Establishment, optimization and application of efficient betula platyphylla gene editing system
By screening and optimizing gene editing vectors, a high-efficiency gene editing system for Bai Birch has been established, which has solved the problem of numerous vectors and low editing efficiency in Bai Birch gene editing technology, and has achieved efficient editing of Bai Birch genes and creation of new germplasms.
Patent Information
- Application Number
- CN202411745114.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-02
- Publication Date
- 2025-06-06
AI Technical Summary
The birch gene editing technology has problems such as a wide variety of vectors, unclear applicable vectors, low editing efficiency and complex operation, making it difficult to efficiently create gene editing plants.
By screening and optimizing gene editing vectors, selecting appropriate culture conditions, and establishing a highly efficient gene editing system in Baihua. The specific steps include target selection, gRNA design, gene editing vector construction, genetic transformation and editing efficiency statistics.
The efficient editing of the BpPDS and BpHAT4 of the Birch genes has been achieved, which improves the gene editing efficiency, simplifies the operation process, and provides a powerful tool for the Birch gene function research and the creation of new germplasms.
Smart Images

Figure CN120099072A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to the establishment, optimization and application of an efficient gene editing system for birch. Background Art
[0002] The CRISPR / Cas system has promoted the rapid development of gene editing technology. The system is derived from a natural immune system of prokaryotes and consists of two parts: clustered regularly interspaced short palindromic repeats (CRISPR) and related proteins (Cas genes). Cas genes play an important role in the CRISPR / Cas system. Currently, a variety of Cas proteins have been discovered, such as Cas1-10, Cas12a, and Cas13a. Among them, the most widely used is the CRISPR / Cas9 system, which recognizes the target gene through artificially designed gRNA and cuts the DNA fragment through the Cas9 protein, resulting in double-strand breaks. Errors occur during the repair process after DNA damage, resulting in gene knockout or insertion, thereby modifying the target gene.
[0003] White birch (Betula platyphylla Suk.) is widely distributed in Northeast China and is a pioneer tree species for afforestation. Compared with crops or herbaceous plants, the breeding cycle of woody birch is long and the efficiency of genetic improvement is low. The application of molecular breeding technology can shorten the breeding cycle and improve the target traits in a targeted manner. The gene editing system can accurately edit the target gene and achieve targeted transformation. It is a powerful tool for gene function research and new germplasm creation.
[0004] In recent years, the CRISPR / Cas9 system has been modified by different researchers and assembled into various gene editing vectors, and has been widely used in model plants such as Arabidopsis, tomato, and wheat. It has been successfully applied in woody plants such as poplar, kumquat, walnut, and apple. Some researchers have also created gene-edited plants in birch using the gene editing system. However, the current gene editing of birch still has problems such as a large number of optional vectors, unclear applicable vectors, low editing efficiency, and complex operation.
[0005] Previous studies have shown that four intermittent heat treatments of Arabidopsis during the vegetative stage increased the mutation efficiency of the SpCas9-targeted green fluorescent protein (GFP) gene. Subsequently, researchers found that a single 24h heat treatment was sufficient to significantly increase the efficiency of CRISPR / Cas9-mediated mutations in Arabidopsis. Other studies have shown that when cells are edited using the CRISPR-Cas12f1 system, cells that recover in low temperatures have higher editing efficiency. These evidences indicate that external conditions have a great influence on the gene editing process in organisms. However, the effects of exogenous conditions on the gene editing efficiency of birch have not been reported.
[0006] Therefore, screening out applicable and efficient gene editing vectors, selecting appropriate culture conditions, applying them to birch gene editing, and conveniently and efficiently producing gene-edited birch plants have become technical challenges that urgently need to be solved in this technical field. Summary of the invention
[0007] The purpose of the present invention is to provide the establishment, optimization and application of an efficient gene editing system for birch, screen out an efficient gene editing system, optimize the culture conditions, and effectively achieve the effective editing of birch genes BpPDS and BpHAT4, providing a powerful tool for studying the gene function of birch and creating new germplasm.
[0008] In order to achieve the above object, the present invention adopts the following technical solutions:
[0009] The establishment, optimization and application of the efficient gene editing system of birch are as follows:
[0010] Step (1): Selection of BpPDS targets
[0011] Based on the genome information of Betula platyphylla, BpPDS was screened and identified, and the target was screened by CRISPR-P 2.0. According to the score and the location of the target, three targets were selected: BpPDS1, BpPDS2 and BpPDS3;
[0012] Step (2): Design of BpPDS gRNA
[0013] According to the genetic transformation of woody plants and the editing characteristics of different vectors, the single-target gene editing system AtU6, pEgP237 and the dual-target gene editing system pHSE401 were selected for research. The sgRNA was designed according to the instructions of the three gene editing vectors; for AtU6 and pEgP237, both have BsaⅠ restriction sites, and the designed primer sequences are as follows:
[0014] sgRNA-F:5'-GATTNNNNNNNNNNNNNNNNNNNN-3';
[0015] sgRNA-R:3'-NNNNNNNNNNNNNNNNNNNNCAAA-5';
[0016] For the pHSE401 dual-target gene editing vector, the primer sequence structure was designed as follows: DT1-BsF:ATATATGGTCTCGATTGNNNNNNNNNNNNNNNNNNNGTT
[0017] DT1-F0:TGNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC
[0018] DT2-R0:AACNNNNNNNNNNNNNNNNNCAATCTCTTAGTCGACTCTAC DT2-BsR:ATTATTGGTCTCGAAACNNNNNNNNNNNNNNNNNNNCAA
[0019] A 19-nt target sequence was substituted for the 19-nt N in primer F0 / BsF; another 19-nt target sequence was substituted for the 19-nt N in R0 / BsR.
[0020] Step (3): Construction of different gene editing vectors
[0021] For the single-target gene editing vectors AtU6 and pEgP237, three sgRNA gene editing vectors were constructed respectively; and for the dual-target gene editing vectors, the three targets were combined to construct pHSE401-BpPDS1-BpPDS2, pHSE401-BpPDS1-BpPDS3, and pHSE401-BpPDS2-BpPDS3 gene editing vectors;
[0022] Step (4): Genetic transformation of Betula platyphylla
[0023] Each editing vector constructed in step (3) was transferred into Agrobacterium GV3101 by electroporation, and the vector was transferred into birch by Agrobacterium-mediated genetic transformation technology. The transformation steps are as follows: the mature birch seeds used for genetic transformation were collected from the superior birch trees selected in the early stage. The cut birch zygotic embryos were immersed in OD 600 =0.5 of Agrobacterium containing a gene editing vector, and the infected zygotic embryos were placed in a co-culture medium [Woody Plant Medium (WPM) medium containing 2 mg / L 6-benzylaminopurine (6BA) and 0.1 mg / L 1-naphthaleneacetic acid (NAA)] for dark culture for 2-3 days, during which the medium was changed; after the co-culture, the zygotic embryos were transferred to a screening medium [WPM medium containing 50 mg / L Hygromycin B (HYG) or Kanamycin (Kan), 200 mg / L Cefotaxim (Cef), 2 mg / L 6BA and 0.1 mg / L NAA], and resistant calli were induced after 20-30 days, and the resistant callus was transferred to an adventitious bud induction medium containing [50 mg / L HYG or Kan, 200 mg / L Cef, 0.8 mg / L 6BA, 0.5 mg / L gibberellin (GA 3) and 0.02 mg / L NAA WPM medium], and after adventitious buds grow out, the adventitious buds are transferred to rooting screening medium (WPM medium containing 0.2 mg / L NAA, 100 mg / L Cef, 20 mg / L HYG or Kan).
[0024] Step (5): Obtaining and counting transgenic plants
[0025] After obtaining transgenic callus through Agrobacterium-mediated zygotic embryo transformation, the plant color was observed, the editing efficiency was statistically analyzed, and the optimal birch gene editing vector was screened.
[0026] Step (6): Optimization of the gene editing system
[0027] The non-edited plants with pHSE401-BpPDS1-BpPDS3 genes were used as materials (with antibiotic resistance but no change in leaf color). After being exposed to different temperatures (4°C and 37°C), drought (200 mM mannitol), and different dark treatment times (12, 24, 36 h), they were redifferentiated and the editing efficiency of the redifferentiated plants was statistically analyzed.
[0028] Step (7): Application of optimal gene editing vector
[0029] 1) Selection of BpHAT4 targets
[0030] 2) Construct the pHSE401-BpHAT4 gene editing vector and perform genetic transformation according to steps (1) to (4).
[0031] 3) Identification of mutation sites in transgenic plants
[0032] When the resistant plants grow to 4-6 cm in the rooting medium, extract the plant DNA, design primers at both ends of the two target sites, use genomic DNA as a template, PCR amplify the target fragment, obtain the fragment information through sequencing technology, compare the obtained sequence information with the wild type, and determine the editing site situation.
[0033] 4) Evaluation of drought resistance of mutants
[0034] After the identified mutants grew 4-6 cm in the rooting medium, they were transferred to the soil. After 2 months of greenhouse culture, the growth status of the mutants and wild-type birch was compared, and no significant difference was found. The wild type and mutants were treated with potted water control, and the plant phenotypes were observed after 5 days and 10 days. The relevant physiological indicators were measured after 5 days of treatment to evaluate the drought resistance of the mutants.
[0035] Beneficial effects:
[0036] The establishment, optimization and application of the birch efficient gene editing system of the present invention evaluate the editing efficiency of different gene editing vectors in birch through a stable transformation system, and finally screen out the optimal gene editing vector; then, optimize the culture conditions of the gene editing system; and apply the birch efficient gene editing vector to obtain BpHAT4 gene-edited plants; and further evaluate their drought resistance. This method provides an efficient gene editing system for birch gene function research and gene editing germplasm creation. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] In order to more clearly illustrate the embodiments of the present invention, the present invention will be briefly introduced below in conjunction with the accompanying drawings, but this does not constitute a limitation to the present invention.
[0038] Figure 1 It is a schematic diagram of the BpPDS gene sequence target;
[0039] Figure 2 The following are maps of three gene editing vectors; A is a schematic diagram of the AtU6 vector, B is a schematic diagram of the pEgP237 vector, and C is a schematic diagram of the pHSE401 vector;
[0040] Figure 3 The phenotype of gene-edited plants of birch, A is a transgenic plant with green leaves, and B is a gene-edited plant with an albino phenotype;
[0041] Figure 4 The re-editing efficiency of plants after different treatments; AD is the re-editing efficiency of plants after 4℃ (A), 37℃ (B), drought (C) and dark treatment (D);
[0042] Figure 5 Schematic diagram of BpHAT4 gene sequence and target distribution;
[0043] Figure 6 For BpHAT4 target sequence mutation analysis;
[0044] Figure 7 This is the analysis of drought resistance of BpHAT4. A is the phenotype of BpHAT4 gene-edited plants. B is the water loss rate of wild type and mutant leaves. C is the relative water content of wild type and mutant. D is the relative conductivity of wild type and mutant. The differences that reach a significant level are marked with “ * " indicates (P<0.05); " indicates extremely significant difference ** ” indicates (P<0.01); DETAILED DESCRIPTION
[0045] The present invention will be further described in detail below in conjunction with specific embodiments. The objects, advantages and features of the present invention will become clearer as the description proceeds. The detailed description is only used to illustrate and explain the present invention and should not be considered as a limitation of the present invention.
[0046] Example 1
[0047] The establishment, optimization and application of the birch efficient gene editing system of this embodiment are carried out according to the following steps:
[0048] Step (1): Selection of BpPDS targets
[0049] According to the genome information of Betula platyphylla, the BpPDS gene was screened and identified, and the target was screened by CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The targets with higher scores and relatively close to the front end of the gene were selected for design. Three targets were selected: BpPDS1, BpPDS2 and BpPDS3. The sequence information of BpPDS1, BpPDS2 and BpPDS3 is shown in Table 1, and their distribution is shown in Table 1. Figure 1 As shown;
[0050] Table 1 BpPDS gene sgRNA target sequences
[0051]
[0052] Step (2): Design of gRNA for BpPDS gene
[0053] Schematic diagram of the three gene editing vectors AtU6, pEgP237 and pHSE401 is shown in Figure 2 As shown, sgRNA was designed according to the instructions; for AtU6 and pEgP237 single-target gene editing vectors, both of them have BsaⅠ restriction sites, and the designed primer sequences are shown in Table 2.
[0054] Table 2 sgRNA target primers for single-target gene editing vectors
[0055]
[0056] For the pHSE401 dual-target gene editing vector, the primer structure was designed as follows: DT1-BsF: ATATATGGTCTCGATTGNNNNNNNNNNNNNNNNNNNGTT;
[0057] DT1-F0:TGNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC;
[0058] DT2-R0:AACNNNNNNNNNNNNNNNNNNNCAATCTCTTAGTCGACTCTAC; DT2-BsR:ATTATTGGTCTCGAAACNNNNNNNNNNNNNNNNNCAA;
[0059] When designing primers, a 19-nt target sequence replaces the 19-nt N in primer F0 / BsF; another 19-nt target inverted complementary sequence replaces the 19-nt N in R0 / BsR. The designed primer sequences are shown in Table 3.
[0060] Table 3 sgRNA primer sequences of pHSE401 dual-target gene editing vector
[0061]
[0062] Step (3): Construction of different gene editing vectors
[0063] 1) For the single-target gene editing vectors AtU6 and pEgP237, the construction methods are basically the same, and the steps are as follows:
[0064] ① Linearize the gene editing vector using BsaⅠ endonuclease. The system is as follows:
[0065] Table 4 BsaⅠ digestion system
[0066]
[0067] The enzyme digestion was carried out at 37°C for 2 h, and the target band was recovered and purified according to the instructions of the gel recovery kit (Omega).
[0068] ② The primers in Table 2 were annealed, and the reaction system was as follows:
[0069] Table 5 sgRNA renaturation system
[0070]
[0071] After mixing, put it into the PCR instrument and renature it according to the following program: 95℃30s; 72℃2min; 37℃2min; 25℃2min.
[0072] ③ The renatured product and the purified enzyme digestion product were subjected to T 4 Connection, the system is as follows:
[0073] Table 6T 4 Connection system
[0074]
[0075] Ligation was performed overnight at 16°C.
[0076] ④ Take 5 μL of the ligation product and transform E. coli. The steps are as follows:
[0077] a) Take out the competent E. coli from the -80℃ freezer, immediately place on ice to thaw, add the reaction solution to the competent cells with a pipette, and place on ice for 30 minutes;
[0078] b) Heat shock in 42°C water bath for 90 seconds, quickly transfer to ice and keep in ice bath for 5 minutes;
[0079] c) Add 600 μL LB liquid medium and culture at 37°C, 200 rpm for 1 h;
[0080] d) Centrifuge at 3000 rpm for 3 min, discard the supernatant, add 200 μL LB to resuspend the bacteria, add to the LB resistance plate containing 50 mg / L Kan, spread the bacterial solution evenly with a spreading stick, dry it, and culture it upside down at 37°C overnight.
[0081] ⑤PCR identification of positive clones
[0082] Randomly select six positive monoclones in a 1.5 ml centrifuge tube, add 600 μL of LB liquid culture medium containing 50 mg / L Kan, and culture in a 37°C constant temperature shaker. After 4 hours, take 10 μL of bacterial solution for denaturation as a PCR detection template. The detection primers are M13-F: GTAAAACGACGGCCAGT, and BpPDS1 / 2 / 3-sgRNA-R. The reaction system is shown in Table 7:
[0083] Table 7 Bacterial liquid detection PCR system
[0084]
[0085] The reaction procedure is as follows:
[0086]
[0087] The positive clones were saved and sequenced, and the recombinant plasmids with correct sequencing results were extracted according to the instructions of the plasmid extraction kit (Omega).
[0088] ⑥Transform the recombinant plasmid into Agrobacterium GV3101, the steps are as follows:
[0089] a) Take out the Agrobacterium GV3101 competent cells from -80°C, thaw them on ice, add 2 μL of plasmid and mix well;
[0090] b) Transfer to a pre-cooled electric shock cup;
[0091] c) Adjust the voltage of the electroporator to 1.8KV, insert the electroporator cup into the injection groove, push the electroporator, and press start. Wait for a few seconds, and you will hear a beep, indicating that the electroporation is over. Quickly remove the electroporator cup and transfer the competent cells to a 1.5mL centrifuge tube with 600μL LB medium. Incubate at 28℃, 200rpm, and shake for 3h.
[0092] d) 150 μL of bacterial solution was spread on LB solid selective medium containing final concentrations of 50 mg / L Kan and 75 mg / L rifampicin (Rif), and cultured inverted at 28°C for 48 h;
[0093] e) PCR identification of positive clones, the method is the same as ⑤.
[0094] Pick the positive monoclonal bacterial solution and shake culture it in liquid culture medium, preserve the strain, and place it in a -80℃ refrigerator for future use.
[0095] 2) For the dual-target gene editing vector, the three targets were combined respectively to construct pHSE401-BpPDS1-BpPDS2, pHSE401-BpPDS1-BpPDS3 and pHSE401-BpPDS2-BpPDS3 gene editing vectors, and the steps are as follows:
[0096] ①PCR amplification
[0097] Four-primer PCR amplification was performed using the primers in Table 3 with pCBC-DT1T2 diluted 100 times as the template. -BsF / -BsR are normal primer concentrations; -F0 / -R0 are diluted 20 times.
[0098] Purify and recover the PCR product, and establish the following restriction enzyme digestion-ligation system:
[0099] Table 8 Enzyme Digestion-Ligation System
[0100]
[0101] ②Transform E. coli according to step 1)
[0102] ③PCR identification of positive clones
[0103] PCR detection was performed using primers U626-IDF: TGTCCCAGGATTAGAATGATTAGGC and U629-IDR: AGCCCTCTTCTTTCGATCCATCAAC. The reaction system is shown in Table 7.
[0104] ④Transform the pHSE401-2×sgRNA plasmid into Agrobacterium by electroporation
[0105] The correctly sequenced pHSE401-2×sgRNA plasmid was transformed into GV3101 Agrobacterium competent cells, following the same steps as ⑥ in 1).
[0106] Step (4): Genetic transformation of Betula platyphylla
[0107] The successfully constructed gene editing vector was transferred into birch through Agrobacterium-mediated stable transformation technology. The transformation steps are as follows:
[0108] ①Inoculate the Agrobacterium strains that contain the correct gene editing vector into LB containing a final concentration of 50 mg / L Kan and 50 mg / L R. R. If, culture at 28°C and 200 rpm for 24-36 hours, re-inoculate into liquid LB at a ratio of 1:50, and culture at 28°C and 200 rpm until OD 600 =0.5, which means the engineering bacteria to be used;
[0109] ②Disinfection of mature birch seeds: Mature birch seeds were collected from the birch seed garden of Northeast Forestry University. They were rinsed with running water for 2-3 days. When the seeds were about to show buds, they were soaked in 75% alcohol for 1 minute, rinsed with sterile water 2-3 times, soaked in 30% hydrogen peroxide for 15 minutes, and rinsed with sterile water 3-4 times.
[0110] ③ Soak the cut birch zygotic embryos in OD 600 =0.5 in the engineering bacterial solution for 3-5 minutes;
[0111] ④ Place the infected zygotic embryos in WPM medium containing 2 mg / L 6BA and 0.1 mg / L NAA and culture them in the dark for 2 to 3 days, during which time the medium is replaced;
[0112] ⑤ After dark culture, place the cells in WPM medium containing 2 mg / L 6BA, 0.1 mg / L NAA, 200 mg / L Cef, 50 mg / L HYG or Kan for selection culture. After about 20 to 30 days, resistant callus will gradually grow;
[0113] ⑥Transfer the resistant callus to a medium containing 0.8 mg / L 6BA and 0.5 mg / L GA 3 , 0.02 mg / L NAA, 200 mg / L Cef, 30 mg / L HYG or Kan's WPM differentiation medium and continue to culture until adventitious buds grow;
[0114] ⑦ Transfer the grown adventitious buds to WPM subculture medium containing 0.8 mg / L 6BA, 200 mg / L Cef, 50 mg / L HYG or Kan to promote the elongation of the adventitious buds; when the adventitious buds elongate to 3-5 cm, transfer them to MS rooting medium containing 0.2 mg / L NAA, 100 mg / L Cef, 20 mg / L HYG or Kan to induce rooting, and finally obtain the birch resistant to HYG or Kan strains for subsequent experiments.
[0115] Step (5): Obtaining and counting transgenic plants
[0116] Since the PDS gene is a key enzyme in the carotenoid biosynthesis pathway, when PDS expression is blocked, the plant loses the photoprotective effect of carotenoids, thus showing a whitening effect. Figure 3 As shown in the figure, the green callus is a transgenic off-target plant, while the mutant shows an albino phenotype. Therefore, the albino efficiency of the transgenic plant can be statistically analyzed by observing the plant phenotype.
[0117] The results showed that the editing efficiency of different sgRNA targets of the same gene editing vector had certain differences; however, the editing efficiency between different editing vectors showed greater differences. pHSE401 showed the highest gene editing efficiency of 23.8% to 46.2%, with an average editing efficiency of 31.5%, and the lowest was AtU6. All transgenic plants did not produce albino phenotypes (Table 9). Therefore, pHSE401 was determined to be the most efficient gene editing vector for birch among pHSE401, AtU6 and pEgP237 vectors.
[0118] Table 9 Statistics of knockout efficiency of different editing vectors in Birch
[0119]
[0120] Step (6): Effects of different culture conditions on gene editing efficiency
[0121] The plants transformed with the pHSE401-BpPDS1,3-sgRNA gene editing vector that did not show albino phenotype were transferred to rooting medium (MS+0.2mg / L NAA+10mg / L HYG) and placed in a greenhouse with a photoperiod of 16h / 8h (light / darkness). One and a half months later, off-target green tissue culture seedlings with consistent growth were selected and treated at 4℃ and 37℃ for 2, 4 and 6h; 200mM mannitol for 3, 6 and 12h; dark treatment for 12, 24 and 36h, and normal cultured plants were used as controls. The stem segments of each treatment and control plant were removed from the axillary buds, cut to 1-2cm, and spread flat on differentiation screening medium (containing 0.8mg / L 6BA, 0.5mg / LGA 3, WPM medium containing 0.02 mg / L NAA, 50 mg / L Cef, and 30 mg / L HYG), the medium was replaced every two weeks until adventitious buds grew, and the colors of the adventitious buds were observed and counted.
[0122] The results showed that under normal conditions, 16.57% of the calli were re-edited after redifferentiation of non-albino plants. Appropriate temperature treatment promoted the pHSE401 editing system. The re-editing efficiency was the highest (87.24%) after 4h treatment at 37℃, and decreased after 6h treatment (64.17%) (Fig 4A); after 2h treatment at 4℃, the re-editing efficiency was also improved (33.97%) (Fig 4B). However, 200mM mannitol and dark treatment had a negative effect on the pHSE401 editing system (Fig 4C, D).
[0123] Step (7): Application of optimal gene editing vector
[0124] In steps (1) to (5), pHSE401 was determined to be an efficient gene editing vector for birch. Therefore, the system was further verified by using the birch BpHAT4 gene.
[0125] 1) Selection of BpHAT4 targets
[0126] The target of BpHAT4 was screened by CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and two targets with higher scores (BpHAT4-1 and BpHAT4-2) were selected. The specific sequences are shown in Table 11, and their distribution diagram is shown in Figure 5 As shown;
[0127] Table 11BpHAT4 gene sgRNA target sequence
[0128]
[0129] 2) According to steps (1) to (4), the pHSE401-BpHAT4 gene editing vector was constructed and genetically transformed. According to step (5), the genetic transformation of Betula platyphylla was performed.
[0130] 3) Mutation identification of transgenic plants
[0131] ① When the resistant plants grow to 4-6 cm, use a plant DNA extraction kit (Biotech) to extract DNA.
[0132] ② Using the extracted mutant birch DNA as a template, design primers around 150-400 bp on both sides of the sgRNA (Table 12), using Taq DNA Polymerase enzyme was used to amplify the target gene fragment and detect the editing status.
[0133] ③ Place the PCR product on a 1% agarose gel for detection and use a gel recovery kit to recover and purify the band at the correct position.
[0134] ④ Connect the T vector, the reaction system is as follows: Solution 1 5μL; PMD18-T vector 1μL;
[0135] Insert 4 μL. Reaction conditions: 16°C overnight.
[0136] ⑤Transform E. coli. The specific steps are the same as 1.2(2).
[0137] ⑥Pick a single clone and sequence it using vector primer M13-F.
[0138] ⑦Compare the sequencing results to detect the editing status of the mutant. Figure 6 As shown, all five strains had mutations at the first target site. The hat4-1 strain deleted four bases, the hat4-2, hat4-4 and hat4-5 strains all deleted a T base, and the hat4-3 deleted a C.
[0139] Table 12BpHAT4 mutant sequence identification primers
[0140]
[0141] 3) Analysis of drought resistance of BpHAT4 mutants
[0142] In order to further illustrate the establishment and optimization of the efficient gene editing system for birch and its application in the study of birch gene function, the drought resistance of the BpHAT4 mutant was evaluated. The wild type and mutants (hat4-1 and hat4-2) of birch cultured for 2 months were subjected to potted drought treatment. Figure 7 As shown in A. Compared with the wild type, the mutant showed leaf wilt and droop after 5 days of drought, and the mutant leaves began to dry up and lose green after 10 days, and the terminal buds wilt and bend. In contrast, the wild type showed a better growth state than the mutant.
[0143] In order to further evaluate the drought resistance of the BpHAT4 mutant, the leaf water loss rate of the wild type and mutant, the relative water content and relative conductivity after 5 days of drought treatment were measured. The results showed that the leaf water loss rate of the mutant was higher than that of the wild type, and the relative water content of the mutant was significantly lower than that of the wild type after 5 days of drought treatment, while the relative conductivity was significantly higher than that of the wild type ( Figure 7 B, C, D).
[0144] Finally, it should be noted that the above embodiments are merely examples for clearly illustrating the invention, and are not intended to limit the specific implementation methods of the invention. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all implementation methods here. Any obvious changes or modifications derived from the spirit and principles of the invention are still within the scope of protection of the claims of the invention.
Claims
1. Establishment, optimization and application of an efficient gene editing system in Birch, characterized in that It is carried out according to the following steps: (1) Screening of sgRNA targets for target genes; (2) Construction of gene editing vectors; (3) Genetic transformation of birch using Agrobacterium-mediated stable transformation technology; (4) Count the BpPDS gene-edited plants and calculate the editing efficiency; (5) Treat non-edited transgenic calli with different temperature, drought, and light conditions, and calculate the re-editing efficiency after treatment; (6) Creation of BpHAT4 gene-edited plants and identification of their drought resistance.
2. The establishment, optimization and application of the efficient gene editing system of birch according to claim 1, characterized in that: In step (1), three targets were designed based on the BpPDS gene sequence: BpPDS1, BpPDS2 and BpPDS3; and two targets were designed based on the BpHAT4 gene sequence of Betula platyphylla, named BpHAT4-1 and BpHAT4-2.
3. The establishment, optimization and application of the efficient gene editing system of birch according to claims 1 and 2, characterized in that: In step (2), three gene editing vectors AtU6, pEgP237 and pHSE401 were constructed for the BpPDS gene; six vectors AtU6-BpPDS1, AtU6-BpPDS2, AtU6-BpPDS3, pEgP237-BpPDS1, pEgP237-BpPDS2 and pEgP237-BpPDS3 were constructed for the single-target gene editing vectors AtU6 and pEgP237, respectively, and pHSE401 was a dual-target gene editing vector, and three vectors pHSE401-BpPDS1-BpPDS2, pHSE401-BpPDS1-BpPDS3 and pHSE401-BpPDS2-BpPDS3 were constructed. The vector pHSE401 with the highest editing efficiency was constructed for the BpHAT4 gene.
4. The establishment, optimization and application of the efficient gene editing system of birch according to claim 1, characterized in that: In step (5), the temperature treatments were 37° C. and 4° C., the drought treatment was drought stress simulated by 200 mM mannitol, and the dark treatment was avoiding light for 12, 24, and 36 h.
5. The establishment, optimization and application of the efficient gene editing system of birch according to claim 1, characterized in that: In step (6), the BpHAT4 gene-edited plants need to be sequenced to identify the mutation type, and the wild type is used as a control to evaluate the drought resistance of the sequenced positive BpHAT4 mutants.
6. The establishment, optimization and application of the efficient gene editing system of birch according to claims 1-5, characterized in that The plant is birch.