_1Cut.

[0217] SEQ ID NO: 189 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 13).

[0218] SEQ ID NO: 190 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 1a).

[0219] SEQ ID NO: 191 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 1b).

[0220] SEQ ID NO: 192 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 2a).

[0221] SEQ ID NO: 193 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 2b).

[0222] SEQ ID NO: 194 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 3).

[0223] SEQ ID NO: 195 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 4a).

[0224] SEQ ID NO: 196 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 4b).

[0225] SEQ ID NO: 197 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 5a).

[0226] SEQ ID NO: 198 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 5b).

[0227] SEQ ID NO: 199 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 6).

[0228] SEQ ID NO: 200 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 7a).

[0229] SEQ ID NO: 201 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 7b).

[0230] SEQ ID NO: 202 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 8a).

[0231] SEQ ID NO: 203 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 8b).

[0232] SEQ ID NO: 204 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 9a).

[0233] SEQ ID NO: 205 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 9b).

[0234] SEQ ID NO: 206 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 10).

[0235] SEQ ID NO: 207 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 11a).

[0236] SEQ ID NO: 208 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 11b).

[0237] SEQ ID NO: 209 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 12).

[0238] SEQ ID NO: 210 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 13a).

[0239] SEQ ID NO: 211 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 13b).

[0240] SEQ ID NO: 212 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 14).

[0241] SEQ ID NO: 213 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 15).

[0242] SEQ ID NO: 214 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 16a).

[0243] SEQ ID NO: 215 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 16b).

[0244] SEQ ID NO: 216 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 17a).

[0245] SEQ ID NO: 217 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 17b).

[0246] SEQ ID NO: 218 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 18a).

[0247] SEQ ID NO: 219 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 18b).

[0248] SEQ ID NO: 220 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 19).

[0249] SEQ ID NO: 221 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 20a).

[0250] SEQ ID NO: 222 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 20b).

[0251] SEQ ID NO: 223 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 21).

[0252] SEQ ID NO: 224 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 1a).

[0253] SEQ ID NO: 225 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 1b).

[0254] SEQ ID NO: 226 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 2a).

[0255] SEQ ID NO: 227 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 2b).

[0256] SEQ ID NO: 228 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 3).

[0257] SEQ ID NO: 229 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 4a).

[0258] SEQ ID NO: 230 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 4b).

[0259] SEQ ID NO: 231 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 5a).

[0260] SEQ ID NO: 232 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 5b).

[0261] SEQ ID NO: 233 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 6a).

[0262] SEQ ID NO: 234 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 6b).

[0263] SEQ ID NO: 235 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 7a).

[0264] SEQ ID NO: 236 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 7b).

[0265] SEQ ID NO: 237 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 8a).

[0266] SEQ ID NO: 238 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 8b).

[0267] SEQ ID NO: 239 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 1).

[0268] SEQ ID NO: 240 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 2a).

[0269] SEQ ID NO: 241 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 2b).

[0270] SEQ ID NO: 242 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 3a).

[0271] SEQ ID NO: 243 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 3b).

[0272] SEQ ID NO: 244 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 4a).

[0273] SEQ ID NO: 245 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 4b).

[0274] SEQ ID NO: 246 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 5a).

[0275] SEQ ID NO: 247 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 5b).

[0276] SEQ ID NO: 248 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 6a).

[0277] SEQ ID NO: 249 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 6b).

[0278] SEQ ID NO: 250 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 7a).

[0279] SEQ ID NO: 251 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 7b).

[0280] SEQ ID NO: 252 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 8a).

[0281] SEQ ID NO: 253 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 8b).

[0282] SEQ ID NO: 254 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 9a).

[0283] SEQ ID NO: 255 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 9b).

[0284] SEQ ID NO: 256 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 10a).

[0285] SEQ ID NO: 257 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 10b).

[0286] SEQ ID NO: 258 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 11a).

[0287] SEQ ID NO: 259 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 11b).

[0288] SEQ ID NO: 260 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 1a).

[0289] SEQ ID NO: 261 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 1b).

[0290] SEQ ID NO: 262 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 2a).

[0291] SEQ ID NO: 263 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 2b).

[0292] SEQ ID NO: 264 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 3a).

[0293] SEQ ID NO: 265 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 3b).

[0294] SEQ ID NO: 266 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 4a).

[0295] SEQ ID NO: 267 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 4b).

[0296] SEQ ID NO: 268 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 5a).

[0297] SEQ ID NO: 269 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 5b).

[0298] SEQ ID NO: 270 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 6a).

[0299] SEQ ID NO: 271 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 6b).

[0300] SEQ ID NO: 272 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 7a).

[0301] SEQ ID NO: 273 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 7b).

[0302] SEQ ID NO: 274 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 8a).

[0303] SEQ ID NO: 275 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 8b).

[0304] SEQ ID NO: 276 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 9a).

[0305] SEQ ID NO: 277 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 9b).

[0306] SEQ ID NO: 278 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 10a).

[0307] SEQ ID NO: 279 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 10b).

[0308] SEQ ID NO: 280 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 11).

[0309] SEQ ID NO: 281 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 12a).

[0310] SEQ ID NO: 282 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 12b).

[0311] SEQ ID NO: 283 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 13).

[0312] SEQ ID NO: 284 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 14a).

[0313] SEQ ID NO: 285 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 14b).

[0314] SEQ ID NO: 286 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 15a).

[0315] SEQ ID NO: 287 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 15b).

[0316] SEQ ID NO: 288 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 16a).

[0317] SEQ ID NO: 289 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 16b).

[0318] SEQ ID NO: 290 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 17a).

[0319] SEQ ID NO: 291 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 17b).

[0320] SEQ ID NO: 292 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 18a).

[0321] SEQ ID NO: 293 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 18b).

[0322] SEQ ID NO: 294 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 19a).

[0323] SEQ ID NO: 295 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 19b).

[0324] SEQ ID NO: 296 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 20a).

[0325] SEQ ID NO: 297 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 20b).

[0326] SEQ ID NO: 298 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 21a).

[0327] SEQ ID NO: 299 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 21b).

[0328] SEQ ID NO: 300 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 22).

[0329] SEQ ID NO: 301 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 23a).

[0330] SEQ ID NO:302 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 23b).

[0331] SEQ ID NO:303 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 24).

[0332] SEQ ID NO:304 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 25a).

[0333] SEQ ID NO:305 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 25b).

[0334] SEQ ID NO:306 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 26a).

[0335] SEQ ID NO:307 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 26b).

[0336] SEQ ID NO:308 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 27a).

[0337] SEQ ID NO:309 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 27b).

[0338] SEQ ID NO:310 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 28a).

[0339] SEQ ID NO:311 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 28b).

[0340] SEQ ID NO:312 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 29a).

[0341] SEQ ID NO:313 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 29b).

[0342] SEQ ID NO:314 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 1).

[0343] SEQ ID NO:315 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 2a).

[0344] SEQ ID NO:316 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 2b).

[0345] SEQ ID NO:317 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 3a).

[0346] SEQ ID NO:318 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 3b).

[0347] SEQ ID NO:319 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 4).

[0348] SEQ ID NO: 320 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 5a).

[0349] SEQ ID NO:321 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 5b).

[0350] SEQ ID NO:322 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 6a).

[0351] SEQ ID NO:323 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 6b).

[0352] SEQ ID NO: 324 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 7a).

[0353] SEQ ID NO:325 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 7b).

[0354] SEQ ID NO:326 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 8a).

[0355] SEQ ID NO:327 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 8b).

[0356] SEQ ID NO:328 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 9a).

[0357] SEQ ID NO:329 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 9b).

[0358] SEQ ID NO: 330 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 10a).

[0359] SEQ ID NO:331 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 10b).

[0360] SEQ ID NO: 332 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 11a).

[0361] SEQ ID NO: 333 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 11b).

[0362] SEQ ID NO: 334 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 12a).

[0363] SEQ ID NO:335 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 12b).

[0364] SEQ ID NO:336 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 13a).

[0365] SEQ ID NO:337 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 13b).

[0366] SEQ ID NO:338 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 14a).

[0367] SEQ ID NO:339 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 14b).

[0368] SEQ ID NO: 340 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 15a).

[0369] SEQ ID NO:341 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 15b).

[0370] SEQ ID NO:342 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 16a).

[0371] SEQ ID NO:343 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 16b).

[0372] SEQ ID NO:344 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 17a).

[0373] SEQ ID NO:345 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 17b).

[0374] SEQ ID NO:346 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 18).

[0375] SEQ ID NO:347 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 19a).

[0376] SEQ ID NO:348 is the edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 19b).

[0377] SEQ ID NO: 349 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 1a).

[0378] SEQ ID NO: 350 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 1b).

[0379] SEQ ID NO:351 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 2a).

[0380] SEQ ID NO:352 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 2b).

[0381] SEQ ID NO:353 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 3a).

[0382] SEQ ID NO:354 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 3b).

[0383] SEQ ID NO:355 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 4a).

[0384] SEQ ID NO:356 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 4b).

[0385] SEQ ID NO:357 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 5a).

[0386] SEQ ID NO:358 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 5b).

[0387] SEQ ID NO:359 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 6a).

[0388] SEQ ID NO: 360 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 6b).

[0389] SEQ ID NO:361 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 7a).

[0390] SEQ ID NO:362 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 7b).

[0391] SEQ ID NO: 363 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 8).

[0392] SEQ ID NO:364 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 9a).

[0393] SEQ ID NO:365 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 9b).

[0394] SEQ ID NO:366 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 10).

[0395] SEQ ID NO:367 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 11).

[0396] SEQ ID NO:368 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 12a).

[0397] SEQ ID NO:369 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 12b).

[0398] SEQ ID NO: 370 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 13a).

[0399] SEQ ID NO:371 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 13b).

[0400] SEQ ID NO: 372 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 14).

[0401] SEQ ID NO: 373 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 15a).

[0402] SEQ ID NO:374 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 15b).

[0403] SEQ ID NO:375 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 16a).

[0404] SEQ ID NO:376 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 16b).

[0405] SEQ ID NO: 377 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 17).

[0406] SEQ ID NO: 378 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 1a).

[0407] SEQ ID NO: 379 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 1b).

[0408] SEQ ID NO: 380 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 2a).

[0409] SEQ ID NO:381 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 2b).

[0410] SEQ ID NO: 382 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 3a).

[0411] SEQ ID NO: 383 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 3b).

[0412] SEQ ID NO: 384 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 4a).

[0413] SEQ ID NO:385 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 4b).

[0414] SEQ ID NO: 386 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 5).

[0415] SEQ ID NO:387 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 6a).

[0416] SEQ ID NO:388 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 6b).

[0417] SEQ ID NO:389 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 7a).

[0418] SEQ ID NO: 390 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 7b).

[0419] SEQ ID NO: 391 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 8a).

[0420] SEQ ID NO: 392 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 8b).

[0421] SEQ ID NO: 393 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 9a).

[0422] SEQ ID NO: 394 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 9b).

[0423] SEQ ID NO: 395 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 10).

[0424] SEQ ID NO:396 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 11a).

[0425] SEQ ID NO: 397 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 11b).

[0426] SEQ ID NO: 398 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 12a).

[0427] SEQ ID NO: 399 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 12b).

[0428] SEQ ID NO: 400 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 13a).

[0429] SEQ ID NO:401 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 13b).

[0430] SEQ ID NO:402 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 14a).

[0431] SEQ ID NO:403 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 14b).

[0432] SEQ ID NO:404 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 15).

[0433] SEQ ID NO:405 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 16a).

[0434] SEQ ID NO:406 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 16b).

[0435] SEQ ID NO:407 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 17a).

[0436] SEQ ID NO:408 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 17b).

[0437] SEQ ID NO:409 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 18a).

[0438] SEQ ID NO:410 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 18b).

[0439] SEQ ID NO:411 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 19a).

[0440] SEQ ID NO:412 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 19b).

[0441] SEQ ID NO:413 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 20a).

[0442] SEQ ID NO:414 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 20b).

[0443] SEQ ID NO:415 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 21a).

[0444] SEQ ID NO:416 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 21b).

[0445] SEQ ID NO:417 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 22a).

[0446] SEQ ID NO:418 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 22b).

[0447] SEQ ID NO:419 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 23a).

[0448] SEQ ID NO:420 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 23b).

[0449] SEQ ID NO:421 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 24a).

[0450] SEQ ID NO:422 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 24b).

[0451] SEQ ID NO:423 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 1a).

[0452] SEQ ID NO:424 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 1b).

[0453] SEQ ID NO:425 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 2a).

[0454] SEQ ID NO:426 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 2b).

[0455] SEQ ID NO:427 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 3a).

[0456] SEQ ID NO:428 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 3b).

[0457] SEQ ID NO:429 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 4a).

[0458] SEQ ID NO:430 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 4b).

[0459] SEQ ID NO:431 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 5a).

[0460] SEQ ID NO:432 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 5b).

[0461] SEQ ID NO:433 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 6).

[0462] SEQ ID NO:434 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 7a).

[0463] SEQ ID NO:435 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 7b).

[0464] SEQ ID NO:436 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 8a).

[0465] SEQ ID NO:437 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 8b).

[0466] SEQ ID NO:438 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 9a).

[0467] SEQ ID NO:439 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 9b).

[0468] SEQ ID NO:440 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 10a).

[0469] SEQ ID NO:441 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 10b).

[0470] SEQ ID NO:442 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 11a).

[0471] SEQ ID NO:443 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 11b).

[0472] SEQ ID NO:444 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 12a).

[0473] SEQ ID NO:445 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 12b).

[0474] SEQ ID NO:446 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 13a).

[0475] SEQ ID NO:447 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 13b).

[0476] SEQ ID NO:448 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 14a).

[0477] SEQ ID NO:449 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 14b).

[0478] SEQ ID NO:450 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 15).

[0479] SEQ ID NO:451 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 16a).

[0480] SEQ ID NO:452 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 16b).

[0481] SEQ ID NO:453 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 17).

[0482] SEQ ID NO:454 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 18a).

[0483] SEQ ID NO:455 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 18b).

[0484] SEQ ID NO:456 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 19).

[0485] SEQ ID NO:457 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 1a).

[0486] SEQ ID NO:458 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 1b).

[0487] SEQ ID NO:459 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 2a).

[0488] SEQ ID NO:460 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 2b).

[0489] SEQ ID NO:461 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 3a).

[0490] SEQ ID NO:462 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 3b).

[0491] SEQ ID NO:463 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 4).

[0492] SEQ ID NO:464 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 4a).

[0493] SEQ ID NO:465 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 4b).

[0494] SEQ ID NO:466 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 5).

[0495] SEQ ID NO:467 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 6a).

[0496] SEQ ID NO:468 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 6b).

[0497] SEQ ID NO:469 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 7).

[0498] SEQ ID NO:470 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 8).

[0499] SEQ ID NO:471 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 9a).

[0500] SEQ ID NO:472 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 9b).

[0501] SEQ ID NO:473 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 10a).

[0502] SEQ ID NO:474 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 10b).

[0503] SEQ ID NO:475 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 11a).

[0504] SEQ ID NO:476 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 11b).

[0505] SEQ ID NO:477 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 12a).

[0506] SEQ ID NO:478 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 12b).

[0507] SEQ ID NO:479 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 1a).

[0508] SEQ ID NO: 480 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 1b).

[0509] SEQ ID NO:481 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 2a).

[0510] SEQ ID NO:482 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 2b).

[0511] SEQ ID NO:483 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 3a).

[0512] SEQ ID NO:484 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 3b).

[0513] SEQ ID NO:485 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 4a).

[0514] SEQ ID NO:486 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 4b).

[0515] SEQ ID NO:487 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 5a).

[0516] SEQ ID NO:488 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 5b).

[0517] SEQ ID NO:489 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 6).

[0518] SEQ ID NO:490 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 7a).

[0519] SEQ ID NO:491 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 7b).

[0520] SEQ ID NO:492 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 8a).

[0521] SEQ ID NO:493 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 8b).

[0522] SEQ ID NO:494 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 9a).

[0523] SEQ ID NO:495 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 9b).

[0524] SEQ ID NO:496 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 10a).

[0525] SEQ ID NO:497 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 10b).

[0526] SEQ ID NO:498 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 11).

[0527] SEQ ID NO:499 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 12a).

[0528] SEQ ID NO:500 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 12b).

[0529] SEQ ID NO:501 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 13a).

[0530] SEQ ID NO:502 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 13b).

[0531] SEQ ID NO:503 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 14a).

[0532] SEQ ID NO:504 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 14b).

[0533] SEQ ID NO:505 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 15a).

[0534] SEQ ID NO:506 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 15b).

[0535] SEQ ID NO:507 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 16a).

[0536] SEQ ID NO:508 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 16b).

[0537] SEQ ID NO:509 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 17a).

[0538] SEQ ID NO:510 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 17b).

[0539] SEQ ID NO:511 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 18a).

[0540] SEQ ID NO:512 is the edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 18b).

[0541] SEQ ID NO:513 is the nucleotide sequence of vector 24857.

[0542] SEQ ID NO:514 is the nucleotide sequence of prGmMADS28-01 (FMOS promoter) in soybean.

[0543] SEQ ID NO:515 is the nucleotide sequence of tGmMADS28-01 (FMOS terminator) in soybean.

[0544] SEQ ID NO:516 is the nucleotide sequence of vector 24905 (control) containing the soybean constitutive promoter.

[0545] SEQ ID NO:517 is the nucleotide sequence of vector 24925.

[0546] SEQ ID NO:518 is the nucleotide sequence of prGmMMD1-01 (FMOS promoter) in soybean.

[0547] SEQ ID NO:519 is the nucleotide sequence of tGmMMD1-01 (FMOS terminator) in soybean.

[0548] SEQ ID NO: 520 is the nucleotide sequence of gRNA1 targeting the first exon in soybean GmCenH3 in vectors 24857 and 24905.

[0549] SEQ ID NO: 521 is the nucleotide sequence of gRNA2 targeting exon 4 in soybean GmCenH3 in vectors 24857 and 24905.

[0550] SEQ ID NO:522 is the nucleotide sequence of the sense primer in the CP4 assay.

[0551] SEQ ID NO:523 is the nucleotide sequence of the antisense primer in the CP4 assay.

[0552] SEQ ID NO:524 is the nucleotide sequence of the probe in the CP4 assay.

[0553] SEQ ID NO:525 is the nucleotide sequence of the sense primer in the Cas assay.

[0554] SEQ ID NO:526 is the nucleotide sequence of the antisense primer in the Cas assay.

[0555] SEQ ID NO:527 is the nucleotide sequence of the probe in the Cas assay.

[0556] SEQ ID NO:528 is the nucleotide sequence of the forward primer in the Cas assay.

[0557] SEQ ID NO:529 is the nucleotide sequence of the reverse primer in the Cas assay.

[0558] SEQ ID NO:530 is the nucleotide sequence of the probe in the Cas assay.

[0559] SEQ ID NO:531 is the nucleotide sequence of intron iUbil-07 of the ubiquitin promoter prUbil-18.

[0560] SEQ ID NO:532 is the nucleotide sequence of Cas12a.

[0561] SEQ ID NO:533 is the nucleotide sequence of vector 25053.

[0562] SEQ ID NO:534 is the nucleotide sequence of vector 25074.

[0563] SEQ ID NO:535 is the nucleotide sequence of vector 25068.

[0564] SEQ ID NO:536 is the nucleotide sequence of vector 25069.

[0565] SEQ ID NO:537 is the nucleotide sequence of vector 24997.

[0566] SEQ ID NO:538 is the nucleotide sequence of vector 25002.

[0567] SEQ ID NO:539 is the nucleotide sequence of vector 25003.

[0568] SEQ ID NO:540 is the nucleotide sequence of vector 25004.

[0569] SEQ ID NO:541 is the nucleotide sequence of vector 25005.

[0570] SEQ ID NO:542 is the nucleotide sequence of vector 25006.

[0571] SEQ ID NO:543 is the nucleotide sequence of vector 25007.

[0572] SEQ ID NO:544 is the nucleotide sequence of vector 25008.

[0573] SEQ ID NO:545 is the nucleotide sequence of vector 25009.

[0574] SEQ ID NO:546 is the nucleotide sequence of a primer used for Adh1 editing analysis.

[0575] SEQ ID NO:547 is the nucleotide sequence of a primer used for Adh1 editing analysis.

[0576] SEQ ID NO:548 is the nucleotide sequence for Adh1 target reference.

[0577] SEQ ID NO:549 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 1).

[0578] SEQ ID NO:550 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 1).

[0579] SEQ ID NO:551 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 2).

[0580] SEQ ID NO:552 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 2).

[0581] SEQ ID NO:553 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 3).

[0582] SEQ ID NO:554 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 3).

[0583] SEQ ID NO:555 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 4).

[0584] SEQ ID NO:556 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 4).

[0585] SEQ ID NO:557 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 5).

[0586] SEQ ID NO:558 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 6).

[0587] SEQ ID NO:559 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 6).

[0588] SEQ ID NO:560 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 7).

[0589] SEQ ID NO:561 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 7).

[0590] SEQ ID NO:562 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 8).

[0591] SEQ ID NO:563 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 8).

[0592] SEQ ID NO:564 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 9).

[0593] SEQ ID NO:565 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 9).

[0594] SEQ ID NO:566 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 10).

[0595] SEQ ID NO:567 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 10).

[0596] SEQ ID NO:568 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 11).

[0597] SEQ ID NO:569 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 11).

[0598] SEQ ID NO:570 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 12).

[0599] SEQ ID NO:571 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 12).

[0600] SEQ ID NO:572 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 13).

[0601] SEQ ID NO:573 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 13).

[0602] SEQ ID NO:574 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 13).

[0603] SEQ ID NO:575 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 14).

[0604] SEQ ID NO:576 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 14).

[0605] SEQ ID NO:577 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 15).

[0606] SEQ ID NO:578 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 16).

[0607] SEQ ID NO:579 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 16).

[0608] SEQ ID NO:580 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 17).

[0609] SEQ ID NO:581 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 17).

[0610] SEQ ID NO:582 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 18).

[0611] SEQ ID NO:583 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 19).

[0612] SEQ ID NO:584 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 20).

[0613] SEQ ID NO:585 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 20).

[0614] SEQ ID NO:586 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 21).

[0615] SEQ ID NO:587 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 22).

[0616] SEQ ID NO:588 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 22).

[0617] SEQ ID NO:589 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 23).

[0618] SEQ ID NO:590 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 23).

[0619] SEQ ID NO:591 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 24).

[0620] SEQ ID NO:592 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 24).

[0621] SEQ ID NO:593 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 25).

[0622] SEQ ID NO:594 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 26).

[0623] SEQ ID NO:595 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 27).

[0624] SEQ ID NO:596 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 27).

[0625] SEQ ID NO:597 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 28).

[0626] SEQ ID NO:598 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 28).

[0627] SEQ ID NO:599 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 29).

[0628] SEQ ID NO: 600 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 30).

[0629] SEQ ID NO: 601 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 30).

[0630] SEQ ID NO: 602 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 31).

[0631] SEQ ID NO: 603 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 31).

[0632] SEQ ID NO: 604 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 32).

[0633] SEQ ID NO:605 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 32).

[0634] SEQ ID NO: 606 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 33).

[0635] SEQ ID NO: 607 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 33).

[0636] SEQ ID NO:608 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 34).

[0637] SEQ ID NO: 609 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 34).

[0638] SEQ ID NO:610 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 35).

[0639] SEQ ID NO:611 is the edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 36).

[0640] SEQ ID NO:612 is the nucleotide sequence of the vector Cr-X-FMOS containing the modified Cas.

[0641] SEQ ID NO:613 is the nucleotide sequence of the vector Ev-FMOS containing the modified Cas.

[0642] SEQ ID NO:614 is a nucleotide sequence encoding a modified form of prZmAP1 used in 24997.

[0643] SEQ ID NO:615 is a nucleotide sequence encoding a modified form of prZmBde1 used in 25002.

[0644] SEQ ID NO:616 is a nucleotide sequence encoding a modified form of prZmBde1 used in 25003.

[0645] SEQ ID NO:617 is a nucleotide sequence encoding a modified form of prZmBde1 used in 25004.

[0646] SEQ ID NO:618 is a nucleotide sequence encoding a modified form of prZmBde1 used in 25005.

[0647] SEQ ID NO:619 is a nucleotide sequence encoding a modified form of prZmBde1 used in 25006.

[0648] SEQ ID NO:620 is a nucleotide sequence encoding a modified form of prOsAP1 used in 25007.

[0649] SEQ ID NO:621 is a nucleotide sequence encoding a modified form of prOsAP1 used in 25008.

[0650] SEQ ID NO:622 is a nucleotide sequence encoding a modified form of prOsAP1 used in 25009.

[0651] SEQ ID NO:623 is a nucleotide sequence encoding a modified form of an intron in prZmAP1-03.

[0652] SEQ ID NO:624 is a nucleotide sequence encoding a modified form of the intron in prZmBde1-03 and prZmBde1-07.

[0653] SEQ ID NO:625 is a nucleotide sequence encoding a modified form of an intron in prZmBde1-04.

[0654] SEQ ID NO:626 is a nucleotide sequence encoding a modified form of an intron in prZmBde1-05.

[0655] SEQ ID NO:627 is a nucleotide sequence encoding a modified form of an intron in prOsAP1-02 and prOsAP1-04.

[0656] SEQ ID NO:628 is the nucleotide sequence of the forward primer used for CENH3 editing analysis.

[0657] SEQ ID NO:629 is the nucleotide sequence of the reverse primer used for CENH3 editing analysis.

[0658] SEQ ID NO:630 is the nucleotide sequence of the forward primer used for CENH3 editing analysis.

[0659] SEQ ID NO:631 is the wild-type nucleotide sequence of the gRNA2 target of construct 24905.

[0660] SEQ ID NO:632 is the edited nucleotide sequence of the gRNA2 target of construct 24905.

[0661] SEQ ID NO: 633 is the nucleotide target sequence of chalcone synthase (WHP1) target 1.

[0662] SEQ ID NO:634 is the nucleotide target sequence of chalcone synthase (C2) target 1.

[0663] SEQ ID NO:635 is the nucleotide target sequence of chalcone synthase (WHP1) target 2.

[0664] SEQ ID NO:636 is the nucleotide target sequence of chalcone synthase (C2) target 2.

[0665] SEQ ID NO: 637 is the nucleotide sequence of primer 1 of WHP1 target 1.

[0666] SEQ ID NO: 638 is the nucleotide sequence of primer 2 of WHP1 target 1.

[0667] SEQ ID NO:639 is the nucleotide sequence of the probe for WHP1 target 1.

[0668] SEQ ID NO:640 is the nucleotide sequence of primer 1 of C2 target 1.

[0669] SEQ ID NO:641 is the nucleotide sequence of primer 2 of C2 target 1.

[0670] SEQ ID NO:642 is the nucleotide sequence of the probe for C2 target 1.

[0671] SEQ ID NO:643 is the nucleotide sequence of primer 1 of WHP1 target 2.

[0672] SEQ ID NO:644 is the nucleotide sequence of primer 2 of WHP1 target 2.

[0673] SEQ ID NO:645 is the nucleotide sequence of the probe for WHP1 target 2.

[0674] SEQ ID NO:646 is the nucleotide sequence of primer 1 of C2 target 2.

[0675] SEQ ID NO:647 is the nucleotide sequence of primer 2 of C2 target 2.

[0676] SEQ ID NO:648 is the nucleotide sequence of the probe for C2 target 2.

[0677] SEQ ID NO: 649 is the nucleotide sequence of the forward primer used for PMI assay.

[0678] SEQ ID NO: 650 is the nucleotide sequence of the reverse primer used for PMI assay.

[0679] SEQ ID NO: 651 is the nucleotide sequence of a probe for PMI assay.

[0680] SEQ ID NO: 652 is the nucleotide sequence of the forward primer used for the control gene ZmEF1 assay.

[0681] SEQ ID NO: 653 is the nucleotide sequence of the reverse primer used for the control gene ZmEF1 assay.

[0682] SEQ ID NO: 654 is the nucleotide sequence of a probe used for measurement of the control gene ZmEF1.

[0683] SEQ ID NO:655 is the WT nucleotide sequence of the gRNA2 target in construct 24905.

[0684] SEQ ID NO:656 is the edited nucleotide sequence from a TO plant transformed with construct 24905.

[0685] SEQ ID NO:657 is the nucleotide sequence of vector 24925.

[0686] SEQ ID NO:658 is the nucleotide sequence deleted in soybean.

[0687] SEQ ID NO:659 is the nucleotide sequence deleted in soybean.

[0688] SEQ ID NO: 660 is the nucleotide sequence deleted in soybean.

[0689] SEQ ID NO: 661 is the nucleotide sequence deleted in soybean.

[0690] SEQ ID NO: 662 is the WT nucleotide sequence in soybean.

[0691] SEQ ID NO: 663 is the edited nucleotide sequence in soybean.

[0692] SEQ ID NO: 664 is the edited nucleotide sequence in soybean.

[0693] SEQ ID NO:665 is the edited nucleotide sequence in soybean.

[0694] SEQ ID NO: 666 is the edited nucleotide sequence in soybean.

[0695] SEQ ID NO: 667 is the WT nucleotide sequence in soybean.

[0696] SEQ ID NO: 668 is the edited nucleotide sequence in soybean.

[0697] SEQ ID NO: 669 is the edited nucleotide sequence in soybean.

[0698] SEQ ID NO: 670 is the edited nucleotide sequence in soybean.

[0699] SEQ ID NO: 671 is the edited nucleotide sequence in soybean.

[0700] SEQ ID NO:672 is the WT nucleotide sequence in soybean.

[0701] SEQ ID NO: 673 is the edited nucleotide sequence in soybean.

[0702] SEQ ID NO: 674 is the edited nucleotide sequence in soybean.

[0703] SEQ ID NO: 675 is the edited nucleotide sequence in soybean.

[0704] SEQ ID NO: 676 is the edited nucleotide sequence in soybean.

[0705] SEQ ID NO: 677 is the edited nucleotide sequence in soybean.

[0706] SEQ ID NO: 678 is the edited nucleotide sequence in soybean.

[0707] SEQ ID NO: 679 is the edited nucleotide sequence in soybean.

[0708] SEQ ID NO: 680 is the edited nucleotide sequence in soybean.

[0709] SEQ ID NO: 681 is the edited nucleotide sequence in soybean.

[0710] SEQ ID NO: 682 is the edited nucleotide sequence in soybean.

[0711] SEQ ID NO: 683 is the WT nucleotide sequence in soybean.

[0712] SEQ ID NO: 684 is the edited nucleotide sequence in soybean.

[0713] SEQ ID NO: 685 is the edited nucleotide sequence in soybean.

[0714] SEQ ID NO: 686 is the edited nucleotide sequence in soybean.

[0715] SEQ ID NO: 687 is the edited nucleotide sequence in soybean.

[0716] SEQ ID NO: 688 is the edited nucleotide sequence in soybean.

[0717] SEQ ID NO: 689 is the edited nucleotide sequence in soybean.

[0718] SEQ ID NO: 690 is the edited nucleotide sequence in soybean.

[0719] SEQ ID NO: 691 is the edited nucleotide sequence in soybean.

[0720] SEQ ID NO: 692 is the edited nucleotide sequence in soybean.

[0721] SEQ ID NO: 693 is the edited nucleotide sequence in soybean.

[0722] SEQ ID NO: 694 is the edited nucleotide sequence in soybean.

[0723] SEQ ID NO: 695 is the edited nucleotide sequence in soybean.

[0724] SEQ ID NO: 696 is the edited nucleotide sequence in soybean.

[0725] SEQ ID NO:697 is the nucleotide sequence of vector AR-SDN2_RETRON.

[0726] SEQ ID NO:698 is the nucleotide sequence encoding the promoter prAtAPETALA1-01.

[0727] SEQ ID NO:699 is the nucleotide sequence encoding the terminator tAtAPETALA1-01.

[0728] SEQ ID NO: 700 is the nucleotide sequence encoding the promoter prAtSEPELLATA2-01.

[0729] SEQ ID NO:701 is the nucleotide sequence encoding terminator tAtSEPELLATA2-01.

[0730] SEQ ID NO:702 is the nucleotide sequence encoding the promoter prMMD1-01.

[0731] SEQ ID NO:703 is the nucleotide sequence encoding terminator tMMD1-01.

[0732] SEQ ID NO:704 is the nucleotide sequence encoding the promoter prS1LOXA-01 (tomato).

[0733] SEQ ID NO:705 is the nucleotide sequence encoding the terminator prS1LOXA-01 (Tomato).

[0734] SEQ ID NO:706 is the nucleotide sequence encoding promoter prS1TM5-01.

[0735] SEQ ID NO:707 is the nucleotide sequence encoding terminator tS1TM5-01.

[0736] SEQ ID NO:708 is the nucleotide sequence encoding promoter prS1TM29-01.

[0737] SEQ ID NO:709 is the nucleotide sequence encoding terminator tS1TM29-01.

[0738] SEQ ID NO:710 is the nucleotide sequence encoding the promoter prGmMMD1-02 (enhanced).

[0739] SEQ ID NO:711 is the nucleotide sequence encoding the first enhancer of prGmMMD1-02.

[0740] SEQ ID NO:712 is the nucleotide sequence encoding the second enhancer of prGmMMD1-02.

[0741] SEQ ID NO:713 is the nucleotide sequence encoding the third enhancer of prGmMMD1-02.

[0742] SEQ ID NO:714 is the nucleotide sequence encoding gRNA.

[0743] SEQ ID NO:715 is the nucleotide sequence encoding gRNA.

[0744] SEQ ID NO:716 is a nucleotide sequence encoding a gRNA targeting the tomato ADH1 gene.

[0745] SEQ ID NO:717 is the nucleotide sequence encoding prZmMSCA1-01.

[0746] SEQ ID NO:718 is the nucleotide sequence encoding tZmMSCA1-01.

[0747] SEQ ID NO:719 is the nucleotide sequence encoding prZmPPG4-01.

[0748] SEQ ID NO:720 is the nucleotide sequence encoding tZmPPG4-01.

[0749] SEQ ID NO: 721 is a nucleotide sequence encoding a promoter for NADH dehydrogenase.

[0750] SEQ ID NO:722 is a nucleotide sequence encoding a terminator for NADH dehydrogenase.

[0751] SEQ ID NO:723 is the nucleotide sequence encoding prZmCID11.

[0752] SEQ ID NO:724 is the nucleotide sequence encoding tZmCID11. BRIEF DESCRIPTION OF THE DRAWINGS

[0753] Figure 1 is a schematic diagram of vector 24301 (SEQ ID NO: 1), which is used to transform maize immature embryos.

[0754] Figure 2 is an exemplary diagram of a vector used to transform maize immature embryos.

[0755] Figure 3 is a schematic diagram of vector 24224 (SEQ ID NO: 10), which is used to transform maize immature embryos.

[0756] Figure 4 is a schematic diagram of vector 24243 (SEQ ID NO: 40), which is used to transform maize immature embryos.

[0757] Figure 5 is a schematic diagram of vector 24265 (SEQ ID NO: 19), which is used to transform maize immature embryos.

[0758] Figure 6 is a schematic diagram of vector 24266 (SEQ ID NO: 22), which is used to transform maize immature embryos.

[0759] Figure 7 is a schematic diagram of vector 24269 (SEQ ID NO: 25), which is used to transform maize immature embryos.

[0760] Figure 8 is a schematic diagram of vector 24270 (SEQ ID NO: 28), which is used to transform maize immature embryos.

[0761] Fig. 9 is a schematic diagram of vector 24289 (SEQ ID NO: 31), which is used to transform maize immature embryos.

[0762] Fig.10 is a schematic diagram of vector 24299 (SEQ ID NO: 34), which is used to transform maize immature embryos.

[0763] Fig.11 is a schematic diagram of vector 24300 (SEQ ID NO: 85), which is used to transform maize immature embryos.

[0764] Fig.12 is a schematic diagram of vector 24305 (SEQ ID NO: 43), which is used to transform maize immature embryos.

[0765] Fig.13 is a schematic diagram of vector 24306 (SEQ ID NO: 46), which is used to transform maize immature embryos.

[0766] Fig.14 is a schematic diagram of vector 24320 (SEQ ID NO: 49), which is used to transform maize immature embryos.

[0767] Fig.15 is a schematic diagram of vector 24426 (SEQ ID NO: 52), which is used to transform maize immature embryos.

[0768] Fig.16 is a schematic diagram of vector 24427 (SEQ ID NO: 55), which is used to transform maize immature embryos.

[0769] Fig.17 is a schematic diagram of vector 24428 (SEQ ID NO: 58), which is used to transform maize immature embryos.

[0770] Fig.18 is a schematic diagram of vector 24454 (SEQ ID NO:61), which is used to transform maize immature embryos.

[0771] Fig.19 is a schematic diagram of vector 24455 (SEQ ID NO: 64), which is used to transform maize immature embryos.

[0772] Fig. 20 is a schematic diagram of vector 24458 (SEQ ID NO: 67), which is used to transform maize immature embryos.

[0773] Fig.21 is a schematic diagram of vector 24459 (SEQ ID NO: 70), which is used to transform maize immature embryos.

[0774] Fig. 22 is a schematic diagram of vector 24460 (SEQ ID NO: 73), which is used to transform maize immature embryos.

[0775] Fig.23 is a schematic diagram of vector 24548 (SEQ ID NO: 76), which is used to transform maize immature embryos.

[0776] Fig.24 is a schematic diagram of vector 24602 (SEQ ID NO: 79), which is used to transform maize immature embryos.

[0777] Fig.25 is a schematic diagram of vector 24688 (SEQ ID NO: 82), which is used to transform maize immature embryos.

[0778] Fig.26a The tassel sampling plan is shown.

[0779] Figure 26b is a graph showing the mosaicism scores of the five constructs.

[0780] Fig.26c is a graph comparing the mosaicism scores of the shortened promoter constructs with those of the other constructs.

[0781] Fig.26d is a graph showing the mosaicism scores of various constructs.

[0782] Fig. 27 At least one expression cassette is displayed having one gRNA target site flanking the donor DNA.

[0783] Fig.28 At least one expression cassette is displayed having two gRNA target sites flanking the donor DNA.

[0784] Fig.29 At least one expression cassette is displayed that does not have gRNA target sites flanking the donor DNA.

[0785] Fig.30 Another embodiment of at least one expression cassette is presented.

[0786] Fig.31 is a schematic diagram of the vector AR-SDN2_REP_1Cut (SEQ ID NO: 188), which is used to transform maize immature embryos.

[0787] Fig.32 is a schematic diagram of the vector AR-SDN2_REP_2Cuts (SEQ ID NO: 187), which is used to transform maize immature embryos.

[0788] Fig.33 is a schematic diagram of the vector AR-SDN2_REP_NoCut (SEQ ID NO: 186), which is used to transform maize immature embryos.

[0789] Fig.34 is a schematic diagram showing the modification of prZmBde1.

[0790] Fig.35 is a schematic diagram of vector 24857 (SEQ ID NO: 513) used for transformation of soybean.

[0791] Fig.36 is a schematic diagram of vector 24905 (SEQ ID NO: 514) used for transformation of soybean.

[0792] Fig.37 is a photo of a T1 plant.

[0793] Fig.38 and 39 Examples of promoters shortened for use in various constructs are shown.

[0794] Fig.40 A sequence alignment is shown, showing multiple unique edits in the T1 seed.

[0795] Fig.41 is a graph showing the expression level of PMI under the control of a constitutive promoter.

[0796] Fig.42 is a graph showing the expression level of Cas9 under the control of the FMOS promoter.

[0797] Fig.43 is a schematic diagram of vector 24925 used to transform maize immature embryos.

[0798] Fig.44 is a schematic diagram of vector AR-SDN2_RETRON (SEQ ID NO: 697), which is used to transform maize immature embryos.

[0799] definition

[0800] Although it is believed that the following terms are well understood by those of ordinary skill in the art, the following definitions are set forth to facilitate explanation of the subject matter disclosed herein.

[0801] Unless otherwise defined below, all technical and scientific terms used herein are intended to have the same meaning as those generally understood by those of ordinary skill in the art. References to the technology employed herein are intended to reference technology generally understood in the art, including variations of those technologies that are well known to those of ordinary skill in the art and / or replacement of equivalent technologies. Although it is believed that the following terms may be well understood by those of ordinary skill in the art, the following definitions are set forth to facilitate explanation of the subject matter disclosed herein.

[0802] In accordance with long-standing patent law conventions, the terms "a," "an," and "the" as used in this application, including the claims, mean "one or more." For example, the phrase "a cell" refers to one or more cells, and in some embodiments may refer to tissues and / or organs. Similarly, the phrase "at least one," when used herein to refer to an entity, refers to, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100 or more of the entity, including but not limited to all integer values ​​between 1 and 100 and integers greater than 100.

[0803] Unless otherwise indicated, all numbers used in the specification and claims expressing amounts of ingredients, reaction conditions, and the like are to be understood as modified in all instances by the term "about". As used herein, the term "about", when referring to a measurable value such as an amount of mass, weight, time, volume, concentration, or percentage, is meant to encompass variations of ±20% from the specified amount in some embodiments, ±10% from the specified amount in some embodiments, ±5% from the specified amount in some embodiments, ±1% from the specified amount in some embodiments, ±0.5% from the specified amount in some embodiments, and ±0.1% from the specified amount in some embodiments, as such variations are suitable for performing the disclosed methods and / or using the disclosed compositions, nucleic acids, polypeptides, and the like. Therefore, unless indicated to the contrary, the numerical parameters set forth in the specification and the appended claims are approximate values ​​that may vary depending upon the desired properties sought to be obtained by the subject matter disclosed herein.

[0804] As used herein, the term "allele" refers to a variant or alternative sequence form at a genetic locus. In a diploid, a single allele at each locus is inherited by an offspring individual from each parent, respectively. Although one of ordinary skill in the art understands that the alleles in any particular individual do not necessarily represent all the alleles present in the species, the two alleles present in a given locus in a diploid organism occupy corresponding positions on a pair of homologous chromosomes.

[0805] As used herein, the term "and / or," when used in the context of listing entities, refers to the entities as being present alone or in combination. Thus, for example, the phrase "A, B, C, and / or D" includes A, B, C, and D individually, but also includes any and all combinations and subcombinations of A, B, C, and D (e.g., AB, AC, AD, BC, BD, CD, ABC, ABD, and BCD). In some embodiments, the one or more elements referred to by "and / or" may also be present alone in single or multiple occurrences in one or more combinations and / or one or more subcombinations.

[0806] As used herein, the phrase "associated with..." refers to the recognizable and / or measurable relationship between two entities. For example, the phrase "associated with HI" refers to proterties, loci, genes, alleles, markers, phenotypes, etc., or their expression, and their presence or absence can affect the scope and / or degree of HI or haploid induction in plants or their offspring. Therefore, when markers are linked to proterties and when the presence of markers indicates whether desired proterties or proterties forms will and / or will occur in the plant / germplasm comprising the marker to what extent, then the marker is "associated" with the proterties. Similarly, when markers are linked to alleles and when the presence of markers indicates whether alleles are present in the plant / germplasm comprising the marker, then the marker is "associated" with the allele. For example, "a marker associated with HI" refers to its presence or absence and can be used to predict whether plants will and / or will show haploid induction to what extent.

[0807] The term "comprising" is synonymous with "including," "containing," and "characterized by," is inclusive or open-ended, and does not exclude additional, unrecited elements and / or method steps. "Comprising" is a term that means the specified elements and / or steps are present, but other elements and / or steps may be added and still fall within the scope of the relevant subject matter.

[0808] As used herein, the phrase "consisting of" excludes any element, step, or ingredient not specifically recited. When the phrase "consisting of" appears in a clause of the body of a claim, rather than directly following the preamble, it limits only the elements set forth in the clause; other elements are not excluded from the claim as a whole.

[0809] As used herein, the phrase "consisting essentially of limits the scope of the associated disclosure or claim to the specified materials and / or steps, plus those that do not materially affect one or more basic and novel characteristics of the disclosed and / or claimed subject matter.

[0810] With respect to the terms "comprising," "consisting essentially of," and "consisting of," where one of these three terms is used herein, the subject matter disclosed and claimed in the present application may, in some embodiments, include the use of either of the other two terms. For example, if the subject matter, in some embodiments, relates to a nucleic acid encoding a polypeptide comprising an amino acid sequence at least 95% identical to SEQ ID NO:. It should be understood that the disclosed subject matter therefore also encompasses nucleic acids encoding polypeptides that, in some embodiments, consist essentially of an amino acid sequence at least 95% identical to SEQ ID NO: and nucleic acids encoding polypeptides that, in some embodiments, consist of an amino acid sequence at least 95% identical to SEQ ID NO:. Similarly, it should also be understood that in some embodiments, the methods for the disclosed subject matter include the steps disclosed herein, in some embodiments, the methods for the subject matter disclosed in the present application consist essentially of the disclosed steps, and in some embodiments, the methods for the subject matter disclosed in the present application consist of the steps disclosed herein.

[0811] As used herein, the term "event" refers to a genetically engineered organism or cell prepared with non-natural DNA that is not normally found in nature, for example, a genetically engineered plant or seed. An event may include a transgenic event in which a transgene is inserted into the DNA of an organism. An event may also include the insertion of a specific transgene into a specific location on a chromosome. An event may also include any combination of insertions or deletions and point mutations.

[0812] As used herein, the term "gene" refers to a unit of inheritance comprising a DNA sequence that occupies a specific location on a chromosome and contains the genetic instructions for a specific characteristic or trait in an organism.

[0813] A "genetic map" is a description, usually depicted in graphical or tabular form, of the genetic linkage relationships between loci on one or more chromosomes within a given species.

[0814] As used herein, a "gene regulatory network" (or "GRN") is a collection of molecular regulators that interact with each other and other substances in the cell to control the gene expression levels of mRNA and protein. The regulators can be DNA, RNA, protein, and complexes of these. GRNs can also include "gene families" as used herein. "Gene family" refers to a group of several similar genes, which generally have similar biochemical functions.

[0815] As used herein, a plant referred to as "haploid" has a reduced number of chromosomes (n) in a haploid plant, and its chromosome set is equal to the chromosome set of the gamete. In a haploid organism, only half of the normal number of chromosomes exists. Therefore, the haploid of a diploid organism (e.g., maize) shows haploidy; the haploid of a tetraploid organism (e.g., ryegrass) shows diploidy; the haploid of a hexaploid organism (e.g., wheat) shows triploidy; and so on. As used herein, a plant referred to as "double haploid" is developed by doubling the haploid set of chromosomes. Plants or seeds obtained from double haploid plants of any number of generations from selfing can still be identified as double haploid plants. Double haploid plants are considered to be homozygous plants. If a plant is fertile, even if the entire vegetative part of the plant is not composed of cells with a doubled chromosome set, the plant is considered to be double haploid; that is, if a plant contains viable gametes, even if it is mosaic in vegetative tissue, the plant will also be considered to be double haploid.

[0816] As used herein, the term "human-induced mutation" refers to any mutation that occurs due to direct or indirect human influence. This term includes, but is not limited to, mutations obtained by any targeted mutagenesis method.

[0817] As used herein, "introduced" refers to delivered, expressed, administered, transported, transferred, infiltrated or other similar terms to indicate the delivery of a desired nucleic acid or protein or combination thereof to an object. For example, a nucleic acid encoding a site-directed nuclease and optionally at least one guide RNA can be introduced into a plant cell.

[0818] As used herein, the terms "marker probe" and "probe" refer to a nucleotide sequence or nucleic acid molecule that can be used to detect the presence or absence of a sequence within a larger sequence (e.g., a nucleic acid probe that is complementary to all or part of a marker or marker locus by nucleic acid hybridization). Marker probes comprising about 8, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more consecutive nucleotides can be used for nucleic acid hybridization.

[0819] As used herein, when identifying the presence / absence of the locus associated with HI, the term "molecular marker" can be used to refer to a genetic marker as defined above, or a coded product (e.g., protein) thereof as a reference point. Molecular markers can be derived from a genomic nucleotide sequence or an expressed nucleotide sequence (e.g., derived from RNA, cDNA, etc.). The term also refers to a nucleotide sequence complementary to a marker sequence or to a nucleotide sequence located on its flank, for example, as a nucleotide sequence of a probe and / or primer that can amplify a marker sequence. When a nucleotide sequence specifically hybridizes in a solution, these nucleotide sequences are "complementary" (e.g., according to Watson-Crick base pairing principles). This term also refers to a genetic marker that indicates a trait by not being complementary to a marker sequence or to a nucleotide sequence located on its flank (e.g., as a nucleotide sequence of a probe and / or primer that can amplify a marker sequence).

[0820] As used herein, the terms "nucleotide sequence", "polynucleotide", "nucleic acid sequence", "nucleic acid molecule" and "nucleic acid fragment" refer to polymers of single-stranded or double-stranded RNA or DNA, optionally containing synthetic, non-natural, and / or altered nucleotide bases. "Nucleotide" is a monomeric unit from which DNA or RNA polymers are constructed and consists of a purine or pyrimidine base, a pentose sugar and a phosphate group. Nucleotides (usually found in their 5'-monophosphate form) are represented by their single-letter names as follows: "A" represents adenylic acid or deoxyadenylic acid (for RNA or DNA, respectively), "C" represents cytidylic acid or deoxycytidylic acid, "G" represents guanylic acid or deoxyguanylic acid, "U" represents uridylic acid, "T" represents deoxythymidylic acid, "R" represents purine (A or G), "Y" represents pyrimidine (C or T), "K" represents G or T, "H" represents A or C or T, "I" represents inosine, and "N" represents any nucleotide.

[0821] As used herein, the term "nucleotide sequence identity" refers to the presence of identical nucleotides at the corresponding positions of two polynucleotides. When comparison is performed to obtain maximum correspondence (for example, in a comparison window), if the nucleotide sequence in two polynucleotides is identical, the polynucleotide has an "identical" sequence. The sequence comparison between two or more polynucleotides is usually performed by comparing the parts of the two sequences on a comparison window to identify and compare the local region of sequence similarity. The comparison window is typically from about 20 to 200 continuous nucleotides. "Percentage sequence identity" of a polynucleotide, for example about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity, can be determined by comparing the sequences of two optimal comparisons on a comparison window, wherein for the optimal comparison of two sequences, compared to a reference sequence, the part of the polynucleotide sequence in the comparison window can include addition or deletion (that is, room). In some embodiments, the percentage is calculated by: (a) determining the number of positions where the same nucleic acid base appears in the two sequences; (b) dividing the number of matching positions by the total number of positions in the comparison window; and (c) multiplying the result by 100. The optimal alignment of the sequences for comparison can also be performed by computerized implementation of known algorithms or by visual inspection. Easily available sequence comparison and multiple sequence alignment algorithms are the Basic Local Alignment Search Tool (BLAST) and ClustalW / ClustalW2 / Clustal Omega programs available on the Internet (e.g., the website of EMBL-EBI). Other suitable programs include, but are not limited to, GAP, BestFit, Plot Similarity and FASTA, which are part of the Accelrys GCG software package available from Accelrys (San Diego, California, USA). See also Smith and Waterman, 1981; Needleman and Wunsch, 1970; Pearson and Lipman, 1988; Ausubel et al., 1988; and Sambrook and Russell, 2001.

[0822] An example of an algorithm suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., 1990. In some embodiments, the percent sequence identity refers to the sequence identity over the entire length of one of the gDNA, cDNA, or predicted protein sequences in the largest ORF of SEQ ID No: 1 being compared. In some embodiments, the calculation for determining the percent nucleic acid sequence identity does not include in the calculation any nucleotide position where one of the compared nucleic acids includes an "N" (i.e., where any nucleotide may be present at that position).

[0823] The term "open reading frame" (ORF) refers to a nucleic acid sequence encoding a polypeptide. In some embodiments, an ORF comprises a translation initiation codon (i.e., a start codon), a translation termination codon (i.e., a stop codon), and a nucleic acid sequence encoding amino acids present in the polypeptide therebetween. The terms "start codon" and "stop codon" refer to a unit of three adjacent nucleotides (i.e., codons) in a coding sequence, which indicate the start and chain termination of protein synthesis (mRNA translation), respectively.

[0824] As used herein, the terms "phenotype", "phenotypic trait" or "trait" refer to one or more traits of a plant or plant cell. A phenotype is observable by the naked eye or by any other evaluation means known in the art (e.g., microscopy, biochemical analysis, or electromechanical determination). In some cases, a phenotype is directly controlled by a single gene or genetic locus (i.e., corresponding to a "monogenic trait"). In other cases, a phenotype is the result of an interaction between several genes, and in some embodiments, it is also caused by the interaction of a plant and / or plant cell with its environment.

[0825] As used herein, the term "plant" may refer to a whole plant, any part thereof, or a cell or tissue culture derived from a plant. Thus, the term "plant" may refer to any of the following: a whole plant, a plant component or organ (e.g., leaves, stems, roots, etc.), a plant tissue, a seed, and / or a plant cell.

[0826] Plant cells are plant cells obtained from plants, or plant cells derived from cells taken from plants by culture. Thus, the term "plant cell" includes, but is not limited to, cells within seeds, suspension cultures, embryos, meristems, callus, leaves, buds, gametophytes, sporophytes, pollen, and microspores. The phrase "plant part" refers to a part of a plant, including single cells and cell tissues (e.g., intact plant cells in plants), cell clumps, and tissue cultures that can regenerate plants. Examples of plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, buds, and seeds; as well as scions, rhizomes, protoplasts, callus, and the like.

[0827] As used herein, the term "primer" refers to an oligonucleotide that is capable of annealing to a nucleic acid target (in some embodiments, specifically annealing to a nucleic acid target) when placed under conditions that induce synthesis of a primer extension product (e.g., in the presence of nucleotides and an agent for polymerization (such as a DNA polymerase) and at a suitable temperature and pH) to allow a DNA polymerase and / or reverse transcriptase to attach thereto, thereby serving as a starting point for DNA synthesis. In some embodiments, one or more primers are employed to amplify plant nucleic acids (e.g., using a polymerase chain reaction; PCR).

[0828] As used herein, the term "probe" refers to a nucleic acid (e.g., a single-stranded nucleic acid or a double-stranded or higher-order nucleic acid chain, or a subsequence thereof) that can form a hydrogen-bonded duplex with a complementary sequence in a target nucleic acid sequence. Typically, the probe has a sufficient length to form a stable and sequence-specific duplex molecule with its complementary sequence, and this can be used in some embodiments to detect a target sequence present in multiple nucleic acids.

[0829] As used herein, term " offspring " and " offspring plant " refer to the plant produced by vegetative reproduction or sexual reproduction from one or more parental plants.Offspring plant can be obtained by cloning a single parental plant or making a single parental plant self-pollination or by making two or more parental plants hybridize.For example, offspring plant can be obtained by cloning or self-pollination of a parental plant or by the hybridization of two parental plants, and comprises self-pollinator and F1 or F2 or even more distant generations.F1 is the first generation offspring (at least one of the two parents is the donor used as the trait for the first time) produced from two parents, and the filial generation of the second generation (F2) or subsequent generation (F3, F4 etc.) is the sample produced from the self-pollination, mutual crossing, backcrossing and / or other hybridization of F1, F2 etc. Thus, F1 can be (and in some embodiments is) a hybrid produced from a cross between two true breeding parents (i.e., each of the true breeding parents is homozygous for the trait of interest or its alleles), and F2 can be (and in some embodiments is) the offspring produced from self-pollination of the F1 hybrid.

[0830] As used herein, phrase "recombination" refers to the exchange ("crossover") of DNA fragments between two DNA molecules or chromatids of paired chromosomes in a region of similar or identical nucleotide sequences."Recombination event" is understood herein to refer to meiotic crossovers in some embodiments.

[0831] As used herein, the term "reference sequence" refers to a defined nucleotide sequence used as a basis for nucleotide sequence comparison.

[0832] As used herein, the term "regeneration" and grammatical variations thereof refer to the production of plants from tissue culture.

[0833] As used herein, the phrase "stringent hybridization conditions" refers to conditions under which a polynucleotide typically hybridizes to its target subsequence (but not substantially to other sequences) in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and may be different in different circumstances.

[0834] Typically, longer sequences hybridize specifically at higher temperatures. A comprehensive guide to nucleic acid hybridization can be found in Sambrook and Russell, 2001. Typically, stringent conditions are selected to be about 5°C to 10°C lower than the thermal melting point (Tm) for a specific sequence at a defined ionic strength pH. Tm is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (when the target sequence is present in excess, at Tm, 50% of the probes are occupied at equilibrium). Exemplary stringent conditions are those that are as follows: a salt concentration of less than about 1.0 M sodium ions, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3, and a temperature of at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides).

[0835] Stringent conditions can also be achieved by adding a destabilizing agent such as formamide. Additional exemplary stringent hybridization conditions include 50% formamide, 5x SSC and 1% SDS, incubated at 42°C; or SSC, 1% SDS, incubated at 65°C; washed once or multiple times at 65°C in 0.2x SSC and 0.1% SDS. For PCR, a temperature of about 36°C is typically used for low stringency amplification, but depending on the primer length, the annealing temperature can vary between about 32°C and 48°C (or higher). Additional guidelines for determining hybridization parameters are provided in many references (see, for example, Ausubel et al., 1999).

[0836] As used herein, the term "trait" refers to a target phenotype, a gene that contributes to the target phenotype, and a nucleic acid sequence associated with the gene that contributes to the target phenotype. For example, "HI trait" refers to a haploid-induced phenotype, and a gene that contributes to haploid induction (e.g., mat1 in maize or Os03g27610 in rice) and a nucleic acid sequence associated with the presence or absence of the haploid-induced phenotype (e.g., a gene product associated with HI).

[0837] As used herein, the term "transgenic" refers to a nucleic acid molecule introduced into an organism or one or more of its ancestors by some form of artificial transfer technology. Therefore, artificial transfer technology produces a "transgenic organism" or "transgenic cell". It should be understood that artificial transfer technology can occur in an ancestral organism (or a cell therein and / or a cell that can develop into an ancestral organism), and even if one or more natural and / or assisted breeding results in the presence of an artificially transferred nucleic acid molecule in an offspring individual, any offspring individual with an artificially transferred nucleic acid molecule or a fragment thereof is still considered to be transgenic.

[0838] As used herein, the term "targeted mutagenesis" or "mutagenesis strategy" refers to any mutagenesis method that results in the deliberate mutagenesis of a selected gene. Targeted mutagenesis includes the methods CRISPR, TILLING, TALEN, and other methods that have not yet been discovered but can be used to achieve the same result.

[0839] It is particularly contemplated that one can mutagenesis promoters to potentially improve the effectiveness of elements for expressing transgenics in plants. Mutagenesis of these elements can be performed randomly, and the activity of the mutagenized promoter sequence can be screened in a trial-by-error procedure. Alternatively, a specific sequence that provides a desired expression characteristic or expression enhancing activity can be identified as a promoter, and these or similar sequences can be introduced into the promoter via mutation. It is further contemplated that one can mutagenesis these sequences in order to enhance the expression of its transgenics in a particular species. The means for mutagenizing the DNA segment encoding the promoter sequence of the present invention are well known to those skilled in the art. As indicated, promoters or other regulatory elements can be modified by random or site-specific mutagenesis procedures. Promoters and other regulatory elements can be modified by adding or deleting one or more nucleotides to change their structure in the sequence encoding the corresponding unmodified sequence.

[0840] Mutagenesis can be carried out according to any of the techniques known in the art, such as but not limited to synthesizing oligonucleotides with one or more mutations in the sequence of a specific regulatory sequence. Specifically, site-specific mutagenesis is a technique that can be used to prepare promoter mutants by specific mutagenesis of basic DNA (underlying DNA). RNA-guided endonucleases ("RGEN", for example, CRISPR / Cas9) can also be used. For example, in conjunction with one or more of the aforementioned considerations, by introducing one or more nucleotide sequence changes into DNA, the technology further provides the ready-made ability to prepare and test sequence variants. Site-specific mutagenesis allows for providing primer sequences of sufficient size and sequence complexity by using specific oligonucleotide sequences of the DNA sequence encoding the desired mutation and a sufficient number of adjacent nucleotides to form stable duplexes on both sides of the deletion connection fragment being studied in detail and produce mutants. Typically, primers of about 17 to about 75 nucleotides or more nucleotides in length are preferred, wherein about 10 to about 25 or more residues on both sides of the sequence connection fragment are changed.

[0841] In the case of isolating clones containing promoters according to the present invention, people may wish to define the promoter region within the clone. An effective targeting means for preparing a mutagenic promoter relies on identifying putative regulatory elements within the promoter sequence. This can be caused by comparing with promoter sequences known to be expressed in similar tissue-specific or developmentally unique patterns. Sequences shared between promoters with similar expression patterns may be candidates for transcription factor binding, and therefore may be elements that confer expression patterns. The confirmation of these putative regulatory elements can be achieved by performing deletion analysis on each putative regulatory sequence, followed by functional analysis of each deletion construct by measuring the reporter gene functionally attached to each construct. Therefore, once a starting promoter sequence is provided, any one of the many different deletion mutants of the starting promoter can be easily prepared.

[0842] The invention disclosed herein provides polynucleotide molecules comprising regulatory element fragments that can be used to construct novel chimeric regulatory elements. Novel combinations of fragments comprising these polynucleotide molecules and at least one other regulatory element or fragment can be constructed and tested in plants and are considered to be within the scope of the present invention. Therefore, the design, construction and use of chimeric regulatory elements are an embodiment of the present invention. The promoter of the present invention includes homologs of cis elements that show homology to the promoter sequence of the present invention and are known to affect gene regulation.

[0843] The functional equivalent fragment of one of the transcriptional regulatory nucleic acids described herein comprises at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000 base pairs of transcriptional regulatory nucleic acids. Then, the equivalent fragment of the transcriptional regulatory nucleic acid obtained by the region of the 5' untranslated region of the missing encoding mRNA will only provide (untranscribed) promoter region. The 5' untranslated region can be easily determined by methods known in the art (e.g., 5'-RACE analysis). Therefore, some transcriptional regulatory nucleic acids described herein are equivalent fragments of other sequences.

[0844] As indicated above, the deletion mutants of the promoter of the present invention can also be prepared randomly and then measured. According to this strategy, a series of constructs are prepared, each of which contains the different parts (subclones) of the promoter, and then the activity of these constructs is screened. Suitable means for screening activity are to attach the promoter or intron construct containing the deletion of the deletion section to selectable or screenable markers, and only separate those cells of the expression marker gene. In this way, many different, deleted promoter constructs have been identified, which still retain the desired or even enhanced activity. Thus, the minimum section required for activity is identified by comparing the selected construct. Then, this section can be used to build a carrier for expressing foreign genes.

[0845] As described herein, "at least one expression cassette" refers in particular to a DNA comprising a regulatory sequence and a nucleic acid encoding a DNA modification enzyme to be expressed by a transfected cell. In one example, the at least one expression cassette is a component of a vector DNA and is expressed in a transfected cell after transformation. As described herein, at least one expression cassette will generally include a plurality of expression cassettes, for example: an expression cassette comprising a regulatory sequence and a nucleic acid encoding a gRNA; an expression cassette comprising a regulatory sequence that triggers replication of a donor DNA; an expression cassette comprising a regulatory sequence and a selective marker or a combination thereof, for example, an expression cassette comprising a DNA encoding a Cas enzyme and a gRNA under the control of an FMOS regulatory sequence. At least one expression cassette described herein may include additional regulatory elements. The term in this context should be broadly understood to include all sequences that may affect the construction or function of at least one expression cassette. For example, a regulatory element may modify transcription and / or translation in a prokaryotic or eukaryotic organism. At least one expression cassette described herein may be downstream (in the 3' direction) of a nucleic acid sequence to be expressed and may optionally contain additional regulatory elements, such as transcription or translation enhancers. Each additional regulatory element may be operably linked to a nucleic acid sequence to be expressed (or a transcriptional regulatory nucleotide sequence). Additional regulatory elements may comprise additional promoters, minimal promoters, promoter elements or transposon elements which may modify or enhance the expression regulatory properties.The at least one expression cassette may also contain one or more introns, one or more exons and one or more terminators.

[0846] In addition, it is considered that promoter combinations from elements of more than one promoter may be useful. For example, U.S. Patent No. 5,491,288 discloses combining a cauliflower mosaic virus promoter with a histone promoter. Therefore, elements from a promoter disclosed herein (e.g., a FMOS promoter) can be combined with elements from other promoters (FMOS or other), as long as the FMOS function is maintained. For example, in certain embodiments the intron in the FMOS promoter can be replaced by introns from other promoters (e.g., introns from ubiquitin promoters). Further, in some embodiments, the FMOS promoter can be extended, for example, by merging with introns from other promoters, such as, merging the FMOS promoter with introns from ubiquitin promoters. DETAILED DESCRIPTION

[0847] The present disclosure relates, inter alia, to systems and methods for improving gene editing efficiency (e.g., for reducing the number of transformations required to generate edits (e.g., new mutations or events) in plant DNA).

[0848] In various embodiments, the present disclosure relates to methods for generating multiple unique edits (eg, multiple unique allele substitutions, multiple unique base insertions, multiple unique base deletions, or multiple unique point mutations) in T1 seeds of a plant.

[0849] In an exemplary embodiment, the method includes transforming at least one expression cassette into a plant cell or plant tissue. Figure 1 An example of at least one expression cassette 2 suitable for use in a transformation method is shown. As described herein, cassette 2 is shown as a combination of features in a plasmid vector 3, but in other examples, the expression cassette can be isolated DNA or can be a feature in a viral vector. The expression cassette 2 comprises a nucleic acid 4 encoding a DNA modification enzyme; a nucleic acid 6 encoding at least one guide RNA (gRNA); and a floral mosaic (FMOS) regulatory sequence 10 including a FMOS promoter 10a. In many embodiments, the FMOS regulatory sequence will further include a FMOS terminator 10b.

[0850] Nucleic acid 4 can encode a variety of DNA modification enzymes. For example, nucleic acid 4 can encode a site-directed nuclease selected from the group consisting of: a meganuclease (MN), a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a Cas nuclease, a Cas9 nuclease, a Cas12a nuclease (also referred to herein as a Cpf1 nuclease), a dCas9-FokI, a dCpf1-FokI, a chimeric Cas9-cytidine deaminase, a chimeric Cas9-adenine deaminase, a chimeric FEN1-FokI and Mega-TAL, a nickase Cas9 (nCas9), a chimeric dCas9 non-FokI nuclease, and a dCpf1 non-FokI nuclease. SEQ ID NO: 4 is an example of a Cas nuclease (particularly a Cas9a nuclease). SEQ ID NO: 532 is another example of a Cas nuclease (particularly a Cas12a nuclease). The Cas nuclease can be modified and still retain Cas nuclease activity. For example, this Cas12a, based on a previous publication, is a rice codon-optimized version of the bacterium ND2006 from the Lachnospiraceae family, except that there is a 3bp change to remove 2 Bsp119I and one RsrII site. Two nuclear localization signals (NLS) are added to the N-terminus and C-terminus, respectively; the N-terminus also contains an epitope tag. Other changes are expected. Therefore, in some instances, the Cas nuclease will have a sequence that is at least 90%, 95%, 98% or 99% identical to SEQ ID NO: 4 or SEQ ID NO: 532.

[0851] Depending on the nuclease used, a nucleic acid encoding at least one gRNA is optionally included 6. For example, when a nuclease (eg, Cas) forming a nuclease-gRNA complex is used, it is desirable to use at least one nucleic acid encoding gRNA. Further, gRNA can be single-stranded, or can include more than one chain, for example, a target agent-RNA hybridized with a target DNA sequence and an activator-RNA hybridized with a target agent-RNA. U.S. Patent No. 8,697,359 and U.S. Patent No. 10,000,772 and U.S. Patent Publication US20160208243 (all of which are incorporated herein by reference) describe various single and multiple guide RNA methods.

[0852] The FMOS regulatory sequence 10 mediates the expression of a DNA modifying enzyme in at least one of a flower primordium cell and a flower reproductive organ, and mediates multiple edits in at least one of a flower primordium cell and a flower reproductive organ. The flower primordium cell and the flower reproductive organ include structures contained in a fully developed flower and all developmental stages of these structures as initiated after the transition from vegetative growth to flower development begins. For example, the flower primordium cell and the flower reproductive organ include microspore mother cells, anthers, stamens, tapetum, megaspore mother cells, pistils, ovaries, styles and stigmas, as well as any developmental stages of these structures.

[0853] Thus, the FMOS regulatory sequence can mediate expression in at least one of an inflorescence, microspore mother cell, anther, stamen, tapetum, megaspore mother cell, pistil, ovary, style, stigma, or any developmental stage of these structures. In many embodiments, the FMOS regulatory sequence will mediate expression of a DNA modification enzyme in both male and female floral reproductive organs or primordia thereof, and mediate multiple edits in both male and female floral reproductive organs or primordia thereof.

[0854] It should be clear that the FMOS regulatory sequence will mediate significantly more DNA modification enzyme expression in floral primordia and floral reproductive organs than in vegetative tissues (e.g., leaf or shoot meristems). The increased expression rate may vary depending on the embodiment. For example, the FMOS regulatory sequence will mediate at least one of the following times more DNA modification enzymes in floral primordia and floral reproductive organs than in shoot apical meristem (SAM): at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, at least 100 times, at least 101 times, at least 102 times, at least 103 times, at least 104 times, at least 105 times, at least 106 times, at least 107 times, at least 108 times, at least The expression rate of the present invention is 74 times less, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times and at least 100 times less. When the expression rate is compared with other vegetative tissues such as leaf tissue, similar ratio improvements will be seen.

[0855] The FMOS regulatory sequence will also mediate significantly more DNA modification enzyme expression in flower primordia and flower reproductive organs than in seeds. For example, the FMOS regulatory sequence will mediate at least one of the following times more DNA modification enzymes in flower primordia and flower reproductive organs than in seeds: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times at least 48 times less, at least 49 times less, at least 50 times less, at least 51 times less, at least 52 times less, at least 53 times less, at least 54 times less, at least 55 times less, at least 56 times less, at least 57 times less, at least 58 times less, at least 59 times less, at least 60 times less, at least 61 times less, at least 62 times less, at least 63 times less, at least 64 times less, at least 65 times less, at least 66 times less, at least 67 times less, at least 68 times less, at least 69 times less, at least 70 times less, at least 71 times less, at least 72 times less, at least 73 times less, at least 74 times less times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times.

[0856] In some embodiments, the FMOS regulatory sequence mediates expression of a DNA modification enzyme in both male and female floral reproductive organs, and mediates multiple edits in both male and female floral reproductive organs. In such embodiments, the expression of the DNA modification enzyme in the male floral reproductive organs is at least one of at least one of the following: at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 11-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17-fold, at least 18-fold, at least 19-fold, at least 20-fold, at least 21-fold, at least 22-fold, at least 23-fold, at least 24-fold, at least 25-fold, at least 26-fold, at least 27-fold, at least 28-fold, at least 29-fold, at least 30-fold, at least 31-fold, at least 32-fold, at least 33-fold, at least 34-fold, at least 35-fold, at least 36-fold, at least 37-fold, at least 38-fold, at least 39-fold, at least 40-fold, at least 41-fold, at least 42-fold, at least 43-fold, at least 44-fold, at least 45-fold, at least 46-fold, at least 47-fold, at least 48-fold, at least 49-fold at least 18 times less, at least 19 times less, at least 20 times less, at least 21 times less, at least 22 times less, at least 23 times less, at least 24 times less, at least 25 times less, at least 26 times less, at least 27 times less, at least 28 times less, at least 29 times less, at least 30 times less, at least 31 times less, at least 32 times less, at least 33 times less, at least 34 times less, at least 35 times less, at least 36 times less, at least 37 times less, at least 38 times less, at least 39 times less, at least 40 times less, at least 41 times less, at least 42 times less, at least 43 times less, at least 44 times less, at least 45 times less , at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times, At least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times.Similarly, the expression of the DNA modifying enzyme in the female floral reproductive organs is at least one of the following: at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 11-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17-fold, at least 18-fold, at least 19-fold, at least 20-fold, at least 21-fold, at least 22-fold, at least 23-fold, at least 24-fold, at least 25-fold, at least 26-fold, at least 27-fold, at least 28-fold, at least 29-fold, at least 30-fold, at least 31-fold, at least 32-fold, at least 33-fold, at least 34-fold, at least 35-fold, at least 36-fold, at least 37-fold, at least 38-fold, at least 39-fold, at least 40-fold, at least 41-fold, at least 42-fold, at least 43-fold, at least 44-fold at least 19 times, at least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times times, at least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times.

[0857] FMOS expression test: DNA modification enzyme expression rate can be measured using qRT PCR. For vegetative tissues, we sampled V3 leaves. For seeds, we sampled mature seeds. For floral primordia and floral reproductive organs, we sampled immature tassels and spikelets (primordia) and anthers at four stages. These stages are as follows: Spike primordia and tassel primordia: 1cm, 2cm, 4cm tassel and spikelet. Anthers: 0.5mm, 1.0mm, 1.5mm, 2.0mm anthers (throughout pre-meiotic and meiotic divisions).

[0858] For expression evaluation using qRT-PCR protocol, RNA was extracted from frozen (leaves, anthers, primordium, seeds) tissues. gDNA was digested with DNA enzyme for 2 hours. It was used as a template in a one-step qRT-PCR in a 384-well plate, using Sigma and Invitrogen reagents. We used TaqMan assays designed with Primer Express software. Real-time qPCR was run on QuantStudios and after adjusting the baseline and threshold, the Ct (or Cq) value was captured. Expression values ​​were calculated for each sample by: GOI Ct was normalized to endogenous housekeeper / reference gene Ct. Assay design will vary depending on nuclease. For example, for Cas9, the primers for qRT-PCR are: forward primer: TTGTGCTGCTCCACGAACA (SEQ ID NO: 528); reverse primer: GCCAGCCACTACGAGAAGCT (SEQ ID NO: 529), and probe: CTGCTTCTGCTCGTTGTCCTCCGG (SEQ ID NO: 530). For PMI assay, the primers for qRT-PCR were: forward primer: CCGGGTGAATCAGCGTTT (SEQ ID NO: 649); reverse primer: GCCGTGGCCTTTGACAGT (SEQ ID NO: 650), and probe: TGCCGCCAACGAATCACCGG (SEQ ID NO: 651). For control gene ZmEF1α assay, the primers for qRT-PCR were: forward primer: GCGCCGTCACCGTATCC (SEQ ID NO: 652); reverse primer: GCTCGTCGGGCGTCAGTA (SEQ ID NO: 653); and probe: ATCAGAGGCGAGCAGAAACCACACCAC (SEQ ID NO: 654).

[0859] exist Figure 1In the example shown, box 2 is contained in vector 24301 (SEQ ID NO: 1). Nucleic acid 4 corresponds to nucleic acid encoding Cas9 (SEQ ID NO: 4). Nucleic acid 6 encoding at least one guide RNA (gRNA) corresponds to a single gRNA comprising a target agent-RNA sequence and an activator-RNA sequence. In this example, the target agent-RNA sequence encodes a sequence targeting the ADH1 gene. FMOS promoter 10a corresponds to prZmAP1-01, which is a promoter sequence of the maize APETALA1 (AP1) gene specifically expressed in early and late male and female inflorescences. The sequence includes an upstream promoter, a first exon, a first intron, and a second exon (part), and the second exon (part) has a 2bp change to remove the ATG start codon, thereby making the exon untranslatable. In some examples, the FMOS promoter may include at least one of the following: a first native exon modified to remove a start codon, a first intron, and at least a portion of a second exon, wherein the portion of the second exon is untranslatable. The FMOS terminator 10b corresponds to tZmAP1-01, which is a terminator sequence in the maize APETALA1 (AP1) gene. Box 2 can be used to generate multiple edits, for example, multiple insertions or deletions, including multiple single base deletions and larger deletions, as well as single base insertions and larger insertions.

[0860] In many embodiments, the box can include additional features. For example, box 2 includes a gRNA promoter 12 to regulate the expression of at least one gRNA. In this example, gRNA promoter 12 corresponds to prOsU3-01, which is a rice U3 promoter for pol III-dependent transcription of non-coding RNA. The vector can similarly include additional features such as, selective markers, for example, marker 14a, which encodes phosphomannose isomerase (PMI) and can be used with mannose selection to recover stably transformed plants. Additional features include regulatory sequences, such as promoter 14b and terminator 14c for regulating the expression of selective markers.

[0861] The vector may further include additional features to assist transformation, such as features of assisting Agrobacterium-mediated transformation, which is a well-known and useful technology for introducing exogenous nucleic acid molecules into plants. For example, the vector may include parts of a Ti (oncogenic) plasmid, such as virulence (VIR) genes and T-DNA borders (left border or LB and right border or RB). In short, the wild-type form of Agrobacterium contains a Ti (oncogenic) plasmid, which refers to the generation of gall growth in host plants. The transfer of the oncogenic T-DNA region of the Ti plasmid to the plant genome uses virulence genes and T-DNA borders (commonly referred to as LB and RB) encoded by the Ti plasmid, which is a group of forward DNA repeats depicting the region to be transferred. For example, vector 1 includes RB18a, LB 18B, VIR genes 18c and VIR promoters 18d. In many embodiments, the vector portion between RB and LB can be considered as at least one expression cassette.

[0862] A variety of vectors for use with expression cassettes as described herein are commercially available, for example, from Clontech (Palo Alto, Calif.). Methods for co-cultivating Agrobacterium with cultured plant cells or wounded tissue, such as, for example, leaf tissue, root explants, hypocotyls, stem segments, or tubers are also well known in the art. See, for example, Glick and Thompson, (eds.), Methods in Plant Molecular Biology and Biotechnology, Boca Raton, Fla.: CRC Press (1993).

[0863] Plant cells or tissues may be transformed as desired, for example, by Agrobacterium-mediated transformation or biolistic-mediated transformation. Biolistic-mediated transformation (originally described by Klein et al. (Nature 327:70-73 (1987)) relies on microprojectiles, such as gold or tungsten, coated with the desired nucleic acid molecules by precipitation with calcium chloride, spermidine or polyethylene glycol. Using an apparatus such as the BIOLISTIC PD-1000 (Biorad; Hercules Calif.), microprojectile particles are introduced into angiosperm tissues at high speed.

[0864] After transformation, the plant cell or plant tissue is regenerated into a TO plant with multiple T1 seeds. T1 seeds will typically be self-pollinated seeds. In some instances, the TO plant can also be backcrossed to produce "BC1" seeds or outcrossed to produce "F1" seeds. As used herein, T1 seeds are considered to include self-pollination or "self-pollinated" seeds, BC1 seeds, and F1 seeds. This "1" refers to the first generation after the TO transformation generation. Using the embodiments of the present invention as disclosed herein, T1 seeds (including self-pollinated seeds, BC1 seeds, or F1 seeds) contain multiple unique edits. For the purposes of this disclosure, when the method disclosed herein is used on Arabidopsis thaliana via flower transformation (for example, as is well known in the art, the flower is immersed in Agrobacterium), the plant subsequently produced is considered to be a T0 plant. Unique editing may vary from embodiment to embodiment. For example, unique editing may include multiple unique allele substitutions, multiple unique base insertions, and multiple unique base deletions. The number of edits can vary, and can include at least one of at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, and at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95 unique edits per transformation. Unique edits can be determined by comparison of the sequence to an unedited sequence.

[0865] In some embodiments, the methods further include growing the T1 seeds to produce a plurality of T1 plants, measuring at least one phenotype in the plants of the T1 generation, and selecting the plants of the T1 generation based on the measurement of the at least one phenotype, wherein the selected plants have a unique edit. Further, the methods can include sequencing the edited target site or insertion site in the selected plants of the T1 generation, sequencing the edited target site or insertion site in non-selected plants of the T1 generation, and aligning the target sequence or insertion sequence in the selected plants with the target site sequence or insertion site sequence in the non-selected plants for comparison purposes, e.g., to discover which mutations confer a desired phenotype and which do not.

[0866] The methods also include crossing the selected plants of the T1 generation having the unique edit with plants that do not have the unique edit to produce offspring with the unique edit. In some embodiments, the selected plants of the T1 generation can be selfed, for example, to increase homozygosity.

[0867] Figure 2A vector 19 is shown comprising at least one expression cassette 20 suitable for use in a transformation method to produce multiple edits, particularly multiple different allele replacements. The expression cassette 20 comprises a nucleic acid 24 encoding a DNA modification enzyme; a nucleic acid 26 encoding at least one guide RNA (gRNA); and a floral mosaic (FMOS) regulatory sequence 30 including a FMOS promoter 30A and a FMOS terminator 30B.

[0868] In this example, at least one cassette 20 also includes a donor DNA 32 for allele replacement and a replicase 34 for driving donor DNA replication. Also included are LIR 36 (long intergenic region, such as derived from wheat dwarf virus (WDV)), SIR40 (short intergenic region, such as derived from wheat dwarf virus (WDV)) and LIR 42. Replicase 34 triggers rolling circle amplification of donor DNA 32, which is located between LIR 36 and SIR 40, for example, in WDV, where migration protein genes and / or coat protein genes can be seen. A donor left target sequence 44a and a donor right target sequence 44b may also be included to help the donor DNA target genomic DNA. A fluorescent reporter gene 44 (cZsGreen) may also be included. Nucleic acid 24 corresponds to a nucleic acid encoding a site-directed nuclease (e.g., Cas). Nucleic acid 26 encodes at least one guide RNA (gRNA).

[0869] Exemplary FMOS promoters of FMOS regulatory sequences are shown in Table 1a. Table 1b lists exemplary FMOS terminators that may also be used if desired.

[0870]

[0871]

[0872]

[0873]

[0874] Further, one of ordinary skill in the art will be able to modify the FMOS sequences disclosed in Tables 1a and 1b to practice the invention as shown in Tables 1c and 1d below. For example, transcription factor (TF) binding motifs can be removed or modified to achieve or improve the performance of FMOS regulatory sequences. When modifying promoters, applicants typically retain important TF binding motifs, i.e., those associated with flowering. For example, applicants tend to retain the TF binding motif AC:RSP02530 / / OS:Rice (Japonica) / Gene:DEP1 / RE:GTAC-motif 3 / BF:IPA1 (DEP1 is a flowering TF).

[0875] Fig.34By way of example, prZmBde1-02 (SEQ ID NO:50, e.g., in vector 24320) is shown, which is modified to remove 760 bp (38% of the promoter sequence upstream of the 5'UTR). In other examples, FMOS efficacy is maintained with even more modifications to the FMOS promoter. For example, prOsAP1-01 (SEQ ID NO:74) maintains efficacy even after removing 53% of the sequence. It may also be desirable to fuse the promoter or terminator, e.g., (e.g., by intron replacement) to produce a fusion of the Bde1 sequence with the AP1 sequence, and have similar FMOS performance. In some examples, FMOS performance may be improved by replacing the native FMOS promoter intron with an intron from another promoter, e.g., from the ubiquitin promoter. By way of example, an intron or a portion thereof of prBde1-02 (as in vector 24320) can be replaced by an intron or a portion thereof from an ubiquitin promoter (e.g., iUbil-07) (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or all of SEQ ID NO: 531). Further, in some instances, FMOS performance can be improved by fusing the native FMOS promoter with an intron from an ubiquitin promoter. For example, the promoter prBde1-02 (as in vector 24320) can be fused to an ubiquitin promoter, e.g., iUbil-07 (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or all of SEQ ID NO: 531).

[0876]

[0877]

[0878]

[0879]

[0880]

[0881]

[0882]

[0883] The FMOS sequences listed in Tables 1a, 1b, 1c and 1d are intended to be exemplary only, as one of ordinary skill in the art will be able to readily construct expression cassettes as described herein by identifying and screening candidate regulatory sequences (e.g., promoters and terminators) for FMOS activity. Screening will similarly help distinguish non-FMOS regulatory sequences that may not meet the FMOS criteria, e.g., they may not express the editing mechanism in a manner that is strong enough to see sufficient editing, or when used in a heterologous cassette to drive transgenic expression, they behave like constitutive promoters. Alternatively, non-FMOS sequences may fail because they are "missing" and will result in significant expression of the edited transgene in an undesirable location, e.g., non-floral tissue (e.g., callus or vegetative meristem). Methods for validating FMOS regulatory sequences are provided in the following examples.

[0884] Example embodiment:

[0885] 1. A method for generating multiple unique edits in T1 seeds of a plant, the method comprising:

[0886] a) transforming at least one expression cassette into a plant cell or plant tissue, wherein the at least one expression cassette comprises

[0887] a nucleic acid encoding a DNA modifying enzyme,

[0888] Optionally, a nucleic acid encoding at least one guide RNA (gRNA), and

[0889] Floral mosaic (FMOS) regulatory sequence, wherein the FMOS regulatory sequence

[0890] (i) mediating the expression of the DNA modifying enzyme in at least one of flower primordium cells and flower reproductive organs, and

[0891] (ii) mediating a plurality of edits in said at least one of said floral primordium and said floral reproductive organ; and

[0892] b) regenerating the plant cell or plant tissue into a TO plant having a plurality of T1 seeds, wherein the T1 seeds contain the plurality of unique edits.

[0893] 2. The method of 1, wherein the plurality of unique edits are selected from the group consisting of: a plurality of unique allele substitutions, a plurality of unique base insertions, and a plurality of unique base deletions.

[0894] 3. A method as described in 1 or 2, wherein the DNA modification enzyme is a site-directed nuclease, and the site-directed nuclease is selected from the group consisting of: a large-range nuclease (MN), a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a Cas nuclease, a Cas9 nuclease, a Cpf1 nuclease, dCas9-FokI, dCpf1-FokI, a chimeric Cas9-cytidine deaminase, a chimeric Cas9-adenine deaminase, a chimeric FEN1-FokI and Mega-TAL, a nickase Cas9 (nCas9), a chimeric dCas9 non-FokI nuclease, and a dCpf1 non-FokI nuclease.

[0895] 4. A method as described in any one of the above, wherein

[0896] The DNA modifying enzyme is a Cas9 nuclease or a Cpf1 nuclease, and

[0897] The at least one expression cassette comprises a nucleic acid encoding a gRNA, wherein the nucleic acid encoding the gRNA is operably linked to a FMOS promoter or a second promoter.

[0898] 5. A method as described in any one of the above, wherein

[0899] The unique edit is an allele replacement, and

[0900] The at least one expression cassette further comprises a nucleic acid of interest (donor DNA).

[0901] 6. The method of any one of 5, wherein the at least one expression cassette further comprises a replication promoter operably linked to the donor DNA to drive replication of the donor DNA.

[0902] 7. The method of 5 or 6, wherein the at least one expression cassette further comprises at least one LIR.

[0903] 8. The method according to any one of the above, further comprising

[0904] growing the T1 seeds to produce a plurality of T1 plants, and

[0905] measuring at least one phenotype in the plants of the T1 generation, and

[0906] Plants of the T1 generation are selected based on measurement of at least one phenotype, wherein the selected plants have the unique edit.

[0907] 9. The method according to 8, further comprising

[0908] sequencing the insertion site of the donor DNA in the selected plants of the T1 generation,

[0909] sequencing the insertion site of the donor DNA in the non-selected plants of the T1 generation, and

[0910] The insertion site sequence of the selected plant is aligned with the insertion site sequence of the non-selected plant.

[0911] 10. The method of 8 or 9, further comprising crossing the selected plants of the T1 generation having the unique edit with plants not having the unique edit to produce offspring having the unique edit.

[0912] 11. The method of any one of the above, wherein the FMOS regulatory sequence mediates expression in at least one of an inflorescence, microspore mother cell, anther, stamen, tapetum, megaspore mother cell, pistil, ovary, style and stigma.

[0913] 12. A method as described in any one of the above, wherein the FMOS regulatory sequence mediates

[0914] The amount of the DNA modifying enzyme in the floral primordium and the floral reproductive organ is at least 2 times greater than that in the vegetative tissue: at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times 2 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times , at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, at least 100 times, at least 101 times, at least 102 times, at least 103 times, at least 104 times, at least 105 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times, and

[0915] The amount of the DNA modifying enzyme in the floral primordium and the floral reproductive organ is at least 2 times greater than that in the seed: at least 3 times greater, at least 4 times greater, at least 5 times greater, at least 6 times greater, at least 7 times greater, at least 8 times greater, at least 9 times greater, at least 10 times greater, at least 11 times greater, at least 12 times greater, at least 13 times greater, at least 14 times greater, at least 15 times greater, at least 16 times greater, at least 17 times greater, at least 18 times greater, at least 19 times greater, at least 20 times greater, at least 21 times greater, at least 22 times greater, times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times , at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times, At least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times.

[0916] 13. The method as described in any one of the above, wherein the FMOS regulatory sequence comprises a FMOS promoter and a FMOS terminator.

[0917] 14. A method as described in any one of the above, wherein the FMOS promoter is selected from the group consisting of SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:26, SEQ ID NO:29, SEQ ID NO:35, SEQ ID NO:47, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:56, SEQ ID NO:62, SEQ ID NO:65, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:77, SEQ ID NO:80, SEQ ID NO:83, SEQ ID NO:86, SEQ ID NO:514, SEQ ID NO:518, SEQ ID NO:614, SEQ ID NO:615, SEQ ID NO:616, SEQ ID NO:617, SEQ ID NO:618, SEQ ID NO:619, SEQ ID NO:620, SEQ ID NO:621, SEQ ID NO:622, SEQ ID NO:698, SEQ ID NO:700, SEQ ID NO:71 NO:702, SEQ ID NO:704, SEQ ID NO:706, SEQ ID NO:708, SEQ ID NO:710, SEQ ID NO:717, SEQ ID NO:719, SEQ ID NO:721 and SEQ ID NO:723 or a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90% homology thereto.

[0918] 15. A method as described in any one of the above, wherein the FMOS terminator is selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:27, SEQ ID NO:30, SEQ ID NO:36, SEQ ID NO:48, SEQ ID NO:51, SEQ ID NO:54, SEQ ID NO:57, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:72, SEQ ID NO:75, SEQ ID NO:78, SEQ ID NO:81, SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:515, SEQ ID NO:519, SEQ ID NO:699, SEQ ID NO:701, SEQ ID NO:703, SEQ ID NO:705, SEQ ID NO:707, SEQ ID NO:709, SEQ ID NO:718, SEQ ID NO:720, SEQ ID NO:722 and SEQ ID NO:723. NO:724 or at least one of the sequences having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90% homology thereto.

[0919] 16. A method as described in any of the above, wherein the multiple unique edits include at least one of the following: at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95 unique edits.

[0920] 17. A method as described in any one of the above, wherein the at least one expression cassette does not contain a translatable exon that is native to the FMOS regulatory sequence. The FMOS promoter may include at least one of the following: a first native exon, a first intron, and at least a portion of a second exon modified to remove a start codon, wherein the portion of the second exon is untranslatable. Further, in some instances, the FMOS promoter may be modified to include, for example, a ubiquitin intron to enhance FMOS activity.

[0921] 18. A method as described in any one of the above, wherein the FMOS regulatory sequence

[0922] (i) mediating the expression of the DNA modifying enzyme in both male and female floral reproductive organs, and

[0923] (ii) Mediates multiple edits in both male and female floral reproductive organs.

[0924] 19. A method as described in any one of the above, wherein

[0925] The expression of the DNA modification enzyme in the male floral reproductive organ is at least one of the following multiples more than in the floral primordium and the floral reproductive organ than in the vegetative tissue: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times. times, at least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times, and

[0926] The expression of the DNA modification enzyme in the female floral reproductive organ is at least one of the following times more than that in the floral primordium and the floral reproductive organ: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times. , at least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least At least 73 times, at least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times.

[0927] 20. The method as described in any one of the above, further comprising measuring the number of edits in at least one of TO flowers, TO tassels and seeds of TO plants.

[0928] 21. A method for generating multiple unique edits in a T1 seed of a plant, the method comprising:

[0929] a) transforming at least one expression cassette into a plant cell or plant tissue, wherein the at least one expression cassette comprises

[0930] A nucleic acid encoding a DNA modifying enzyme selected from the group consisting of: a Cas9 nuclease and a Cpf1 nuclease,

[0931] a nucleic acid encoding a guide RNA (gRNA), and

[0932] A floral mosaic (FMOS) regulatory sequence comprising an FMOS promoter, wherein the FMOS regulatory sequence

[0933] (i) mediating the expression of the DNA modifying enzyme in at least one of flower primordium cells and flower reproductive organs,

[0934] (ii) mediating a plurality of edits in at least one of said floral primordium and said floral reproductive organ,

[0935] (iii) at least one of at least two times more, at least three times more, at least four times more, at least five times more, and at least six times more, of mediating a DNA modification enzyme in at least one of the floral primordium and the floral reproductive organ than in the shoot apical meristem (SAM), and

[0936] (iv) at least one of at least two times more, at least three times more, at least four times more, at least five times more, and at least six times more, of mediating a DNA modifying enzyme in at least one of the floral primordium and the floral reproductive organ than in the seed;

[0937] b) regenerating the plant cell or plant tissue into a plant having a plurality of T1 seeds; and

[0938] c) growing the T1 seeds to produce a T1 generation, wherein the T1 generation contains at least one of at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95 unique edits.

[0939] 22. The method according to 21, further comprising

[0940] d) measuring at least one phenotype in plants of said T1 generation,

[0941] e) selecting plants of the T1 generation based on measuring at least one phenotype, wherein the selected plants have a unique edit, and

[0942] f) sequencing the insertion site of said donor DNA in said selected plants of said T1 generation.

[0943] 23. The method of claim 21 or 22, wherein the FMOS promoter is selected from the group consisting of SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:26, SEQ ID NO:29, SEQ ID NO:35, SEQ ID NO:47, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:56, SEQ ID NO:62, SEQ ID NO:65, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:77, SEQ ID NO:80, SEQ ID NO:83, SEQ ID NO:86, SEQ ID NO:514, SEQ ID NO:518, SEQ ID NO:614, SEQ ID NO:615, SEQ ID NO:616, SEQ ID NO:617, SEQ ID NO:618, SEQ ID NO:619, SEQ ID NO:620, SEQ ID NO:621, SEQ ID NO:622, SEQ ID NO:698, SEQ ID NO:700, SEQ ID NO:71 ID NO:702, SEQ ID NO:704, SEQ ID NO:706, SEQ ID NO:708, SEQ ID NO:710, SEQ ID NO:717, SEQ ID NO:719, SEQ ID NO:721 and SEQ ID NO:723, or a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90% homology thereto.

[0944] 24. A method for generating multiple unique edits in a T1 seed of a plant, the method comprising:

[0945] a) expressing in a plant cell or plant tissue selected from the group consisting of flower primordium cells and flower reproductive organs

[0946] a nucleic acid encoding a DNA modifying enzyme, and

[0947] a nucleic acid encoding a guide RNA (gRNA),

[0948] At least one of the nucleic acid encoding the DNA modification enzyme and the nucleic acid encoding the gRNA is operably linked to a floral mosaic (FMOS) regulatory sequence, wherein the FMOS regulatory sequence

[0949] (i) mediating the expression of at least one of the DNA modification enzyme and the gRNA in at least one of a flower primordium cell and a flower reproductive organ, and

[0950] (ii) mediating a plurality of edits in said at least one of said floral primordium and said floral reproductive organ; and

[0951] b) regenerating the plant cell or plant tissue into a plant having a plurality of T1 seeds, wherein the T1 seeds contain the plurality of unique edits.

[0952] 25. The method according to 24, further comprising

[0953] delivering a nucleic acid of interest (donor DNA) into said plant cell or said plant tissue where it is expressed, and

[0954] The donor DNA is inserted into the genome of the plant.

[0955] 26. The method of claim 24 or 25, wherein the FMOS regulatory sequence comprises at least one of a FMOS promoter and a FMOS terminator, wherein

[0956] The FMOS promoter is selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:26, SEQ ID NO:29, SEQ ID NO:35, SEQ ID NO:47, SEQ ID NO:50, SEQ ID NO:53, SEQ IDNO:56, SEQ ID NO:62, SEQ ID NO:65, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:77, SEQ ID NO:80, SEQ ID NO:83, SEQ ID NO:86, SEQ ID NO:514, SEQ ID NO:518, SEQ ID NO:614, SEQ ID NO:615, SEQ ID NO:616, SEQ ID NO:617, SEQ ID NO:618, SEQ ID NO:619, SEQ ID NO:620, SEQ ID NO:621, SEQ ID NO:622, SEQ ID NO:698, SEQ ID NO:700, SEQ ID NO:702, SEQID NO:704, SEQ ID NO:706, SEQ ID NO:708, SEQ ID NO:710, SEQ ID NO:717, SEQ ID NO:719, SEQ ID NO:721 and SEQ ID NO:723, or a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90% homology thereto, and

[0957] The FMOS terminator is selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:27, SEQ ID NO:30, SEQ ID NO:36, SEQ ID NO:48, SEQ ID NO:51, SEQ ID NO:54, SEQ ID NO:57, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:72, SEQ ID NO:75, SEQ ID NO:78, SEQ ID NO:81, SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:515, SEQ ID NO:519, SEQ ID NO:699, SEQ ID NO:701, SEQ ID NO:703, SEQ ID NO:705, SEQ ID NO:707, SEQ ID NO:709, SEQ ID NO:718, SEQ ID NO:720, SEQ ID NO:722, and SEQ ID NO:723. NO:724 or at least one of the sequences having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90% homology thereto.

[0958] 27. The method of any one of the above, wherein the TO plant has a mosaic score of at least 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 17, 18, 19 and 20, wherein the mosaic score is determined by Mosaic Score Method 1. The upper limit of the mosaic score will be determined by the efficacy of the FMOS promoter, however, the applicant expects that typical mosaic scores are in the range of at least one of 0.5 to 30, 1 to 25, 2 to 25, 3 to 25, 4 to 25, 5 to 25, 6 to 25, 5 to 20, 5 to 19, 5 to 18, 5 to 17, 5 to 16 and 5 to 15.

[0959] 28. At least one expression cassette for producing at least 20 unique edits in T1 seeds of a plant, said

[0960] The expression cassette contains:

[0961] a nucleic acid encoding a DNA modifying enzyme,

[0962] Optionally, a nucleic acid encoding at least one guide RNA (gRNA), and

[0963] Floral mosaic (FMOS) promoter, wherein the FMOS promoter

[0964] (i) mediating the expression of the DNA modifying enzyme in at least one of flower primordium cells and flower reproductive organs, and

[0965] (ii) mediating a plurality of edits in said at least one of said floral primordium and said floral reproductive organ, and

[0966] (iii) Mediation

[0967] In at least one of the floral primordium and the floral reproductive organ, at least one of the following DNA modifying enzymes is expressed at least one times more than in the vegetative tissue: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, at least 100 times, at least 101 times, at least 102 times, at least 103 times, at least 104 times, at least 105 times, at least 106 times, at least 107 times, at least 108 times, at least at least 74 times less, at least 75 times less, at least 76 times less, at least 77 times less, at least 78 times less, at least 79 times less, at least 80 times less, at least 81 times less, at least 82 times less, at least 83 times less, at least 84 times less, at least 85 times less, at least 86 times less, at least 87 times less, at least 88 times less, at least 89 times less, at least 90 times less, at least 91 times less, at least 92 times less, at least 93 times less, at least 94 times less, at least 95 times less, at least 96 times less, at least 97 times less, at least 98 times less, at least 99 times less, and at least 100 times less, and

[0968] In at least one of the floral primordium and the floral reproductive organ, at least one of the following is expressed more than in the seed by at least one fold: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times , at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, At least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times.

[0969] 29. The box as described in 28, wherein

[0970] The DNA modifying enzyme is Cas9 nuclease or Cpf1 nuclease;

[0971] The cassette comprises a nucleic acid encoding a gRNA, wherein the nucleic acid encoding the gRNA is operably linked to the FMOS promoter or a second promoter;

[0972] The cassette further comprises a nucleic acid of interest (donor DNA) and a replication promoter operably linked to the donor DNA to drive replication of the donor DNA; and

[0973] The FMOS promoter mediates expression in at least one of an inflorescence, a microspore mother cell, anther, a stamen, a tapetum, a megaspore mother cell, a pistil, an ovary, a style, and a stigma.

[0974] 29. The box of claim 27 or 28, wherein the FMOS promoter is selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 20, SEQ ID NO: 26, SEQ ID NO: 29, SEQ ID NO: 35, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 53, SEQ ID NO: 56, SEQ ID NO: 62, SEQ ID NO: 65, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 77, SEQ ID NO: 80, SEQ ID NO: 83, SEQ ID NO: 86, SEQ ID NO: 514, SEQ ID NO: 518, SEQ ID NO: 614, SEQ ID NO: 615, SEQ ID NO: 616, SEQ ID NO: 617, SEQ ID NO: 618, SEQ ID NO: 619, SEQ ID NO: 620, SEQ ID NO: 621, SEQ ID NO: 622, SEQ ID NO: 698, SEQ ID NO: NO:700, SEQ ID NO:702, SEQ ID NO:704, SEQ ID NO:706, SEQ ID NO:708, SEQ ID NO:710, SEQ ID NO:717, SEQ ID NO:719, SEQ ID NO:721 and SEQ ID NO:723, or a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90% homology thereto, and

[0975] Optionally, the cassette further comprises an FMOS terminator selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:27, SEQ ID NO:30, SEQ ID NO:36, SEQ ID NO:48, SEQ ID NO:51, SEQ ID NO:54, SEQ ID NO:57, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:72, SEQ ID NO:75, SEQ ID NO:78, SEQ ID NO:81, SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:515, SEQ ID NO:519, SEQ ID NO:699, SEQ ID NO:701, SEQ ID NO:703, SEQ ID NO:705, SEQ ID NO:707, SEQ ID NO:709, SEQ ID NO:718, SEQ ID NO:720, SEQ ID NO:722, and SEQ ID NO:723. NO:724 or at least one of the sequences having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90% homology thereto.

[0976] 30. A plant produced by the method described in 1-27.

[0977] 31. A plant cell comprising the cassette of 28-29.

[0978] Although various FMOS regulatory sequences have been disclosed above, one of ordinary skill in the art will be able to readily generate FMOS regulatory sequences as described in the claims using Examples 1-4 below.

[0979] Examples

[0980] Example 1: Identification of candidates for FMOS regulatory sequences

[0981] Candidates for use as FMOS regulatory sequences are identified by searching for genes in crop species or related species that meet two initial screening criteria:

[0982] 1. Moderate or high expression in tissues containing many actual reproductive cells (floral tissues). This may include inflorescence primordia, branch meristems, floral meristems, or anther or ovule primordia, which produce somatic (non-reproductive) cell types and germinal (reproductive) cell types. Exemplary FMOS candidates drive expression in anther and ovule cells that have acquired reproductive cell fate (germinal cells, archesporial cells or spore cells, pollen mother cells, or megaspore mother cells). Exemplary FMOS candidates may also have moderate or high expression in meiotic cells (sex mother cells) or post-meiotic gametophytic cells: microspores, megaspores, or eggs and sperm that are fertilized to produce the next generation.

[0983] 2. Exemplary FMOS candidates have no expression or very low expression in precursor stem cells that produce plant regional parts, including transformed tissues (in maize, this means embryos and callus). FMOS candidates should also be silent or have low expression in the apical meristem. FMOS candidates should have low expression in the very early inflorescence meristem - and may first turn on after the floral meristem has differentiated into spikelet pairs or floral meristems. Typical FMOS candidates will not be expressed before flower development.

[0984] For maize genes, expression levels in SAM were classified as “low”, “medium”, or “high” based on normalized expression values ​​from an in-house mRNASeq gene profiling study. In this study, quartiles were calculated using the full matrix of normalized count values ​​for all detected genes in 69 tissues / developmental stages. Quartiles provide thresholds for classifying individual gene expression values ​​as low (less than the first quartile), medium (expression values ​​between the first and third quartiles), and high (expression values ​​greater than the third quartile). Maize callus protein expression values ​​were obtained from Supplementary Table S3 in the following literature: Ge F et al. (2017) Metabolomic and Proteomic Analysis of Maize Embryonic Callus inducedfrom immature embryo. Scientific Reports 7(1):1004. The table contains a list of more than 4,000 proteins identified in all 3 replicates of their proteomic analysis of maize embryo callus. If our candidate gene is not included in the list of proteins expressed in callus, we classify its expression in callus as "off". Similarly, rice callus protein expression values ​​were obtained from the following literature: Abiko M et al. (2013) Identification of proteins enriched in rice egg or sperm cells by single-cell proteomics. [Proteins enriched in rice egg or sperm cells identified by single-cell proteomics] PLoS One. [Public Library of Science Comprehensive] July 25; 8 (7): e69578. Supplementary Table S6 contains a list of proteins detected in rice callus by LC-MS / MS. As for maize genes, if our candidate gene is not included in the list of proteins expressed in callus, we classify its expression as "off". Similar criteria can also be used to evaluate candidates for dicotyledonous plants.

[0985] In addition to identifying candidate sequences by measuring expression, one skilled in the art can also identify candidate regulatory sequences based on gene expression data in plant tissue expression databases, called gene maps, which show the expression of genes in different tissues of many species to evaluate regulatory sequence candidates.

[0986] The gene promoter list that applicant selected is shown in Table 2 below, and the construct design that applicant finally tested.All these genes have flower preference or specific expression.Also show the RNA or protein expression level of gene in the callus or the top meristem of maize or rice tissue.

[0987] Table 2

[0988]

[0989]

[0990] Table 2. Gene expression profiles and construct designs of FMOS candidates (17 in maize; 7 in rice)

[0991] After analyzing the gene atlas, microarray and RNA-seq data set from multiple tissues and data sources, the applicant selected 11 maize genes with reproductive lineage specific expression to be used for testing FMOS activity. The applicant also identified six kinds of rice genes (normally the homologues of the maize genes we found) that show similar expression patterns in rice. Exemplary nominations are included in the anther and ovule primordium and / or germinal cells (sporogenous cells, pollen mother cells, megaspore mother cells or sex mother cells) of male and female reproductive organs, showing a promoter of high priority expression.

[0992] Example 2. Production of constructs containing FMOS regulatory sequences

[0993] Once a candidate list of regulatory sequences is identified, they are screened for activity by constructing constructs using promoters and terminators to drive expression of Cas9 and measuring the resulting editing diversity in stably transformed plants (T0 plants) and progeny (T1 plants).

[0994] Starting from the 19 FMOS candidates identified in Example 1, we designed 24 constructs, including promoter sequences and 5' untranslated regions (UTRs), different variants of terminators, and in some cases, we included the first 15 base pairs of the untranslatable first exon and intron and the second exon (from the FMOS candidate gene) as regulatory sequences. These sequences together constitute the regulatory region that flanks the Cas9 coding sequence and drives the expression of the Cas9 coding sequence. The guide RNA in all 24 constructs targets exon 2 of alcohol dehydrogenase I (ADH1, GRMZM2G442658), and its target site sequence is 5'-cggcaagccactgtcgatcg-3' (SEQ ID NO:6). The selective marker is phosphomannose isomerase (PMI), and we use mannose selection to regain the plant of the stably transformed maize inbred line NP2222.

[0995] An additional control construct had Cas9 driven by the constitutive CMP promoter.

[0996] Figure 1 A schematic diagram of vector 24301 (SEQ ID NO: 1) is shown for use in transforming maize immature embryos to generate multiple different edits in the ZmADH1 gene: promoter prZmAP1-01; terminator tZmAP1-01; guide RNA (gRNA) sequence; rsgRNAZmVLHP-01: single guide RNA (sgRNA) comprising gRNA, tracRNA, and PolIII termination sequence. cPMI: PMI selective marker gene; cCas9: Cas9 nuclease gene; RB: T-DNA right border; LB: T-DNA left border; tNOS: nopaline synthase terminator. cSpec: spectinomycin resistance gene.

[0997] Figure 3 is a schematic diagram of vector 24224 (SEQ ID NO: 10), which is used to transform maize immature embryos.

[0998] Figure 4 is a schematic diagram of vector 24243 (SEQ ID NO: 40), which is used to transform maize immature embryos.

[0999] Figure 5 is a schematic diagram of vector 24265 (SEQ ID NO: 19), which is used to transform maize immature embryos.

[1000] Figure 6 is a schematic diagram of vector 24266 (SEQ ID NO: 22), which is used to transform maize immature embryos.

[1001] Figure 7 is a schematic diagram of vector 24269 (SEQ ID NO: 25), which is used to transform maize immature embryos.

[1002] Figure 8 is a schematic diagram of vector 24270 (SEQ ID NO: 28), which is used to transform maize immature embryos.

[1003] Fig. 9 is a schematic diagram of vector 24289 (SEQ ID NO: 31), which is used to transform maize immature embryos.

[1004] Fig.10 is a schematic diagram of vector 24299 (SEQ ID NO: 34), which is used to transform maize immature embryos.

[1005] Fig.11 is a schematic diagram of vector 24300 (SEQ ID NO: 85), which is used to transform maize immature embryos.

[1006] Fig.12 is a schematic diagram of vector 24305 (SEQ ID NO: 43), which is used to transform maize immature embryos.

[1007] Fig.13 is a schematic diagram of vector 24306 (SEQ ID NO: 46), which is used to transform maize immature embryos.

[1008] Fig.14 is a schematic diagram of vector 24320 (SEQ ID NO: 49), which is used to transform maize immature embryos.

[1009] Fig.15 is a schematic diagram of vector 24426 (SEQ ID NO: 52), which is used to transform maize immature embryos.

[1010] Fig.16 is a schematic diagram of vector 24427 (SEQ ID NO: 55), which is used to transform maize immature embryos.

[1011] Fig.17 is a schematic diagram of vector 24428 (SEQ ID NO: 58), which is used to transform maize immature embryos.

[1012] Fig.18 is a schematic diagram of vector 24454 (SEQ ID NO:61), which is used to transform maize immature embryos.

[1013] Fig.19 is a schematic diagram of vector 24455 (SEQ ID NO: 64), which is used to transform maize immature embryos.

[1014] Fig. 20 is a schematic diagram of vector 24458 (SEQ ID NO: 67), which is used to transform maize immature embryos.

[1015] Fig.21 is a schematic diagram of vector 24459 (SEQ ID NO: 70), which is used to transform maize immature embryos.

[1016] Fig. 22 is a schematic diagram of vector 24460 (SEQ ID NO: 73), which is used to transform maize immature embryos.

[1017] Fig.23 is a schematic diagram of vector 24548 (SEQ ID NO: 76), which is used to transform maize immature embryos.

[1018] Fig.24 is a schematic diagram of vector 24602 (SEQ ID NO: 79), which is used to transform maize immature embryos.

[1019] Fig.25 is a schematic diagram of vector 24688 (SEQ ID NO: 82), which is used to transform maize immature embryos.

[1020] The promoters and terminators used in the various vectors are also listed below along with the sequence information. Example 3. Transformation of plants with an expression cassette containing FMOS regulatory sequences

[1021] For each construct, we sent 10 to 20 single-copy T0 events (except 24265, which had a low transformation frequency and produced only two events) to the greenhouse. We sampled the seedlings and checked for single copies of the PMI and Cas9 transgenes and for editing at the ADH1 target site. We also checked PMI and Cas9 expression in seedling leaves.

[1022] We found that nearly all constructs behaved as expected - had one copy of the transgene by qPCR (see secondary Taqman assay data below) and the ADH1 target site was edited in the control construct (vector 24224, see Taqman score of 0 [both copies edited] or 1 [one copy edited, one WT]), but not in most of the FMOS candidate constructs (see Taqman score of 2 [both copies still WT, or not edited]). In addition, the majority of the FMOS candidate constructs had PMI expression in leaves, but no Cas9 expression - further demonstrating that expression control was restricted to vegetative tissues. This was evident in every construct tested, although not in every event. For example, 13 of the 13 events (transformed plants) with the control construct 24224 had edits at the ADH1 target site (8 of which had both copies of the ADH1 gene edited) and Cas9 expression was over 1000x higher than the control gene.

[1023] In contrast, the ZmAGO18A (ARGONAUTE 18A) promoter / terminator combination in construct 24269 had editing in only two of seventeen events, and only expressed more than 1000x in one event. Therefore, the FMOS candidate worked as expected in 15 of 17 events. According to our database and literature analysis, the Aris gene has high specific expression in the germinal spore archeocytes of maize anthers and ovules. When the regulatory sequence is used to drive Cas9, in most events, editing does not occur in callus tissue, and the expression of Cas9 is limited, which is a desired performance in the FMOS regulatory sequence candidate.

[1024] Likewise, in the construct with the ZmAP1 promoter / terminator, we found no events with edits in the seedling leaf Taqman samples, and Cas9 expression in the leaves was very low. Therefore, these two regulatory regions represent promising FMOS candidates because they allow transformed plants to remain unedited during vegetative development. Similarly, with the exception of the rice OsMEL1 promoter and terminator in constructs 24305 and 24243, most of the other regulatory regions we tested performed well in this seedling assay. We tested both versions, and in most events, both edited during callus or early vegetative meristems, resulting in edited ADH1 in the leaves.

[1025] Table 3

[1026]

[1027]

[1028]

[1029]

[1030]

[1031]

[1032] Table 3. FMOS constructs tested, including leaf editing data (generated by Taqman qPCR assay) and qRT data from seedling leaves. The Taqman assay is a qPCR assay run against a standard internal control, which also happens to be ADH1 (different from the region targeted by the guide RNA, so the control assay is not affected by any small editing of the gene that may occur). For transgenic assays and target site PCR assays, a Taqman qPCR score of "1" indicates the presence of a "wild type" copy of a gene (or transgene). This is determined by comparison within the plate with the control tissue. A score of "2" indicates the presence of two "wild type" copies. A score of "0" indicates the presence of zero wild type copies; in other words, both target sites are edited. For quantitative reverse transcriptase (qRT)-PCR data (two columns on the right side of the table), the expression of two transgenic PMI and Cas9 is scored with reference to the internal standard assay. The numbers provided in these two columns represent the fold change relative to the internal control.

[1033] The control constructs exhibited efficient editing in leaves, based on a consistent wild-type ADH1 Taqman assay score of “0” or “1” in each event, meaning that 1 or both copies of the ADH1 target site carried new mutations induced by the editing machinery. In contrast, the FMOS candidates primarily kept the ADH1 target site intact, likely due to low expression of the Cas9 protein in callus, meristem, and immature leaves. Low expression of Cas9 RNA and CAS9 protein in the FMOS promoter constructs was verified by examining qRT-PCR and ELISA data for each event. Two versions of the rice MEL1 promoter (meiosis aborted at leptotene 1) triggered many events with editing in leaves but low Cas9 expression; the editing was most likely due to callus or vegetative meristem expression of Cas9 when Cas9 paired with the OsMEL1 regulatory region. This is an example of a candidate regulatory sequence with a unique meiosis-specific phenotype, but it is not an ideal FMOS candidate due to early expression in callus or vegetative meristem. We discarded plants or constructs that showed editing in callus or vegetative meristems (as indicated by editing in leaves). Because leaves are derived from meristems, we inferred that leaf editing implies meristem editing.

[1034] We focused on using the FMOS regulatory sequences to generate events with multiple edits in flowers (as determined by tassel editing and mosaicism assays discussed in Example 4 and illustrated in Table 4).

[1035] Example 4. Generating multiple unique edits and confirming floral-enriched expression of the editing machinery

[1036] Two tassel editing and mosaicism assays were used to illustrate the performance of FMOS regulatory sequences. Both assays indicate whether editing is present at ADH1 target sites - the first assay is a pollen ADH1 biochemical assay using dehydrogenase staining, which can be used to quickly provide an effective readout of adh1 function in pollen collected from up to 48 different positions on the tassel. The second assay is a target-side DNA-seq performed by next-generation sequencing (NGS), performed only on tassel samples from T0 events that showed highly edited positions in the adh1 pollen assay screen. The NGS assay revealed the diversity of editing at the target site. Therefore, by combining data from the first and second screens, we were able to generate a very high-quality dataset showing the efficiency of floral editing and the degree of mosaicism in different parts of the tassel. The NGS data of the promoter were then analyzed by mutation type and position on the tassel to calculate a mosaicism score that approximates the average number of different editing events detected in a given tassel of the T0 event.

[1037] Fig.26a Sampling from the tassels of each event for the assay is illustrated. Sample the tassels of each event 24-48 times. Harvest the spikelets at the pre-anthesis stage and place the upper and floret anthers into the wells of a 96-well plate in a standard sequence as shown - in the same position in each plate. If we do not have enough laterals to fill rows C and D or rows G and H, we simply stop at the number of laterals we have in each event.

[1038] In order to quantify the extent of editing in the tassel and the diversity of editing events, 24 to 48 tassel spikelets (flowers) were taken from different positions on the tassel (each tassel had hundreds of spikelets), and the three anthers of the upper floret of each spikelet were clamped in half with tweezers and loaded into the wells of a 96-well ADH1 staining plate. Each well of the plate contained 800 μl 0.1 M Tris-HCl (pH 6.7) at room temperature. The three lower floret anthers from each spikelet were placed in the corresponding wells of a 96-well DNA sequencing plate to be stored in a -80 refrigerator. The pollen in the staining plate was stained for ADH1 activity using the scheme of Wisman et al. Genetic and molecular characterization of an Adh-1null mutant [Genetic and molecular characteristics of Adh-1 null mutants] Mol Gen Genet [Molecular Genetics and General Genetics] 1991 226: 120-128 (we made it suitable for 96-well plate screening to enable high-throughput analysis of various parts of the flower).

[1039] Briefly, staining plates were frozen overnight at -20°C and thawed for 2-3 hours. Pollen was collected by pipetting through a 96-well 40 μm nylon mesh sintered filter plate. It was blotted dry and placed in a 96-well collection plate; each well contained 400uL MTT staining buffer containing 94% v / v 0.1M Tris-HCL, 6% v / v ethanol, 0.3g / L nicotinamide adenine dinucleotide (NAD), 0.2g / L 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and 40mg / L phenazine methylsulfate (PMS). The plate was then covered and incubated at 28°C in the dark for one hour. Wild-type pollen stained purple. Pollen that lost ADH1 activity remained unstained (transparent). ADH1 is not required for pollen development, survival or fertilization. 11% of non-viable pollen was detected in the WT control sample. Samples with <1% ADH1 positive pollen were rated as completely edited; Samples with >90% ADH1 positive pollen were rated as unedited. Partially edited entries were characterized by the percentage of ADH1 positive pollen in the well, with an estimated increment of 5% (i.e. 5%, 10%, 15, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% and 95%). The average percentage was normalized (-11%, based on control). The diversity of editing was assessed by the frequency of different %ADH1+ brackets. Constructs with mosaicism and high editing efficiency were nominated for NGS to further illustrate the diversity of editing.

[1040] Table 4

[1041]

[1042] Table 4. ADH1 staining scores (average of hundreds of samples). These data encourage us to focus our pollen sequencing efforts on three constructs 24301, 24320 and 24269, which have the highest amount of pollen assumed to be edited. Eight of the twelve FMOS promoters show <50% editing. Calculate the % of edited adh1 pollen for those events that do not show editing in leaf samples. Calculate the % of edited pollen by subtracting % WT ADH1+ pollen from 100. Then normalize this number by subtracting 11% (which is the average % of unstained pollen in WT samples).

[1043] Although predicted to be expressed in the germinal lineage, Table 4 shows that eight FMOS promoter candidates show> 50% WT pollen by ADH1 staining. One of the reasons may be that those FMOS candidates have flower expression rather than germinal expression. Although we have used many high-quality expression data sets, in many cases, the samples contain a mixture of germinal cells and somatic cells. Another possible explanation is that the expression activity is low in a heterologous environment due to the missing chromatin features or distal sequences. Cis-enhancers may be hundreds of kilobases away from the genes they enhance in maize. The selection of FMOS promoters can also be further assisted by improved RNAseq data from specific reproductive lineage cells and by utilizing chromatin landscape studies (such as ChIP-seq, ATAC-seq, DNAse I-seq, MNase-seq or other data types). Therefore, this will lead to the design of chimeric promoters with different enhancers, promoters, introns and terminators to induce high specific expression in reproductive cells.

[1044] ADH1 staining also helps to examine the degree of mosaicism in ADH1 gene editing. By looking at 24 to 48 samples at different positions on the tassel, we can see that the extent of editing varies. For example, Table 5 below shows the results of ADH1 pollen staining for 14 events of construct 24320 (over 7 plates). In the first event, GVG00887355, some anther samples had more WT pollen (40%, in the A4 well) than other anther samples (5% in the B7 well). This is a sign of mosaicism-if the editing occurs very early in development, all wells will have "0%" WT pollen, as is the case with the control CMP promoter (see Table 6).

[1045] Table 5

[1046]

[1047]

[1048] Table 5. Shows an example of pollen staining results. This is for 14 events from construct 24320. The numbers in each well represent the percentage of stained (unedited) pollen. Some events like GVG00887372 did not have much editing, but 11 of the 14 events had efficient editing. The prevalence of some samples with higher and lower levels of editing in the plate indicates mosaicism.

[1049] Table 6

[1050]

[1051]

[1052] Table 6. Control construct 24224 (CMP constitutive promoter) shows 100% editing in pollen.

[1053] Table 7

[1054]

[1055]

[1056] Table 7. ADH1 staining results for 24305 Many events showed premature expression of Cas9 as shown in the editing assay data in leaves (scores of 0 or 1). This resulted in a lack of mosaicism in the tassels (most / all wells in these events showed nearly 100% editing).

[1057] Table 7a

[1058]

[1059]

[1060] Table 7a. ADH1 staining results for 24460. 13 of 15 events had high efficiency editing. The prevalence of some samples with higher and lower degrees of editing in the plate suggests mosaicism.

[1061] The ADH1 assay is an inexpensive, first-pass screen for determining editing diversity, while DNA sequencing of the ADH1 target site is a more specific assessment. In this example, we sequenced only constructs that showed no or little leaf editing by the ADH1 staining assay but >50% ADH1 editing in pollen. For those selected events in constructs 24301, 24320, 24460, 24305, and 24269, anther samples were taken from the -80 freezer and genomic DNA was extracted. PCR amplification of the ADH1 target site was performed on each sample. The PCR amplicons were sent for next-generation sequencing. A cutoff of 1% read abundance was set for sequences that were considered "real."

[1062] Here we present the molecular analytical approaches developed and implemented in-house to enable high-throughput screening and characterization of genome editing events, including high-throughput TaqMan assays, Sanger and ICE assays, next-generation sequencing (NGS), and genome editing assays.

[1063] Mosaicability scoring method 1:

[1064] A three-step process can be used to directly measure the FMOS activity of any promoter driving a nuclease and / or guide RNA to determine a "mosaic score" via Mosaic Score Method 1. This process can be used to calculate the mosaic score for each T0 event or progeny plant. This scoring method can be used for any flowering plant or crop.

[1065] Step 1) T0 one or more inflorescences or inflorescence parts (i.e. anthers and carpels) are sampled four to hundreds of times. Create a map of the inflorescence or the whole plant, indicating the source of the different samples for tracking. The nature of the map can depend on the plant. In maize, we arrange by tassel branches. In soybean or tomato, flower branches or flower clusters can be used.

[1066] Step 2) NGS was performed on these samples, a cutoff of 1% was set for the read % and individual plant profiles were created for each edit obtained.

[1067] Step 3) Mosaicism scores are calculated using these profiles as follows: the first edit is counted once, all subsequent edits (if adjacent to samples with the same edit in the same branch / cluster) are counted only if the read % differs from the adjacent read % by >15% (read % less than 10% can be excluded from the adjacent criterion). All counted edits of all edit types (alleles) for the entire plant are summed and then divided by the number of samples. This gives the mosaicism score for the plant. The mosaicism score is equal to the number of unique edits identified / sample.

[1068] Applicants consider that a mosaicism score greater than 0.5 should be considered a "functional" FMOS promoter. A score greater than 2 should be considered "good". A score greater than 5 should be considered a "very good" FMOS promoter. A score greater than 10 should be considered an "excellent" FMOS promoter. A score greater than 15 should be considered an "elite" FMOS promoter.

[1069] An example of a mosaic score measured in corn using Mosaic Score Method 1 is provided below.

[1070] High-throughput TaqMan screening

[1071] For editing cleavage site analysis, target-specific primers are designed to be located on both sides of the expected editing region, wherein the target-specific probe is placed at the editing cleavage site. Quantitative real-time PCR is performed for copy number analysis in high-throughput screening of genome editing events. Two copies of the target site indicate that there is no editing, one copy indicates that one allele is edited, and zero copies indicate that both alleles are edited. Real-time PCR is set up in a 384-well plate. The reaction is repeated multiple times to simultaneously amplify the target gene and the endogenous control gene. For each sample, the Taqman assay is set by combining 3 μl of extracted genomic DNA with 3 μl of a master mixture comprising Jumpstart Taq ReadyMix (Sigma) (supplemented with primers each having a final concentration of 300 nM and probes each having a final concentration of 100 nM). The 384-well plates were heat sealed and real-time PCR was performed in an ABI 7900 real-time PCR machine or a Life Technologies Quant Studio Flex 7 instrument using the following parameters: 95°C for 5 min, 95°C for 5 sec, and 60°C for 30 sec for 40 cycles. Post-run data analysis was performed according to the manufacturer's instructions.

[1072] For allelic replacement / target insertion analysis, unique TaqMan assays can also be designed to suit specific purposes (not described herein).

[1073] NGS (Next Generation Sequencing) and Genome Editing Analysis Pathways

[1074] Events were characterized using GNS and genome editing assays.

[1075] Genome editing assays are designed to detect and characterize target sequence changes or allelic substitutions using NGS data.

[1076] The applicants performed the following analysis tasks:

[1077] Retrieve Illumina reads from NGS libraries

[1078] Trimming read segments

[1079] Merge paired-end reads

[1080] Read sampling (rather than using all reads)

[1081] Align the merged reads to the WT reference

[1082] Align the WT reference to the reference with the desired allele substitution (allele substitution events only)

[1083] Call variants in the reference that have the desired allele substitution (allelic substitution events only)

[1084] Call variants between individual reads and the WT reference

[1085] Identify the presence and location of partial alignments

[1086] Identify common variants among reads

[1087] Determine variant frequencies and remove low-frequency variants

[1088] Identification of variant-induced frameshifts

[1089] Assess the impact of phased indels on the reading frame

[1090] Determine haplotype

[1091] ·Produce result report

[1092] Archive the results in the NGS repository

[1093] However, others may prefer other ways to assess their pathways.

[1094] DNA was extracted and purified using standard laboratory protocols in 96-well plates. If sample size is limited, such as a small number of pollen grains, the amount of extraction buffer and elution buffer was reduced accordingly. Target-specific primers were designed to flank the target editing region. For Adh1 editing analysis, target-specific primer 1 (FE4228) of CTAACTCGTTGAGTGGCCCTG (SEQ ID NO: 546) and target-specific primer 2 (FE4229) of CAGATAAGCCGCCAAGAAGG (SEQ ID NO: 546) were designed. The NGS universal TAG sequence was added to the designed target-specific primers.

[1095] Set up PCR reactions in a 96-well plate using a high-fidelity polymerase (such as Q5). For each PCR reaction, add 12.5ul 2x Q5 Hot Start High-Fidelity Master Mix, 1.25ul Primer 1, 1.25ul Primer 2, 4ul DNA, and 6ul H2O and mix. PCR amplifications were run under the following conditions:

[1096]

[1097] Check the quality of the PCR products and dilute them with H2O at a ratio of 1:50 or 1:100 for next generation sequencing. In NGS library preparation, nested PCR is performed to add sample-specific barcodes and sequencing TAGs to each sample. Up to 384 barcoded samples are pooled together and sequenced by Miseq as 2x 250bp or 2x 300bp paired-end reads.

[1098] To capture low-frequency heterogeneous editing, the default analysis parameters were adjusted accordingly, for example, increasing the "number of reads analyzed" to >= 1000 and reducing the "minimum variation percentage" to = < 1%. When the "minimum variation percentage" is set low, more false-positive SNPs may appear. To help assess false positives, some WT samples were included in the process and analysis.

[1099] Adh1 target reference used in NGS analysis (SEQ ID NO:548):ctaactcgttgagtggccctgtttctcggacgtaaggcctttgctgctccacacatgtccattcgaattttaccgtgtttagcaaggg cgaaaagtttgcatcttgatgatttagcttgactatgcgattgctttcctggacccgtgcagctgcggtggcatgggaggccggcaagccactgtcg atcgaggaggtggaggtagcgcctccgcaggccatggaggtgcgcgtcaagatcctcttcacctcgctctgccacaccgacgtctacttctggggag gccaaggtatctaatcagccatcccatttgtgatctttgtcagtagatatgatacaacaactcgcggttgacttgcgccttcttggcggcttatctg

[1100] Sanger sequencing and ICE analysis pipeline

[1101] As an alternative to NGS, others may prefer Sanger sequencing and CRISPR Editing Inference (ICE) (developed by Synthego Inc.) for high-throughput sequencing analysis of genome editing events. Primer design, PCR, cleanup of PCR products, and Sanger sequencing followed standard laboratory protocols.

[1102] In order to use this data to estimate mosaicism, it is important that we determine which edits are likely independent (e.g., made in different cells of the developing plant) and which are considered part of a putative clonal sector (derived from a single cell where the edit originally occurred). Better FMOS activity will be associated with the former - more independent edits (occurring later in plant development) rather than the latter - edits detected as part of the same clone-derived cell sector. To do this, for each edit (e.g., mutation, variant, transgenic event), the edits are mapped onto a graph of the tassel. This graph is called the "tassel graph" for each variant. For a good demonstration of our edit assessment in practice, see Table 8. For this example, a four base pair deletion (a very common global edit) from the TCGA of two different events is shown, including the location of the sample plate and the 96-well plate. To understand and manage mosaic sector patterns, we converted the raw sequence reads (as shown in Table 8) into tassel graphs (as shown in Table 9) to facilitate neighbor / adjacent analysis.

[1103] Table 8

[1104]

[1105] Table 8 shows the sequence information of TCGA for two events 182: missing.

[1106] Table 9

[1107]

[1108] Table 9. Tassel plot of an allele (or edit) "missing TCGA": cells represent the spikelet sample position on the tassel that contains the edit, and the percentage of the edit in all NGS reads of those samples, for both events

[1109] Table 9 is a tassel map with the same information as shown in Table 8. Editing 182 of the two events: Deletion TCGA was found in multiple locations in different parts of the tassel, including the central spike and side branches. The % in each cell represents the fraction of reads with the sequence and corresponds to one well of a 96-well plate. Each well is a different tassel spikelet. Each well also has other different edits that appear in other tassel maps not shown in this article. This mutation appears in different positions in the tassel, but some adjacent parts in the central spike of the two events may show sectors from the same single editing event early in plant or tassel development. In order to standardize the process of all events and constructs, and therefore be able to compare which constructs act as the best FMOS promoter, we set the following rule: Check the tassel map, starting from the bottom of each spike, the first mutation is always considered a unique mutation. Moving up from the first mutation, other mutations are counted only when the mutation abundance is less than 10% or the difference in mutation abundance from the previous spikelet exceeds 15%. In other words, the first edit found in a given column (in the tassel diagram, the column represents the tassel branch or central tassel) is counted; subsequent edits are also counted unless the same edit is represented in the previous cell where the percentage of representation in the NGS data between the two samples is within + / -15% (this is based on the idea that such edits with similar abundance are more likely to be part of a continuous sector). Edits with <10% representation are excluded from the 15% rule because their rarity suggests that they are not part of a continuous sector. Using this rule, the edits shown in bold italics in Table 9 cannot be considered unrelated to previous edits and are therefore not counted. For this sequence variant in Table 9, seven independent edits were determined for MSKE181002A045A and 17 independent edits for MZKE181002A151A.

[1110] For each event, the total number of independent edits (all edits) was calculated and the resulting value was divided by the total number of samples evaluated by NGS (typically 12 samples for the central spikelet plus 6 samples for each lateral branch, but the total number varied for different events). This calculation gave us an average of the independent edits for each sampled spikelet, and this average was considered the “mosaicism score”. For the constitutive promoter CMP, mosaicism scores for events sampled 24 to 48 times would appear in the range of 0.021-0.083 when only one (homozygous) or two (biallelic) edits were detected throughout the tassel. Regarding the FMOS promoter, first-pass analysis revealed several events that showed no edits in the pollen ADH1 assay and also had very few or no edits in the NGS data - these are likely events where transgene expression was almost completely silenced - and gave very low mosaicism scores (0.0-.1). Removing these events (MZKE181800A021A, MZKE181800A056A, MZKE181800A074A, MZKE182000A005A, MZKE182000A029A, MZKE182000A031A) from the analysis, the mosaic scores of the five FMOS promoters we evaluated by NGS ranged from 1.24 (prZmAgo18A-01, construct #24269) to 11.79 (prZmBde1-02, construct #24230). Thus, by this conservative analysis, the mosaicism of these FMOS promoters was shown to be approximately 15-fold (1.24 / 0.083) to 561-fold (11.79 / 0.021) higher than that achievable with ubiquitous promoters. Given that not all tassels and ears were sampled for NGS, this is certainly an underestimate. Likewise, floral mosaicism is defined herein as the number or frequency of different (diverse) edits in the germ cells of an event: these higher mosaicism scores clearly indicate that edits in the tassel are highly diverse and therefore FMOS promoter activity is higher. Likewise, the mosaicism score represents the number of different edits detected on average in the spikelet samples.

[1111] Figure 26b Mosaicism scores are shown for each of the five constructs for which we evaluated NGS data.Table 10 shows mosaicism scores for events from exemplary FMOS promoters based on NGS data.

[1112] Table 10

[1113]

[1114]

[1115] FMOS activity was further confirmed by sequencing of T1 progeny seeds: up to 100 seeds were germinated from each of the five events of constructs 24301, 24320, 24269 and 24460. Taqman assays indicated zygosity for the target site in ADH1. (Table 11)

[1116] Table 11

[1117]

[1118] Table 9b. Summary of Taqman scores for T1 progeny (pooled from five events) for four FMOS constructs. A Taqman score of 0 means both copies are edited; a score of 1 is heterozygous; a score of 2 is "WT / WT" or unedited.

[1119] The total edited alleles edited in the progeny were calculated by adding the number of progeny with one copy of edited ADH1 to 2*(the number of progeny with two copies of edited ADH1). The predicted number of edits from the male side was then subtracted (this was determined by multiplying the paternal editing rate [from Table 4] by the number of progeny plants sampled); the difference between the total edited allele and the predicted paternal editing number for each construct was then divided by the total progeny number to provide a proxy for the maternal editing rate.

[1120] Using this method, it was found that the maternal editing rates of 24301, 24320, 24269 and 24460 were 61%, 73%, 62% and 61%, respectively. Other examples may have other editing rates, such as at least 50%, at least 55%, at least 60%, at least 70%, at least 80%. Therefore, the prZmBde1-02 promoter in construct 24320 is the most effective in editing female cells (in female spikes), although prOsAP1-01 (24460) is the best in editing male cells (85% male cell editing rate in male spikes). To understand the diversity of editing found in the offspring, DNA was extracted from offspring with one or two edited ADH1 alleles. The target site PCR products were sequenced. In most cases, chromatographic double peaks were observed starting from the target site. To clarify the Sanger sequencing results, the CRISPR Editing Inference (ICE) program (Sanger) distinguished the two alleles.

[1121] Tables 12 and 13 illustrate the results of T0 pollen ADH1 staining and sequencing of 50 T1 progeny from vector 24269, event number MZKE181002A135A. This event did not show editing in the leaves, and ADH1 staining appeared to show good FMOS activity. We did not perform NGS sequencing, but checked the T1 progeny, and most individuals were biallelic, with two different edits inherited from the maternal (egg cell) and paternal (pollen grain / sperm cell) flowers. In some cases, no edits were found or the inherited edits were the same, but this is an exception rather than a rule. This is just one example of hundreds of similar results obtained from this promoter and other FMOS regulatory systems tested.

[1122] Table 12. Pollen ADH1 staining data for event MZKE181002A135A (construct 24269)

[1123]

[1124] Table 13

[1125]

[1126]

[1127]

[1128]

[1129]

[1130]

[1131]

[1132]

[1133]

[1134]

[1135]

[1136]

[1137] S = Sample #

[1138] Table 14 illustrates the sequencing results of T1 progeny from vector 24301, event numbers MZKE18100A050A, MZKE18100A063A, MZKE18100A064A, MZKE18100A078A and MZKE18100A084A. Most individuals are biallelic, with two different edits inherited from the maternal (egg cell) and paternal (pollen grain / sperm cell) flowers. In a few cases, no edits were found or the inherited edits were the same.

[1139] Table 14

[1140]

[1141]

[1142]

[1143]

[1144]

[1145]

[1146]

[1147]

[1148]

[1149]

[1150]

[1151]

[1152]

[1153]

[1154]

[1155]

[1156]

[1157]

[1158]

[1159]

[1160]

[1161] S#=Sample#

[1162] Table 15 illustrates the sequencing results of T1 progeny from vector 24320, event numbers MZKE18200A019A, MZKE18200A028A, MZKE18200A045A, MZKE18200A057A and MZKE18200A064A. Most individuals are biallelic, with two different edits inherited from the maternal (egg cell) and paternal (pollen grain / sperm cell) flowers. In some cases, no edits were found or the inherited edits were the same.

[1163] Table 15

[1164]

[1165]

[1166]

[1167]

[1168]

[1169]

[1170]

[1171]

[1172]

[1173]

[1174]

[1175]

[1176]

[1177]

[1178]

[1179]

[1180]

[1181]

[1182]

[1183] S#=Sample#

[1184] Table 16 summarizes the sequencing results of T1 offspring from vector 24460, event numbers MZKE184306A030A, MZKE184306A047A, MZKE184306A060A, MZKE184306A062A and MZKE184306A104A. Most individuals are biallelic, with two different edits inherited from maternal (egg) and paternal (pollen grains / sperm cells). In some cases, no edits were found or the inherited edits were the same. Information from E1 offspring is used to calculate maternal editing frequency.

[1185] Table 16

[1186]

[1187]

[1188]

[1189]

[1190]

[1191]

[1192] The total number of different edits generated in the progeny, e.g., at least one nucleotide difference, was found. The four data types were combined with leaf editing rates, ADH1 staining data, and pollen mosaic scores and used to evaluate the FMOS regulatory system and understand the temporal and tissue specificity of FMOS constructs.

[1193] Of the 24 FMOS constructs tested, five appeared to be efficient FMOS constructs based on pollen NGS data, so we checked some of the five events via NGS and evaluated the T1 progeny. Based on pollen NGS and mosaic score analysis, we found that three of the five were confirmed to be very high-quality FMOS constructs: 24320 (prZmBde1-02), 24301 (prZmAP1-01), and 24460 (prOsAP1-01). In the T0 leaf samples, these constructs gave low or zero editing in most events, and highly diverse editing in tassels and progeny - resulting in floral mosaic scores for most events averaging above 3 (based on mosaic scores, since each tassel has at least 100 spikelets, and each spikelet will be edited at least 3 times to calculate, predicting more than 300 different editing events in the entire tassel). The CMP constitutive promoter (construct 24224) showed 100% editing in leaves. These events also showed close to 100% editing in the tassel by ADH1 staining. Edited sequences in different tassel samples were not analyzed. For several other constructs, although there was little or no evidence of editing in the leaves, the editing efficiency in the tassel was also quite low by ADH1 staining. This may be due to the promoter not being very strong in its native state, or it being strong in its native state but not very specific for the germinal tissue that produces pollen. Perhaps the necessary cis or trans enhancer sequences were not captured in the regions selected for the promoter and / or terminator.

[1194] A box in vector 24320 uses prZmBde1-v2, a highly expressed flower-specific promoter extracted from the natural maize BEARDED EAR1 gene ID Zm00001d017614, as the FMOS promoter. Cas9 is driven by the natural ZmBde1 promoter sequence from B73v5 in the construct for specific expression in early inflorescence meristems (in situ hybridization data from Thompson et al., 2009). The sequence used includes promoter, first exon, first intron and second exon (part). This is a total of 5741bp of regulatory sequences, including 2000bp upstream promoter sequence + 209bp 5'UTR, 182bp first exon, large first intron (3332bp) and part of the 15bp second exon ending with a 3bp start codon. The change of two bp is used to remove the ATG start codon in the exon and remove a BbsI site for cloning, which will not destroy any motif of any transcription factor binding site, as determined by Nsite. The terminator sequence after Cas9 is also from the ZmBde1 natural terminator, which consists of 828bp downstream of the stop codon, including 324bp of 3' untranslated region. Zero of the fourteen events containing this construct showed any editing in the leaves. Although three events had minimal editing in the tassel, 10 events showed efficient editing of the ADH1 gene in pollen, and large editing diversity (mosaic score = 11.79) was seen from the NGS data of these events. A wide variety of editing (maternal editing score = 73%) was also inherited in T1 seeds. The version of the promoter lacking the first intron was used to express Cas9 with tNOS (construct 24265) or the natural ZmBde1 terminator (construct 24266), but it was learned by ADH1 staining that none of these combinations could be efficiently edited. Thus, for this construct, floral expression was improved when the first intron was included as part of the promoter.

[1195] Another FMOS box in vector 24301 contains prZmAP1-v1, a high-expression flower-specific promoter extracted from the native maize APETALA1 gene (ID Zm00001d007949). The promoter sequence is 2846bp, including 520bp upstream sequence + 220bp 5'UTR, 185bp first exon, large intron (2846bp) and 15bp second exon ending with 3bp start codon. The terminator tZmAP1-v1 is a 953bp regulatory sequence, including 324bp 3'UTR and 629bp downstream sequence. Eleven of the fourteen events showed no editing in the leaves (two seedling leaf samples were tested), while the other three events showed only very low editing percentages. In ADH1 staining, eleven plants showed very high editing levels. The tassel mosaic score based on sequencing of ADH1 target site PCR products from 48 anther samples was 4.16, indicating that the editing in the T0 tassel was highly diverse. The maternal editing score was 61%. The T1 progeny showed different editing. Another embodiment can include a rice version of the promoter tested, taken from the OsAPETALA1 gene (Os07t01089000-02), construct 24660. The promoter also performed well in leaf sampling and ADH1 pollen staining assays. We examined four events by NGS, and the different edits found in the data resulted in a mosaic score of 5.86. The T1 progeny also showed a wide variety of editing results.

[1196] Another FMOS cassette in vector 24460 contains prOsAP1-v1, a high-expression flower-specific promoter extracted from the native rice APETALA1 gene (IDOs07g01820 or Os07t01089000-02). The promoter sequence contains 2000bp of upstream sequence + 124bp 5'UTR, 185bp first exon (ATG at the 5' end is changed to AAG to ensure that translation does not start prematurely), followed by the first intron (2416bp), and 15bp second exon ending with a 3bp start codon. The terminator tZmAP1-v1 is a 1000bp regulatory sequence, including 361bp of 3'UTR and 629bp of downstream sequence. Fifteen of the fifteen events showed no editing in leaves (two seedling leaf samples were tested), and 13 events showed very high editing levels in ADH1 staining. The tassel mosaic score based on sequencing of ADH1 target site PCR products from up to 48 anther samples per event was 6.01, indicating a high diversity of edits in the T0 tassel. The maternal editing score was 61%. The T1 progeny exhibited diverse edits - we found that the diversity of T1 matched that seen with other highly functional FMOS constructs 24320 and 24301 (both had events that produced more than 20 different mutant alleles in their T1 progeny); similarly, 24460 had events that produced more than 20 different mutant alleles in its T1 progeny.

[1197] Another FMOS construct 24269 contains prZmAGO18A-v1, a high-expression germinal cell-specific promoter extracted from the maize ARGONAUTE18A gene (ID Zm00001d006351). Cas9 is driven by the natural ZmAGO18A promoter sequence in the construct, including 1,225bp upstream sequence, the first exon containing the complete 5'UTR, and 755bp intron until the first 15bp of exon 2. The terminator consists of an 1116bp sequence downstream of the stop codon, including the 3'UTR stop codon (including the 3'UTR). Thirteen of the fifteen events showed no editing in the leaves, and these thirteen events also showed effective editing and moderate mosaicism in pollen ADH1 staining. T1 seed data indicate that the inherited edits in the offspring are highly diverse (the percentage of maternally derived edits is 62%). However, many of the edits in the offspring are. The fact that so many progeny carry the same edited sequence leads to the hypothesis that the editing occurs in some event very early in meristem development - so that a large fraction of T0 events carry the same edit. Indeed, this hypothesis is supported by NGS analysis - using our new mosaicism scoring method to analyze NGS data, we found that the mosaicism score is much lower than other FMOS promoters - only 1.24. While this is still at least 14-fold higher than ubiquitous or constitutive promoters, it is 3 to 10-fold lower than other FMOS promoters. These analyses confirm both the robustness of our assay pathway and the power of the mosaicism scoring process to elucidate exactly how certain FMOS promoters behave relative to others.

[1198] Finally, to confirm the floral tissue expression enrichment and reveal the floral developmental stage at which these promoters drive high editing enzyme expression, we performed qRT-PCR on T1 plants carrying one copy of the FMOS promoter editing construct. We tested 3 events from construct 24320 (prZmBde1-02: events MZKE182000A057A, MZKE182000A064A and MZKE182000A028A), 3 events from construct 24301 (prZmAP1-01: events MZKE181800A050A, MZKE181800A033A and MZKE181800A073A) and 3 events from construct 24269 (prZmAGO18A-01: events MZKE181002A088A, MZKE181002A080A and MZKE181002A121A). We tested the expression of a PMI-selective marker (phosphomannose isomerase) under the control of a constitutive promoter ( Fig.41 ) and expression of Cas9 controlled by the FMOS promoter ( Fig.42). The qRT assay utilized the positive control gene elongation factor 1α to normalize for all sample types. We collected samples from juvenile (<3 cm) tassels before flower formation, premeiotic anthers (<1 mm), juvenile (<3 cm) ear primordia, and unfertilized R1 stage kernels.

[1199] like Fig.41 As shown, expression of the selectable marker gene PMI was shown by qRT-PCR, and the PMI gene was expressed in all events of all constructs. Although the levels varied between different flower tissues (anthers were most abundant), the levels were fairly equivalent between events and constructs. Fig.42 As shown, expression of the nuclease Cas9 was shown via qRT-PCR, with the Cas9 gene being expressed in all events of all constructs, although for 24269 the expression was rather low in all tissue types. This may be due to the use of prZmAGO18a by construct 24269, which is specific for germinal cells (pre-meiotic cells), which are very rare compared to all somatic cells of these tissues. Therefore, the Cas9 signal can be diluted by extracting total RNA from the entire inflorescence. In contrast, Cas9 using prZmBde1-02 (24320) and ZmAP1-01 (24301) had high expression in floral tissues, both male and female (tassels, anthers, panicles and kernels). It was fairly equivalent between the different events of the constructs. Example 5: Maintaining FMOS promoter efficacy in the presence of promoter modifications

[1200] According to the teachings of the applicant, for example, as illustrated in Examples 1-4 above, the FMOS promoter can be easily modified and still maintain FMOS activity. For example, prZmBde1 is modified to remove a domain that lacks a significant flower transcription factor binding motif and is not in the upstream or downstream of the transcription or translation start site in close proximity. In order to test whether these domains are non-essential to FMOS activity, we removed them, then rebuilt the construct and retested them by the same method described in Examples 2 and 3. For example, we constructed promoter prZmBde1-03 (SEQ ID NO:615) by removing 1,696bp from the intron (iZmBde1-01) in prZmBde1-02 (SEQ ID NO:538) in construct 25002. We produced ten events, and 8 / 10 events were shown to be not edited in leaves (Taqman assay was 2, which means that both copies of ADH1 were not edited). Of these eight events, seven were predominantly negative (showing a good degree of editing) for ADH1 pollen in most spikelet samples (Table 17). Of these seven events, we performed NGS on three events (GVG01189795, GVG01189803, and GVG01192964) and found an average mosaic score of 11.72.

[1201] Table 17. Leaf assay and pollen ADH1 staining scores for ten events from construct 25002. Truncated form of the ZmBdel-02 promoter in which a large portion of the intron was removed.

[1202]

[1203]

[1204] We germinated 100 self-pollinated T1 progeny from three events (GVG01189795, GVG01189803, and GVG01192964) and performed PCR sequencing of a subset of target sites. We found dozens of different edits and widely diverse editing results from T1 male and female inflorescences. As exemplified in Table 18 below (from event GVG01189803), we found that different individuals often contained multiple edits in a 50% read fraction: In other words, T1 plants were often bi-allelic, receiving two different edits - one from the male gametophyte (pollen-derived or tassel-derived) and the other from the female gametophyte (egg-derived or tassel-derived). In some cases, the edits received from males and females were identical in these T1 progeny.

[1205] Table 18. T1 editing results in promoter 25002, event GVG1189803.

[1206]

[1207]

[1208]

[1209]

[1210]

[1211]

[1212]

[1213]

[1214]

[1215]

[1216]

[1217]

[1218]

[1219]

[1220] For construct 25002, the TO tassel mosaicism score and T1 diversity were essentially equivalent to the non-truncated promoter in Example 4. Thus, prZmBde1-02 and prZmBde1-03 (40% shorter) are roughly equivalent to the FMOS promoter.

[1221] Interestingly, when we truncated the ZmBde1-02 promoter in a slightly different way, in construct 25003 (SEQ ID NO: 539), we obtained another efficient FMOS promoter. In construct 25003, we included the promoter prZmBde1-04 (SEQ ID NO: 616), which removed 2,337 bp from an intron (iZmBde1-01) within prZmBde1-02. In total length, this promoter is less than 60% of the length of ZmBde1-02 (due to the large gap in intron 2 removed in the truncated promoter prZmBde1-04, the alignment will show less than 60% similarity). Despite this large deletion, we found 12 / 12 events with no editing in leaves (maintaining specificity), and 7 events were predominantly negative by the ADH1 pollen assay (showing good editing in the tassel) in most spikelet samples (Table 14), while 5 / 12 events did not show good editing in the tassel by the ADH1 assay.

[1222] Table 19 shows leaf assay and pollen ADH1 staining scores for 10 events from construct 25003, which contains prZmBde1-04, a truncated form of the ZmBde1-02 promoter in which a large portion of the intron was removed, constituting more than 40% of the total prZmBde1-02 regulatory sequence.

[1223] Table 19

[1224]

[1225]

[1226] By ADH1 staining, in 7 events with strong editing in male spike, we performed NGS and found mosaicism in four events (GVG01191002, GVG01191008, GVG01191010 and GVG01191012). We sprouted 100 self-pollinated T1 offspring from three events (GVG01191002, GVG01191010 and GVG01191012), and PCR sequencing was performed on the target site of a subset. We found more than 20 different editings in the self-pollination offspring of these events. As illustrated in Table 20 below for event GVG01191002, we found nine different alleles in only 15 offspring by PCR-seq. In most cases, the editing found is different (double allele T1), although in some cases they are identical (homozygous T1 offspring).

[1227] Table 20 summarizes the T1 PCR sequencing data for construct 25003 event GVG01191002, showing ADH1 target site editing in 15 progeny.

[1228] Table 20

[1229]

[1230]

[1231] In yet another example, we removed 300 bp from the very beginning of the promoter prZmBde1-02 and 1,696 bp from the first intron to obtain prZmBde1-07 (SEQ ID NO: 619) in construct 25006 (SEQ ID NO: 542). 17 events were generated, and all had no evidence of leaf editing, while 15 / 17 events showed at least moderate levels of editing by tassel ADH1 staining (Table 21), and 5 / 17 events showed a high degree of editing based on ADH1 staining. Events GVG01195902, GVG01195903, GVG01195904, GVG01195891, and GVG01195894 had an average of 14% staining, assuming that a small percentage of unstained pollen is dead (as can be seen from the negative control [WT pollen] where approximately 10% of the pollen is unstained), then approximately 75%-85% of the pollen is edited. NGS was performed on the corresponding tassel samples from events GVG01195902, GVG01195904, and GVG01195894, and these samples produced an average mosaic score of 11.88.

[1232] Table 21 shows leaf assay and pollen ADH1 staining scores for ten events from construct 25006, which is a truncated version of the ZmBdel-02 promoter in which a large portion of the intron was removed and the first 300 bp of the 5' end of the promoter were also removed.

[1233] Table 21

[1234]

[1235]

[1236]

[1237] 100 T1 self-pollinated progeny from events GVG01195902, GVG01195904, and GVG01195894 were germinated and a subset of gRNA target sites were PCR sequenced. We found more than 20 different edits in the self-pollinated progeny of these events. In most cases, the edits found were different (biallelic T1), although in some cases they were the same (homozygous T1 progeny).

[1238] Comparing these modified promoter results to construct 24320 (prZmBde1-02), we found that by all measures, T0 leaf editing, pollen staining, NGS diversity, E1 diversity, and mosaicism scores did not affect FMOS activity. One minor exception was that we did see a decrease in FMOS activity in construct 25003, which removed an 8 bp sequence that corresponds to a putative transcription factor binding motif for the rice transcription factor Leafless1 (LFL1). Interestingly, if all Bde1 promoter explorations are considered, it is clear that not even the entire intron is required - in fact, you can remove a large portion of the intron and the promoter can still function as a FMOS promoter. Furthermore, at least the first 300 bp of the promoter that we initially captured in prZmBde1-02 are not required. It is possible to remove a large portion of the intron, 2,337 bp (prZmBde1-04) and still obtain decent FMOS activity, although the mosaicism score does drop by a few points, likely due to the lack of the OsLFL1 site. Fig.38 An overview of truncated promoters is illustrated. Overall, 25002 had an average score of 11.7 (compared to 11.8 for 25320); 25003 had a score of 9.1; and 25006 had a score of 11.9. Constructs 25004 and 25005 performed poorly in terms of conversion or editing frequency.

[1239] As can be seen, the FMOS promoter developed using Examples 1-5 can be easily modified in a variety of ways and still maintain FMOS promoter efficacy. In addition, the methods disclosed herein can be used to easily determine whether the modification of the FMOS promoter identified using Examples 1-5 has a negative impact on FMOS activity. For example, in construct 24460, the rice AP1 regulatory sequence performed well as a FMOS promoter, however, in prOsAP1-02 (construct 25007), we removed a large part of the intron; in prOsAP1-03 (construct 25008), we removed a large part of the promoter; in prOsAP1-04, we removed both parts (from the intron and the promoter). In all three constructs, FMOS activity was reduced because some events showed editing in leaves (ADH1 leaf taqman assay scores of 0 or 1). However, after further characterization by ADH1 pollen staining, NGS of tassel spikelet samples, and T1 progeny analysis, FMOS activity was clearly retained in some cases where the leaf Taqman assay scored 0. For example, in construct 25007, 12 of the 13 events had a leaf Taqman assay score of 0 or slightly above 0, indicating some editing in the leaves. We assume that this means that the shoot meristem has also been edited, so the tassel and spike will not be mosaic. However, if we look at the pollen staining data, we see that some samples retain ADH1 activity - exemplifying FMOS activity, not what we usually see with constitutive promoters (Table 22).

[1240] Pollen ADH1 staining assay data are shown in Table 22. The percentages shown in the wells of these plates are the proportion of pollen sampled that were ADH1+.

[1241] Table 22

[1242]

[1243]

[1244] In addition, we looked at the T1 data from event GVG01195930, which scored 0 in the T0 leaf Taqman, and we found extensive and diverse editing in the major biallelic progeny summarized in Table 23 below.

[1245] Table 23

[1246]

[1247]

[1248] Similarly, construct 25008, event GVG01195946, generated pollen NGS data with a mosaic score of 4.97 and edited T1 data showing very broad diversity (Table 24). Table 24 summarizes the diversity of E1 edits from event GVG01195946, a truncated form of prOsAP1, prOsAP1-03, which removed approximately 1 kb from the promoter.

[1249] Table 24

[1250]

[1251]

[1252] Similarly, construct 25009 (SEQ ID NO: 545) using a modified form of prOsAP1 (SEQ ID NO: 622) removed over 52% of the promoter (a total of 2.4 kB removed from the 4.6 kB promoter), and all four events produced good editing diversity, and the NGS data showed a large number of edits per sample. For a small example of the NGS data, see Table 25; the mosaic score for this event GVG01195812 was 5.92. For GVG01195906, the score was 6.38, and for GVG01195915, the score was 5.63. Table 25 summarizes the NGS data for event GVG01195812, which shows some editing in the leaves, but still retains FMOS activity, as demonstrated by the table, where a wide variety of edits were found in the tassel; at least 5 or 6 edits were found in each pollen sample. The mosaic score for this event was 5.92.

[1253] Table 25

[1254]

[1255]

[1256]

[1257]

[1258]

[1259]

[1260]

[1261] In conclusion, the truncated promoter prOsAP1-01 maintained FMOS activity. Fig.39The promoter prOsAP1 is shown to be truncated in the following constructs: in construct 25007 (average mosaic score of 4.9); in construct 25008 (average mosaic score of 4.9); and in construct 25009 (average mosaic score of 6.0). These are good performances compared to the baseline of construct 24460 (6.0).

[1262] By another example, prZmAP1-01 (SEQ ID NO: 2) was modified to remove domains that lacked significant flower transcription factor binding motifs and were located in the promoter. To test whether these domains were non-essential for FMOS activity, we removed them, then rebuilt the constructs and retested them by exactly the same method as described in Examples 2 and 3. For example, we constructed the promoter prZmAP1-03 (SEQ ID NO: 614) by removing 1,746bp (46%) from the prZmAP1-01 promoter (SEQ ID NO: 537) of construct 24997. We generated 11 events, of which 8 scored "2" (i.e., they were not edited) in the leaf Taqman assay, and 5 of them did not appear to be edited at the tassel stage (see Table 26 below) by ADH1 pollen assessment, while three events looked like they had FMOS activity. In addition, the leaf Taqman of one event was "0" and had pollen ADH1 staining that looked like a constitutive promoter (all samples were "0"). Two events were scored as "1" in the leaf assay.

[1263] Table 26 shows the ADH1 staining data for 11 events from construct 24997 (truncated prZmAP1). The score represents the proportion of pollen grains that stained positive for ADH1 for each sample.

[1264] Table 26

[1265]

[1266]

[1267] By ADH1 pollen staining, the three events GVG01189786, GVG01189784 and GVG01189781 scored "2" and had good FMOS apparent activity. The latter two were sent to perform tassel spikelet NGS and T1 progeny analysis. In addition, the event GVG01189790, which was scored as "1" (heterozygous) by Taqman assay and was known to maintain FMOS activity by ADH1 staining, was subjected to tassel spikelet NGS. The mosaic scores of the three events were similar, but GVG01189790 was the lowest (4.33), followed by events with better FMOS indicators in the T0 stage (GVG01189781 was 4.75 and GVG01189784 was 5.58). In the T1 analysis, many different edits can be seen in the progeny of each of these two events. There are values ​​similar to those seen for the original prZmAP1-01.

[1268] The mosaicism score of the original promoter was compared to its truncated form ( Fig.26c ), you can see that there is no change in score between prZmAP1-01 (construct 24301) and the truncated prZmAP1-03 (construct 24997); there is no change in score between prZmBde1-02 and prZmBde1-03 and prZmBde1-07 (25002 and 25006, respectively), while there is a slight decrease in the score of prZmBde1-04 (25003); there is little change in score between prOsAP1-01 (24460) and prOsAP1-02, prOsAP1-03, and prOsAP1-04 (25007, 25008, and 25009, respectively), except for a slight decrease in 25008.

[1269] We also recalculated the mosaicism score using a different formula (Mosaicism Method 2) to recheck the results of the NGS datasets for all constructs. As described previously, we used a tassel plot for each allele type (or edit type). Starting from the bottom of each spikelet, the first mutation was always considered a unique mutation. Moving upward from the first mutation, additional mutations were only counted if the mutation abundance differed from the previous spikelet sample by more than 15%. Mutations with an abundance <10% were also subject to this rule (previously, they were excluded from this rule; see Example 4). For each event, the total number of independent edits was calculated (across all edits) and the resulting value was divided by the total number of samples evaluated by NGS. Therefore, this 'mosaicism score' represents the average of the unique edits for each spikelet sample. A mosaicism score was calculated for each event. Fig.26dMosaicism scores using Mosaicism Method 2 (which is more conservative and may underestimate the actual editing diversity) are shown - the overall trend is the same as before. Table 26d shows the mosaicism scores using Mosaicism Method 2, which subjects edits with <10% abundance to the <15% neighbor rule (see above and Example 4 for explanation). Unless otherwise specifically indicated, all mosaicism scores in the claims are calculated using Mosaicism Method 1.

[1270] Provided below are detailed descriptions of exemplary vector constructs comprising expression cassettes according to various embodiments of the invention.

[1271]

[1272]

[1273]

[1274]

[1275]

[1276]

[1277]

[1278]

[1279]

[1280]

[1281]

[1282]

[1283]

[1284]

[1285]

[1286]

[1287] Truncated promoters and introns are summarized below.

[1288]

[1289]

[1290]

[1291] Example 6: Efficient allele replacement (homologous directed repair) by driving Cas9 via the FMOS promoter

[1292] Embodiments of the present invention can also be used for allele replacement, including improving the efficiency of allele replacement. Five constructs suitable for allele replacement are described below. All five designs use the same donor DNA and guide RNA sequence, which targets the herbicide-tolerant acetolactate synthase (ALS) gene GRMZM2G143008 on chromosome 5. The donor DNA contains a sequence of about 1000bp, which has a high homology to the endogenous maize gene. Near the center of the donor sequence are some SNPs that are different between the donor and endogenous sequences, including a SNP that induces the amino acid 568 of the ALS coding sequence to change from tryptophan to leucine. This well-known mutation confers resistance to a wide spectrum of common herbicides. Therefore, the use of the ALS target provides a dominant genetic feature that is successful in editing (allelic replacement). Several events can be performed for each of the following six construct designs, and the T1 offspring are sprayed with imazethapyr herbicide (312ml / ha Pursuit). Those plants that survived the herbicide treatment were sampled, and the putative allelic replacement alleles were amplified and sequenced.

[1293] The first design is to use the FMOS promoter to drive the expression of Cas9, to have a guide RNA driven from a rice U3 promoter, and to provide a copy of the DNA donor for homology-driven repair in a T-DNA vector. Alternatively, a guide RNA target site flanking the DNA donor in the T-DNA can be included so that the donor can be released from the T-DNA insertion site and can be used as a repair template for homology-directed repair at the target site (e.g., in the ALS gene). For example, vector construct 25123 (SEQ ID NO: 88).

[1294] The second, third and fourth designs use two different FMOS promoters: one drives the expression of Cas9 (preferably, the promoter is active before or during meiosis in one or both of the male and female reproductive organs (anthers and carpels); the other promoter is used to drive the expression of spliced ​​mRNA that produces the trans-acting replication factors Rep and RepA from the Mastrevirus genus. In this example, we used the wheat dwarf virus Rep / RepA coding sequence (see design below). Rep / RepA triggers rolling circle amplification of donor DNA, which is located between the long intergenic region (LIR) and the short intergenic region (SIR) of the same virus, where the migration protein gene and the capsid protein gene are usually found. We placed the ZsGreen sequence between the LIR and the SIR, where the Rep / RepA gene is usually located. The exact location of ZcGreen and the DNA donor may vary; for example, their locations can be interchanged.

[1295] The expression of Rep / RepA can be driven by a constitutive promoter, but more typically by a FMOS promoter. This may be useful because, in some cases, the continued induction of RepA expression is associated with a negative impact on overall plant adaptability, health and seed production. In many instances, Rep / RepA is expressed during a very short time window in the germinal cell lineage, and then closed (by using a second FMOS promoter) when the expression of Cas9, Cas12a or other targeted nucleases is turned on. This design limits the expression of Rep / RepA to a shorter time window (to prevent toxicity to plants) but before nuclease expression, allowing enough time to amplify the DNA donor before the target gene begins editing. In many instances, Rep / RepA is expressed about one or two days before editing nuclease (Cas9), or even just a few hours. In the design below, the FMOS promoter prZmAGO18A (which has low or medium expression in the germinal cells of anthers and ovules) confirmed by early anther primordium specificity is used to drive the expression of Rep / RepA genes. The expression of Cas9 nuclease is controlled by the regulatory region of the prZmBde1-02 promoter, which is active during flower specification, before meiosis and during meiosis. The construct also contains the DNA donor sequence that we want to use for allele replacement, which includes homology arms with high sequence similarity to the cleavage site in the natural target locus, as well as LIR, ZsGreen and SIR sequences in the same loop. The action of RepA protein will lead to amplification through rolling circle amplification, resulting in a large number of single-stranded DNA donor molecules, which may become double-stranded due to the activity of the host DNA polymerase. When double-stranded, the loop can be cut by Cas9 and guide RNA (see vector AR-SDN2_REP_NoCut( Fig.33 )(AR-SDN2_REP_NoCut (SEQ ID NO: 186). Optional one or more guide RNA target sites may also be located on the sides of the donor sequence, such as the vector AR-SDN2_REP_2Cuts ( Fig.32 ) (SEQ ID NO:#187) and vector AR-SDN2_REP_1cut ( Fig.31 )(SEQ ID NO:188) - these sites can be cleaved by nucleases, linearizing and / or releasing the circular donor, which can make it suitable for participation in recombination (homologous directed repair) after Cas9 cleavage of the target site. The characteristic diagram of SEQ ID #XYZ (AR-SDN2_REP_CUT) is shown below. In some embodiments, it is also desirable to have the promoter driving RepA expressed at less than 50% of the promoter driving CRISPR. For example, in embodiments where plant toxicity is observed or it is desired to increase the rate of event generation, it may be desirable to reduce the expression of RepA.

[1296] In another example, the MSCA1 (MS22) promoter (prZmMSCA1-01) (SEQ ID NO: 717) (GRMZM2G442791) and terminator 1ZmMSCA1-01 (SEQ ID NO: 718) that drive expression during a very short window of flower development are used to express Rep / RepA. This expression is quickly turned off because this gene is only responsible for the specialization of reproductive cells in anthers and ovules. After a few hours, the prZmAGO18A FMOS promoter turns on the expression of Cas9 in the newly differentiated germinal cells in anthers and ovules at the pre-meiotic stage. In other designs, the FMOS promoter prOsMEL1 (SEQ ID NO: 41 or 42) and terminator tOsMEL1 (SEQ ID NO: 44 or 45) are used to drive the expression of targeted nucleases. In another design, highly expressed putative FMOS promoters and terminators from the following genes: protein phosphoglycosidase 4 (ppg4) (GRMZM2G032528) with prZmPPG4-01 (SEQ ID NO:719) and tZmPPG4-01 (SEQ ID NO:720); NADH dehydrogenase (GRMZM2G158188) with promoter (SEQ ID NO:721) and terminator (SEQ ID NO:722); or CID11 (GRMZM2G173428) with promoter prZmCID11 (SEQ ID NO:723) and terminator tZmCID11 (SEQ ID NO:724) can be used to drive expression of nuclease (a highly expressed, very enriched germinal cell gene). In yet another design, a number of flower and germinal cell-specific genes can be identified from the following source article on the initial germinal cell population in flowers (Kelliher and Walbot (2014) Germinal Cell Initials Accommodate Hypoxia and Precociously Express Meiotic Genes Plant Journal 77(4)639-652.), and from this source, two are selected: ideally, low- or moderately expressed, highly specific genes that can be used to drive expression of Rep / RepA, which is active slightly earlier in development than a second promoter, which is expressed at a higher level and is used to express the nuclease.

[1297] Fig. 27An embodiment is illustrated, including the use of one guide RNA target site flanking the donor sequence preceding the LIR and SIR. Sequential activation of RepA and Cas9 in the flower triggers high copy donor DNA, which can be used for allele replacement at the target site by homologous recombination. In this case, the target site is shown in the ALS target gene (GRMZM2G143008 on chromosome 5). This version has a gRNA cleavage site that linearizes the amplified DNA donor replicon.

[1298] Fig.28 Another embodiment is described, which is similar to Fig. 27 , but includes two guide RNA target sites in the replicon flanking the DNA donor sequence. This will completely release the amplified DNA donor from the LIR, ZsGreen and SIR sequences after cleavage by Cas9 and guideRNA.

[1299] Fig.29 Another embodiment is described, which is similar to Fig. 27 The embodiment is shown in Figure 1, except that the donor DNA is not flanked by gRNA target sites, so that the amplified donor sequence remains circular and is not linearized.

[1300] Fig.30Another embodiment is described, which also uses two FMOS promoters, but in this case there is no viral element. Instead, the first FMOS promoter (prAGO18a-01) drives the expression of a reverse transcriptase (RT) enzyme that specifically interacts with a reverse transcriptase RNA (e.g., Ec86), while the second FMOS promoter drives the expression of Cas9 or another targeted nuclease (SEQ ID AR-SDN2_RETRON). The donor DNA in this construct is produced in cells by reverse transcription from a reverse transcriptase-donor RNA-guide RNA chimeric transcript that is controlled by a rice U3 promoter. Reverse transcription of the reverse transcriptase sequence and the donor RNA results in the donor DNA sequence being covalently linked to the guide RNA. This method of allele replacement using retrotransposons, also known as CRISPEY (Sharon, E., Chen, SA.A., Khosla, NM, Smith, JD, Pritchard, JK, and Fraser, HB (2018) FUNCTIONAL GENETIC VARIANTS REVEALED BY MASSIVELY PARALLEL PRECISE GENOME EDITING Cell 175(2):544-557) delivers abundant donor DNA to the site of the guide RNA and Cas9 double-strand break at the target site. In this example, we used the FMOS promoter to increase the efficiency of successful allele replacement at the embryo or callus stage, rather than the standard use of CRISPEY (which is still presumably very inefficient and potentially phytotoxic). Fig.44 A schematic diagram of vector AR-SDN2_RETRON (SEQ ID NO: 697) is illustrated, which is another retromer-based example according to various aspects of the present disclosure.

[1301] Discussed above Fig.32 A schematic diagram of vector AR-SDN2_REP_2Cuts (SEQ ID NO: 187) is shown, which is an example of a vector suitable for allele replacement. Additional features of vector AR-SDN2_REP_2Cuts are further described in the notes below.

[1302]

[1303]

[1304]

[1305]

[1306]

[1307] Multiple constructs are constructed to test different allele replacement designs using replicons containing donor DNA, which are optionally flanked by guide RNA target sites, Rep or RepA gene cassettes controlled by a FMOS promoter, and Cas9 or another nuclease cassette driven by another FMOS promoter, and a selective marker cassette. The allele replacement frequencies in these preferred constructs are determined as described by measuring the editing frequency produced in stable transformed plants (T0 plants) and the number of successful allele replacements produced in offspring (T1 plants). The guide RNA in these constructs targets exon 2 of the acetolactate synthase (ALS, GRMZM2G143008) gene, and its target site sequence is 5′-CAAGTATGTGTGCGCTCTGT-3′ (SEQ ID NO: 6). The selective marker is phosphomannose isomerase (PMI) under the control of a constitutive promoter, and mannose selection is used to regain the plant of the maize inbred line NP2222 of stable transformation. For each construct, approximately 10 single-copy T0 events were identified after seedling sampling to confirm that the ADH1 target site was not edited and grown to maturity. PMI and Cas9 expression in leaves was also examined by qRT-PCR. Plants were outcrossed and self-pollinated.

[1308] Embryo rescue is performed, followed by Taqman testing for successful allele replacement, or mature seeds are planted and germinated plants are sprayed with a standard concentration of herbicide such as Pursuit (e.g., imazethapyr) at a concentration of at least 200 mL / ha to determine the frequency of plant survival (because survival may be due to successful allele replacement). Samples are collected and tested by Taqman assay to determine whether the donor replaced the target sequence: if positive, it indicates a possible successful replacement. These survivors are sequenced to confirm that they do represent fully SDN2-edited alleles.

[1309] As mentioned above, this allele replacement may be very challenging in plants, for example, because the non-homologous end joining pathway is very conducive to DNA repair. By using the FMOS promoter to drive the editing mechanism, people can overcome the above challenges and easily generate allele replacement in most T0 events. The disclosure of the applicant can be used to save a lot of time and a lot of resource costs. Compared with the prior art, five to ten events can be carried out relatively easily by using this technology (in some instances) and the allele replacement in the T1 generation can be restored. This improvement may be attributed (at least in part) to two factors. First, by generating mosaic T0 plants with hundreds of thousands to tens of thousands of edits, each T0 plant obviously has a better chance of producing at least one or more T1 seeds with allele exchange. The diversity of mutations inherited in seeds reduces the overall energy and financial resources required in the process-some events can be simply carried out and seeds can be screened for correct editing. Then sequencing can be used for screening as needed. Compared with producing 1000 T0 events, the time, financial resources and labor required for sequencing 1000 T1 seeds are less. This is mainly because sequencing is relatively fast and cheap. In short, the FMOS regulatory system, in particular the FMOS promoter, provides significant advantages. The second reason why the FMOS promoter can improve the efficiency of allele replacement is that the homologous recombination machinery can be expressed in germinal lineage cells before and during meiosis. Allele replacement requires these factors that promote homologous repair, but when most constitutive promoters will express Cas9 and edit, these factors are not expressed very high in callus or vegetative tissue. Due to at least these reasons, the applicant believes that the FMOS promoter is significantly superior to the constitutive promoter in allele replacement.

[1310] Example embodiment:

[1311] 1. A method for producing multiple unique allele substitutions in T1 seeds of a plant, the method comprising:

[1312] a) transforming at least one expression cassette into a plant cell or plant tissue, wherein the at least one expression cassette comprises

[1313] a nucleic acid encoding a DNA modifying enzyme,

[1314] Optionally, a nucleic acid encoding at least one guide RNA (gRNA),

[1315] Target nucleic acid (donor DNA),

[1316] a replication promoter operably linked to the donor DNA to drive replication of the donor DNA,

[1317] as well as

[1318] Floral mosaic (FMOS) regulatory sequence, wherein the FMOS regulatory sequence

[1319] (i) mediating the expression of the DNA modifying enzyme in at least one of flower primordium cells and flower reproductive organs, and

[1320] (ii) mediating a unique allele replacement in at least one of said floral primordium and said floral reproductive organ; and

[1321] b) regenerating the plant cell or plant tissue into a TO plant having a plurality of T1 seeds, wherein the T1 seeds contain a plurality of unique allelic replacements.

[1322] 2. The method of 1, wherein the DNA modification enzyme is a site-directed nuclease, and the site-directed nuclease is selected from the group consisting of: a meganuclease (MN), a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a Cas9 nuclease, a Cpf1 nuclease, a dCas9-FokI, a dCpf1-FokI, a chimeric Cas9-cytidine deaminase, a chimeric Cas9-adenine deaminase, a chimeric FEN1-FokI and a Mega-TAL, a nickase Cas9 (nCas9), a chimeric dCas9 non-FokI nuclease, and a dCpf1 non-FokI nuclease.

[1323] 3. The method as described in 1, wherein

[1324] The DNA modifying enzyme is a Cas9 nuclease or a Cpf1 nuclease, and

[1325] The at least one expression cassette comprises a nucleic acid encoding a gRNA, wherein the nucleic acid encoding the gRNA is operably linked to a FMOS promoter or a second promoter.

[1326] 4. The method of any one of the above, wherein the at least one expression cassette further comprises at least one LIR.

[1327] 5. The method according to any one of the above, further comprising

[1328] growing the T1 seeds to produce a plurality of T1 plants, and

[1329] measuring at least one phenotype in the plants of the T1 generation, and

[1330] Plants of the T1 generation are selected based on measuring at least one phenotype, wherein the selected plants have an allelic exchange.

[1331] 6. The method of 5, further comprising crossing the selected plants of the T1 generation having the unique edit with plants that do not have the unique edit to produce offspring having the unique edit.

[1332] 7. The method of any one of the above, wherein the FMOS regulatory sequence mediates expression in at least one of an inflorescence, microspore mother cell, anther, stamen, tapetum, megaspore mother cell, pistil, ovary, style and stigma.

[1333] 8. The method as described in any one of the above, wherein the FMOS regulatory sequence mediates the expression of the DNA modification enzyme in the flower primordium and the flower reproductive organ more than in the vegetative tissue, and wherein the FMOS regulatory sequence mediates the expression of the DNA modification enzyme in the flower primordium and the flower reproductive organ more than in the seed (relative amount, for example, at least 2 times more, at least 3 times more, which is the same as described in other embodiments).

[1334] 9. The method as described in any one of the above, wherein the FMOS regulatory sequence comprises a FMOS promoter and a FMOS terminator.

[1335] 10. A FMOS promoter which may be selected from those described herein.

[1336] 11. A FMOS terminator which may be selected from those described herein.

[1337] 12. A method as described in any of the above, wherein the plurality of unique allele substitutions comprises at least one of: at least 5, at least 10, at least 15, and at least 20 unique allele substitutions.

[1338] 13. A method as described in any one of the above, wherein the at least one expression cassette does not contain a translatable exon that is native to the FMOS regulatory sequence. The FMOS promoter may include at least one of the following: a first native exon, a first intron, and at least a portion of a second exon modified to remove a start codon, wherein the portion of the second exon is untranslatable. Further, in some instances, the FMOS promoter may be modified to include, for example, a ubiquitin intron to enhance FMOS activity.

[1339] 14. A method as described in any one of the above, wherein the FMOS regulatory sequence

[1340] (i) mediating the expression of the DNA modifying enzyme in both male and female floral reproductive organs, and

[1341] (ii) Mediate multiple allelic substitutions in both male and female floral reproductive organs.

[1342] 15. The method as described in any one of the above, further comprising measuring the number of edits in at least one of TO flowers, TO tassels and seeds of TO plants.

[1343] 16. At least one expression cassette as described in any one of 1-15 above.

[1344] 17. A plant produced by the method described in 1-15.

[1345] 18. A plant cell comprising at least one expression cassette according to 16.

[1346] Example 7: Efficient expression alteration via FMOS promoter (promoter bashing)

[1347] Embodiments of the present invention can also be used to alter gene expression. For example, a FMOS promoter driving an engineered nuclease can be paired with multiple guide RNAs targeting the gene regulatory region (promoter, terminator, 5′ or 3′ untranslated region, intron, cis-enhancer or cis-repressor).

[1348] Therefore, the construct has the ability to induce new mutations at multiple positions in the gene regulatory region in the flower, thereby producing small and large insertions and deletions of the regulatory region, as well as rearrangements in some cases. This will have many effects on the regulation mode of the gene. In some germinal lineages, and thus in some T1 offspring seeds, this will lead to stable downregulation, stable upregulation or changes in the tissue specificity or performance of the gene under different genetic backgrounds. The idea of ​​designing multiple guide RNAs to the gene regulatory region is called promoter re-hitting, but significant improvements can be achieved using the FMOS promoter. Therefore, the combination of the FMOS promoter (or FMOS regulatory region) driving Cas9 and the promoter re-hitting concept is a major improvement over the promoter re-hitting performed using a constitutive promoter. For background information on promoter re-hitting, see Rodrl′guez-Leal et al., 2017, Cell [Cell] 171, 470-480, October 5, 2017.

[1349] The traditional concept of promoter knocking involves generating large editing diversity of one region. The present disclosure improves promoter knocking by using FMOS promoter to generate diversity more efficiently and rapidly and with minimal crossing efforts.

[1350] In order to prove the effective expression change via FMOS promoter, the maize APETALA1 (ZmAP1) promoter was used to generate constructs to drive Cas12a activity, which were paired with multiple guide RNAs targeting the following regulatory sequences, which mediate transgenic expression, and the transgenic encoding 5-enolpyruvylshikimic acid-3-phosphate (EPSP) synthase (EPSPS), which confers resistance to the herbicide glyphosate. In this event, the regulatory sequences of the EPSPS gene include enhancers (eFMV) of the figwort mosaic virus (FMV) promoter, enhancers (e35S) of the cauliflower mosaic virus 35S promoter, maize ubi1 promoter (prZmUbi158) and the Ω5'UTR leader sequence (eTMV) of the tobacco mosaic virus. The purpose of this experiment is to determine whether a series of new EPSPS expression alleles can be generated using FMOS promoter editing of some enhancer or promoter sequences. We identified a total of eight guide RNAs, which are intended to be paired with nuclease Cas12a. The eight guide RNAs should be able to produce unique edits to the regulatory sequences of the EPSPS transgene: two for the eFMV enhancer, two for the e35S enhancer, three for the prUbil58 promoter, and one for the eTMV translation enhancer. In the construct, the expression of the guide RNAs is driven by the constitutive Ubi4 promoter from sugarcane, where each guide RNA is flanked by two self-cleaving ribozymes (hammerhead and HDV) for efficient processing. The vector also contains PMI as a selectable marker.

[1351] Construct 25068 (SEQ ID NO: 535) is a binary CRISPR construct that targets EPSPS events in a JHAX background to reduce the expression level of EPSPS trait genes. The expression of the endonuc...

Claims

1. A method for generating multiple unique edits in T1 seeds of a plant, the method comprising: include: a) transforming at least one expression cassette consisting of SEQ ID NO: 49 into a plant cell or plant tissue, wherein the at least one expression cassette comprises A nucleic acid encoding a DNA modification enzyme consisting of SEQ ID NO:4, Optionally, a nucleic acid encoding at least one guide RNA (gRNA), and Floral mosaic (FMOS) regulatory sequence, wherein the FMOS regulatory sequence (i) mediating the expression of the DNA modifying enzyme in at least one of flower primordium cells and flower reproductive organs, and (ii) mediating a plurality of edits in said at least one of said floral primordium and said floral reproductive organ; as well as b) regenerating the plant cell or plant tissue into a TO plant having a plurality of T1 seeds, wherein the T1 seeds contain the plurality of unique edits, The FMOS regulatory sequence consists of SEQ ID NO:50 and SEQ ID NO:

51.

2. The method of claim 1, wherein the plurality of unique edits are selected from the group consisting of: a plurality of unique allele substitutions, a plurality of unique base insertions, and a plurality of unique base deletions.

3. The method of claim 1, wherein The DNA modifying enzyme is a Cas9 nuclease consisting of SEQ ID NO: 4, and The at least one expression cassette comprises a nucleic acid encoding a gRNA, wherein the nucleic acid encoding the gRNA is operably linked to a FMOS promoter or a second promoter.

4. The method of claim 3, wherein The unique edit is an allele replacement, and The at least one expression cassette further comprises donor DNA.

5. The method of claim 4, wherein the at least one expression cassette further comprises a replication promoter operably linked to the donor DNA to drive replication of the donor DNA.

6. The method of claim 4, wherein the at least one expression cassette further comprises at least one LIR.

7. The method of claim 1, further comprising growing the T1 seeds to produce a plurality of T1 plants, and measuring at least one phenotype in the plants of the T1 generation, and Plants of the T1 generation are selected based on measuring at least one phenotype, wherein the selected plants have the unique edit, and wherein the selected plants comprise the donor DNA.

8. The method of claim 7, further comprising sequencing the insertion site of the donor DNA in the selected plants of the T1 generation, sequencing the insertion site of the donor DNA in the non-selected plants of the T1 generation, and The insertion site sequence of the selected plant is aligned with the insertion site sequence of the non-selected plant.

9. The method of claim 1, wherein the FMOS regulatory sequence mediates expression in at least one of an inflorescence, a microspore mother cell, an anther, a stamen, a tapetum, a megaspore mother cell, a pistil, an ovary, a style, and a stigma.

10. The method of claim 1, wherein the FMOS regulatory sequence mediates The amount of the DNA modifying enzyme in the floral primordium and the floral reproductive organ is at least 2 times greater than that in the vegetative tissue: at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times 2 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times , at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, at least 100 times, at least 101 times, at least 102 times, at least 103 times, at least 104 times, at least 105 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times, and The amount of the DNA modifying enzyme in the floral primordium and the floral reproductive organ is at least 2 times greater than that in the seed: at least 3 times greater, at least 4 times greater, at least 5 times greater, at least 6 times greater, at least 7 times greater, at least 8 times greater, at least 9 times greater, at least 10 times greater, at least 11 times greater, at least 12 times greater, at least 13 times greater, at least 14 times greater, at least 15 times greater, at least 16 times greater, at least 17 times greater, at least 18 times greater, at least 19 times greater, at least 20 times greater, at least 21 times greater, at least 22 times greater, times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times , at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times, At least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times.

11. The method of claim 1 , wherein the plurality of unique edits comprises at least one of: at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95 unique edits.

12. The method of claim 1, wherein the at least one expression cassette does not comprise a translatable exon native to the FMOS regulatory sequence.

13. The method of claim 1, wherein the FMOS regulatory sequence (i) mediating the expression of the DNA modifying enzyme in both male and female floral reproductive organs, and (ii) Mediates multiple edits in both male and female floral reproductive organs.

14. The method of claim 13, wherein The expression of the DNA modification enzyme in the male floral reproductive organ is at least one of the following times more than that in the floral primordium and the floral reproductive organ: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, At least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times times, at least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times, and The expression of the DNA modification enzyme in the female floral reproductive organ is at least one of the following times more than that in the floral primordium and the floral reproductive organ: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times , at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times, At least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times.

15. at least one expression cassette consisting of SEQ ID NO: 49 for producing at least 15 unique edits in the T1 seeds of the plant, The expression cassette comprises: A nucleic acid encoding a DNA modification enzyme consisting of SEQ ID NO:4, Optionally, a nucleic acid encoding at least one guide RNA (gRNA), and Floral mosaic (FMOS) promoter, wherein the FMOS promoter (i) mediating the expression of the DNA modifying enzyme in at least one of flower primordium cells and flower reproductive organs, and (ii) mediating a plurality of edits in said at least one of said floral primordium and said floral reproductive organ, and (iii) Mediation In at least one of the floral primordium and the floral reproductive organ, the DNA modifying enzyme is expressed at least one of the following times more than in the vegetative tissue: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 47 times less, at least 48 times less, at least 49 times less, at least 50 times less, at least 51 times less, at least 52 times less, at least 53 times less, at least 54 times less, at least 55 times less, at least 56 times less, at least 57 times less, at least 58 times less, at least 59 times less, at least 60 times less, at least 61 times less, at least 62 times less, at least 63 times less, at least 64 times less, at least 65 times less, at least 66 times less, at least 67 times less, at least 68 times less, at least 69 times less, at least 70 times less, at least 71 times less, at least 72 times less, at least 73 times less, at least at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times, and In at least one of the floral primordium and the floral reproductive organ, at least one of the following multiples of the DNA modifying enzyme is expressed in at least one of the floral primordium and the floral reproductive organ as compared to in the seed: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times, at least 75 times, at least 76 times, at least 77 times at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, at least 100 times, at least 101 times, at least 102 times, at least 103 times, at least 104 times, at least 105 times, at least 106 times, at least at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times less, at least 110 times less, at least 111 times less, at least 112 times less, at least 113 times less, at least 114 times less, at least 115 times less, at least 116 times less, at least 117 times less, at least 118 times less, at least 119 times less, at least 120 times less, at least 121 times less, at least 122 times less, at least 123 times less, at least 124 times less, at least 125 times less, at least 126 times less, at least 127 times less, at least 128 times less, at least 129 times less, And wherein the FMOS promoter consists of SEQ ID NO:

50.

16. The expression cassette of claim 15, wherein The DNA modifying enzyme is a Cas9 nuclease consisting of SEQ ID NO: 4; The cassette comprises a nucleic acid encoding a gRNA, wherein the nucleic acid encoding the gRNA is operably linked to the FMOS promoter consisting of SEQ ID NO: 50 or a second promoter; The cassette further comprises a donor DNA and a replication promoter operably linked to the donor DNA to drive replication of the donor DNA; and The FMOS promoter mediates expression in at least one of an inflorescence, a microspore mother cell, anther, a stamen, a tapetum, a megaspore mother cell, a pistil, an ovary, a style, and a stigma.

17. The expression cassette of claim 15, wherein the expression cassette further comprises a FMOS terminator consisting of SEQ ID NO:51.

Images