Application of SlNOP2 protein and coding gene thereof in tomato breeding

By regulating the phenotypic traits of tomatoes by using SlNOP2 protein and gene editing technology, the problem of difficulty in improving tomato production and quality in existing breeding technologies has been solved, and significant yield and quality improvement has been achieved.

CN120099089AInactive Publication Date: 2025-06-06THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510592242.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-09
Publication Date
2025-06-06
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

Existing tomato breeding technology is difficult to effectively improve the yield, quality, disease resistance and stress resistance of tomatoes, while enhancing their nutritional value.

Method used

By regulating the phenotypic traits of plants, such as plant height, fruit number, fruit weight, root weight and seed size, high yield breeding of tomatoes is achieved. Specific methods include knockout, inhibition of SlNOP2 gene expression or increasing target traits by gene editing.

Benefits of technology

It significantly increases the plant height, fruit number, fruit weight and root weight of tomatoes, enhances the growth and stress resistance of plants, thereby improving the yield and quality of tomatoes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses an application of SlNOP2 protein and a coding gene thereof in tomato breeding. The invention provides an application of SlNOP2 protein in regulation and control of phenotypic characters of plants. The phenotypic characters are plant height and / or fruit quantity and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed perimeter and / or seed surface area. The invention also protects the application of the SlNOP2 protein or the SlNOP2 gene as an inhibition target in plant breeding. The target of the plant breeding is to cultivate plants with increased plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed perimeter and / or seed surface area. The invention provides a new thought and a potential target for tomato molecular breeding, can be used for cultivating high-yield new tomato germplasm, and has industrial popularization value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the application of SlNOP2 protein and its encoding gene in tomato breeding. Background Art

[0002] tomato( Solanum lycopersicum ) is an annual herbaceous plant of the Solanaceae family Solanum. Tomatoes are rich in carotene, vitamin C and B vitamins, and have high nutritional value. They can be used as both vegetables and fruits, and can be eaten raw or cooked. Tomatoes can be used to make tomato sauce, tomato juice and diced tomatoes. Tomatoes are rich in lycopene, which has strong antioxidant capacity, can lower blood pressure, clear away heat and detoxify, and can also be extracted as a health product.

[0003] Tomato breeding is extremely important in modern agriculture. It can not only improve the yield and quality of tomatoes, but also enhance their disease resistance, adaptability and nutritional value. One of the important goals of breeding is to increase yield, such as increasing the number of fruits per plant and increasing the weight of single fruit. Breeding related to other traits also has its value. For example, tomato breeding for the purpose of increasing plant height usually means that the leaves of the plant are more widely distributed and can capture more light energy. The enhanced photosynthesis efficiency helps promote plant growth and fruit development, thereby increasing yield. In addition, taller plants can improve field ventilation and lighting conditions and reduce the occurrence of diseases and pests. Increasing the weight of tomato roots is of great significance in tomato breeding and cultivation, because the root system is the main organ for plants to absorb water and nutrients, which directly affects the growth, yield and stress resistance of the plant. The increase in root weight usually means that the root system is more developed and can absorb more water and nutrients, thereby promoting plant growth and improving fruit yield and quality. A developed root system can penetrate deep into the soil, absorb deep water, and improve the drought resistance of the plant. The increase in root weight can enhance the anchoring ability of the plant and reduce the risk of lodging. A well-developed root system can more efficiently absorb nutrients from the soil and reduce fertilizer waste.

[0004] Tomato breeding plays an important role in increasing yield, improving quality, enhancing disease resistance and stress resistance, and increasing nutritional value. By combining traditional breeding with modern biotechnology, we can cultivate tomato varieties that are more suitable for future agricultural needs and contribute to global food security and sustainable agricultural development. Summary of the invention

[0005] The purpose of the present invention is to provide the application of S1NOP2 protein and its encoding gene in tomato breeding.

[0006] The present invention provides the use of SlNOP2 protein in regulating the phenotypic traits of plants; the phenotypic traits are plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area.

[0007] The meaning of regulating the phenotypic traits of the plant is that the reduction of SlNOP2 protein increases the plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area of ​​the plant.

[0008] The present invention also provides SlNOP2 The application of genes in regulating the phenotypic traits of plants; the phenotypic traits are plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area.

[0009] The meaning of regulating the phenotypic traits of the plant is: knocking out SlNOP2 The gene increases the plant height and / or the number of fruits and / or the weight of fruits and / or the weight of root system and / or the length of seeds and / or the width of seeds and / or the circumference of seeds and / or the surface area of ​​seeds.

[0010] The meaning of regulating the phenotypic traits of the plant is: inhibiting SlNOP2 Gene expression increases the plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area of ​​the plant.

[0011] The meaning of regulating the phenotypic traits of the plant is: SlNOP2 Genes are targeted for gene editing to increase plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area.

[0012] The present invention also protects S1NOP2 protein or SlNOP2 The invention relates to the use of genes as suppression targets in plant breeding; the goal of the plant breeding is to cultivate plants with increased plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area.

[0013] The present invention also protects against SlNOP2 The invention relates to a method for producing a plant having an increased plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area. SlNOP2Genes can be specifically inhibited SlNOP2 Gene expression. Inhibition SlNOP2 The gene expression substance can be specifically: SlNOP2 A gene editing vector with a gene as a target. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located at SlNOP2 Specifically, the target of the sgRNA is shown in SEQ ID NO: 5.

[0014] The present invention also protects a method for plant breeding for the purpose of increasing plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed perimeter and / or seed surface area, comprising the following steps: inhibiting SlNOP2 The expression of the gene increases the plant height and / or the number of fruits and / or the weight of fruits and / or the weight of the root system and / or the length of seeds and / or the width of seeds and / or the circumference of seeds and / or the surface area of ​​seeds. SlNOP2 The expression of the gene is achieved by gene editing. The target of the gene editing is located at SlNOP2 In the gene. Specifically, the gene editing is based on Cas9, and the target of the sgRNA is shown in SEQ ID NO: 5. The gene editing is achieved by introducing a gene editing vector. SlNOP2 Gene expression is suppressed by introducing SlNOP2 Substances that inhibit gene expression. SlNOP2 The gene expression substance can be specifically: SlNOP2 A gene editing vector with a gene as a target. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located at SlNOP2 Specifically, the target of the sgRNA is shown in SEQ ID NO: 5.

[0015] The present invention also protects a method for plant breeding for the purpose of increasing plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed perimeter and / or seed surface area, comprising the following steps: SlNOP2 Gene editing is performed to obtain gene-edited plants, and plants with increased plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area relative to the recipient plant are screened from the gene-edited plants. The gene editing is achieved by introducing a gene editing vector. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located at SlNOP2 Specifically, the target of the sgRNA is shown in SEQ ID NO: 5.

[0016] The present invention also protects a plant breeding method for the purpose of increasing plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area, comprising the following steps: increasing the abundance of SlNOP2 protein in a recipient plant, thereby increasing the plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area of ​​the plant.

[0017] The present invention also protects a method for preparing a plant with increased plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed perimeter and / or seed surface area, comprising the following steps: replacing the DNA molecule shown in SEQ ID NO: 6 or SEQ ID NO: 7 in the genomic DNA of the recipient plant with the DNA molecule shown in SEQ ID NO: SlNOP2 The DNA molecule shown in SEQ ID NO: 5 in the gene is used to obtain a plant with increased plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed perimeter and / or seed surface area. Specifically, the replacement is a homozygous replacement, that is, the replacement occurs on both homologous chromosomes.

[0018] The SlNOP2 protein is as follows (a1) or (a2) or (a3) ​​or (a4): (a1) the protein shown in SEQ ID NO: 1; (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) a protein related to a plant phenotypic trait obtained by substituting and / or deleting and / or adding one or more amino acid residues in (a1); (a4) A protein derived from tomato that has more than 98% identity with (a1) and is associated with a phenotypic trait of the plant.

[0019] Exemplarily, the tag may be a Poly-Arg tag, a Poly-His tag, a FLAG tag, a Strep-tag II tag, a c-myc tag, or the like.

[0020] Said SlNOP2 The gene is a gene encoding S1NOP2 protein.

[0021] Specifically, SlNOP2 The gene is as follows (b1) or (b2) or (b3) or (b4) or (b5): (b1) a DNA molecule having a coding region as shown in SEQ ID NO: 2; (b2) the DNA molecule shown at positions 187 to 5505 in SEQ ID NO: 3; (b3) a DNA molecule represented by SEQ ID NO: 3; (b4) a DNA molecule derived from tomato and having more than 95% identity with (b1) or (b2) or (b3) and encoding the protein; (b5) A DNA molecule that hybridizes to the nucleotide sequence defined in (b1) or (b2) or (b3) under stringent conditions and encodes the protein.

[0022] The stringent conditions may be using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65° C. and washing the membrane in a DNA or RNA hybridization experiment.

[0023] Specifically, the gene editing vector is a recombinant plasmid BGK012. Positions 1 to 10000 of the recombinant plasmid BGK012 are shown in SEQ ID NO: 4, and positions 10001 to 16423 are shown in GenBank: OQ615330.1 (21-AUG-2024) at positions 1841 to 8263.

[0024] Any of the above plants is SlNOP2 A plant having a gene. Any of the above plants is a monocot or a dicot. Any of the above plants is a plant of the Solanaceae family. Any of the above plants is a plant of the genus Solanum. Any of the above plants is a plant of the genus Tomato. Any of the above plants is an Ailsa Craig tomato.

[0025] The present invention provides new ideas and potential targets for tomato molecular breeding, can be used to cultivate new high-yield tomato germplasm, and has industrial promotion value. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 are exemplary photos of plants.

[0027] Figure 2 An exemplary photograph showing the number of fruits on a plant.

[0028] Figure 3 An exemplary photograph of the plant's root system.

[0029] Figure 4 These are the statistical results of plant height, number of fruits per plant, fresh weight of each fruit and fresh weight of roots.

[0030] Figure 5 is an exemplary photo of seeds.

[0031] Figure 6 These are the statistical results of the length, width, circumference and surface area of ​​the seeds.

[0032] Figure 7 RNA m 5 Detection results of C modification level. DETAILED DESCRIPTION

[0033] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0034] The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. Unless otherwise specified, the quantitative tests in the following examples are set up with three repeated experiments, and the results are averaged. In the examples, **P<0.01, ***P<0.001, ****P<0.0001; the P value is from one-way analysis of variance (as well as non-parametric or mixed methods). The wild-type plant refers to the AC tomato plant. AC tomato, the full name of Ailsa Craig tomato, is a tomato germplasm in the prior art. It has been verified by sequencing that the Ailsa Craig tomato genomic DNA has a DNA molecule shown in SEQ ID NO: 3, encoding the protein shown in SEQ ID NO: 1.

[0035] Example 1. Construction of recombinant plasmid BGK012 The recombinant plasmid BGK012 is a circular plasmid (16423 bp) formed by a double-stranded DNA molecule, and positions 1-10000 are shown in SEQ ID NO: 4, and positions 10001-16423 are shown in GenBank: OQ615330.1 (21-AUG-2024) positions 1841-8263. In SEQ ID NO: 4, nucleotides 1044-1139 encode sgRNA (the target sequence corresponds to positions 119-138 in SEQ ID NO: 2 or positions 305-324 in SEQ ID NO: 3), nucleotides 3222-7493 encode Cas9 protein, and nucleotides 8849-9874 encode hygromycin resistance protein.

[0036] 2. Preparation of mutant plants 1. The recombinant plasmid BGK012 was introduced into the competent cells of Agrobacterium tumefaciens EHA105 by electroporation to obtain recombinant Agrobacterium.

[0037] 2. After AC tomato seeds germinate, take the cotyledons and hypocotyls as explants.

[0038] 3. Introduce the recombinant Agrobacterium obtained in step 1 into the explant obtained in step 2 by Agrobacterium infection method, and cultivate the rooted regenerated plant, namely T 0 Generation of plants.

[0039] 4. T obtained from step 3 0 Screening of transgenic plants from the first generation of plants.

[0040] Screening method: Take plant leaves and extract genomic DNA; use the genomic DNA as a template and use the primer pair consisting of HYG-F1 and HYG-R1 for PCR amplification. If an amplified product (about 519 bp) is obtained, the plant is a transgenic plant.

[0041] 5. T selected in step 4 0 The first generation of transgenic plants were self-pollinated and seeds were harvested, and then the seeds were cultivated into plants, namely T 1 Generation of plants.

[0042] 6. T obtained from step 5 1 Screen transgenic plants from the next generation of plants (the screening method is the same as that in step 4).

[0043] 7. T selected in step 6 1 The first generation of transgenic plants were self-pollinated and seeds were harvested, and then the seeds were cultivated into plants, namely T 2 Generation of plants.

[0044] 8. T obtained from step 7 2 Screen target plants from the next generation of plants.

[0045] Screening method: Take plant leaves and extract genomic DNA; use the genomic DNA as a template and use the primer pair consisting of HYG-F1 and HYG-R1 to perform PCR amplification to screen plants without amplification products (about 519bp).

[0046] 9. T selected from step 8 2 Screen homozygous gene-edited plants from the first generation of target plants.

[0047] Screening method: Take plant leaves and extract genomic DNA; use genomic DNA as a template and use the primer pair consisting of Sl-F1 and Sl-R1 for PCR amplification, recover the amplified product and sequence it. If the amplified product has only one sequencing result and it is different from the reference sequence, the plant is a homozygous gene-edited plant. Reference sequence: The nucleotide sequence of the amplified product amplified by PCR amplification using the genomic DNA of wild-type plant leaves as a template and the primer pair consisting of Sl-F1 and Sl-R1.

[0048] After the above steps, from T 2 Two homozygous gene-edited plants were obtained from the first generation of plants, named Sl-KO1 and Sl-KO2.

[0049] Compared with the wild-type plant genome SlNOP2 Compared with the genes in the genome of Sl-KO1 plants, SlNOP2 The gene underwent the following mutation: GTGATAGTGAAGGAACGGATGGG (SEQ ID NO: 5) mutated to GTGATAGGGATGGG (SEQ ID NO: 6), and the mutation form was homozygous (i.e., a pair of homologous chromosomes underwent the same mutation), and no other parts underwent mutation.

[0050] Compared with the wild-type plant genome SlNOP2 Compared with the genes in the genome of Sl-KO2 plants, SlNOP2 The gene underwent the following mutation: GTGATAGTGAAGGAACGGATGGG (SEQ ID NO: 5) mutated to GTGATAGTGAAGGAACGATGGG (SEQ ID NO: 7), and the mutation form was homozygous (i.e., a pair of homologous chromosomes underwent the same mutation), and no other parts underwent mutation.

[0051] 3. Phenotypic identification The tested seeds were: seeds obtained from self-pollination of Sl-KO1 plants, seeds obtained from self-pollination of Sl-KO2 plants, and seeds of wild-type plants.

[0052] The experiment was conducted in a greenhouse in Beijing.

[0053] On December 03, 2023, the test seeds were sown in plug trays and cultivated and managed normally, and the seeds germinated into seedlings.

[0054] On January 25, 2024, the seedlings were transplanted into pots, one plant per pot, and cultivated and managed normally.

[0055] On April 1, 2024, the first harvest was carried out. All ripe fruits on each plant were picked (ripe fruits are red fruits, the same below) and placed in the refrigerator.

[0056] On April 15, 2024, the second harvest was carried out to pick all the fruits on each plant.

[0057] Five plants grown from seeds obtained from self-pollination of Sl-KO1 plants (referred to as Sl-KO1 offspring plants, indicated by Sl-KO1) were counted. Five plants grown from seeds obtained from self-pollination of Sl-KO2 plants (referred to as Sl-KO2 offspring plants, indicated by Sl-KO2) were counted. Five plants grown from seeds of wild-type plants (referred to as Sl-CK plants, indicated by Sl-CK) were counted.

[0058] On March 25, 2024, exemplary photos of the plants are available at Figure 1 (Scale bar, 20 cm). The fruits from the first and second harvests of each plant were combined. See the illustrative photos for details. Figure 2 (Scale bar, 3 cm). After the second harvest, the root system of the plant was photographed. See the sample photos for details. Figure 3 (Scale bar, 3 cm). After the second harvest, the plant height was measured and the average value of the five plants was calculated. The results are shown in Figure 4 . Count the total number of fruits obtained from each plant (the number of fruits picked for the first time + the number of fruits picked for the second time), and then calculate the average value of the five plants, which is the number of fruits per plant. The results are shown in Figure 4 All fruits of the five plants were mixed, and 8 fruits were randomly sampled from the ripe fruits. The fresh weight of the fruits was weighed and the average value was taken, which was the fresh weight of each fruit. The results are shown in Figure 4 After the second harvest, the fresh weight of the roots of the plants was measured and the average value of the five plants was calculated as the fresh weight of the roots of the single plant. Figure 4 The results showed that compared with Sl-CK plants, the plant height, fruit number, fruit weight and root weight of Sl-KO1 and Sl-KO2 offspring plants increased significantly.

[0059] All the ripe fruits of five plants were mixed, and the seeds (also called kernels) were collected, and 20-30 seeds were randomly sampled. Figure 5 (Scale bar, 1 mm). The length of the seeds was measured and the average value was calculated. The width of the seeds was measured and the average value was calculated. The circumference of the seeds was measured and the average value was calculated. The surface area of ​​the seeds was measured and the average value was calculated. The results are shown in Figure 6 . Figure 6 In the figure, GL represents the length of the seed, GW represents the width of the seed, GP represents the circumference of the seed, and GA represents the surface area of ​​the seed. The results showed that compared with the Sl-CK plant, the seeds of the Sl-KO1 and Sl-KO2 offspring plants had a phenotype of significantly increased length, significantly increased width, significantly increased circumference, and significantly increased surface area.

[0060] 4. RNA m 5 C modification level The test seeds were: seeds obtained by self-pollination of Sl-KO1 plants, seeds obtained by self-pollination of Sl-KO2 plants, and seeds of wild-type plants. The test seeds were germinated and cultured in a greenhouse until the flowering stage, and the latest germinated leaves were taken to extract total RNA.

[0061] Three plants were counted from the seeds obtained from self-pollination of Sl-KO1 plants (referred to as Sl-KO1 offspring plants, indicated by Sl-KO1). Three plants were counted from the seeds obtained from self-pollination of Sl-KO2 plants (referred to as Sl-KO2 offspring plants, indicated by Sl-KO2). Three plants were counted from the seeds of wild-type plants (referred to as Sl-CK plants, indicated by Sl-CK).

[0062] Total RNA was collected and RNA Dot-blot was performed. The specific antibody used was anti-m 5 C antibody (Diagenode, C15200081), which can specifically recognize m 5 C modification site. The RNA amount was set to 1000 ng and then diluted to 500 ng. Figure 7 The results show that RNA samples of different doses can be recognized by specific antibodies, and the signal intensity is positively correlated with the RNA amount.

[0063] Total RNA was collected and detected by ultra-high performance liquid chromatography-mass spectrometry (UHPLC-MS / MS). 5 The abundance of C modification was measured using an Agilent 6400 triple quadrupole liquid chromatography-mass spectrometry instrument, which has the characteristics of high sensitivity and high resolution. Watsons distilled water (0.1% formic acid) and acetonitrile (0.1% formic acid) were used as mobile phases. The separation column was a GOLDaQ column (100 mm × 2.1 mm, pore size 1.9 μm), and ion pair injection detection was set. This column is widely used in the quantitative analysis of RNA modification due to its excellent separation efficiency and stability. The results are shown in Figure 7 Right picture.

[0064] The results showed that compared with Sl-CK plants, the RNA m 5 C modification levels increased significantly.

[0065] The sequences of the primers used in the above examples are as follows: HYG-F1 (SEQ ID NO: 8): 5'-CAAAGATCGTTATGTTTATCGGCACT-3'; HYG-R1 (SEQ ID NO: 9): 5'-TTGGCGACCTCGTATTGGGAA-3'.

[0066] Sl-F1 (SEQ ID NO: 10): 5'-GGCTCACTTCAACTAACG-3'; Sl-R1 (SEQ ID NO: 11): 5'-GAGTCATAAATGATGGCTAA-3'.

[0067] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Application of SlNOP2 protein in regulating phenotypic traits of plants; the SlNOP2 protein is the protein shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The meaning of regulating the phenotypic traits of the plant is that the reduction of SlNOP2 protein increases the plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area of ​​the plant.

3. SlNOP2 The use of genes in regulating phenotypic traits of plants; Said SlNOP2 The gene is a gene encoding SlNOP2 protein; The S1NOP2 protein is the S1NOP2 protein described in claim 1; The phenotypic traits are plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area.

4. The use according to claim 3, characterized in that: The meaning of regulating the phenotypic traits of the plant is: knocking out SlNOP2 The gene increases the plant height and / or the number of fruits and / or the weight of fruits and / or the weight of root system and / or the length of seeds and / or the width of seeds and / or the circumference of seeds and / or the surface area of ​​seeds; Alternatively, the phenotypic traits of the plant are controlled by: inhibiting SlNOP2 Gene expression increases the plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area of ​​the plant; Alternatively, the meaning of regulating the phenotypic traits of the plant is: SlNOP2 Genes are targeted for gene editing to increase plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area. 5.SlNOP2 protein or SlNOP2 The invention relates to an application of a gene as an inhibition target in plant breeding; the goal of the plant breeding is to cultivate plants with increased plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area; SlNOP2 The gene is a gene encoding S1NOP2 protein; the S1NOP2 protein is the S1NOP2 protein described in claim 1.

6. Inhibition SlNOP2 The invention relates to a method for producing a plant having an increased plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area. SlNOP2 The gene is a gene encoding S1NOP2 protein; the S1NOP2 protein is the S1NOP2 protein described in claim 1.

7. A method for plant breeding for the purpose of increasing plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed perimeter and / or seed surface area, comprising the steps of: inhibiting SlNOP2 The expression of the gene increases the plant height and / or the number of fruits and / or the weight of fruits and / or the weight of the root system and / or the length of seeds and / or the width of seeds and / or the perimeter of seeds and / or the surface area of ​​seeds; SlNOP2 The gene is a gene encoding S1NOP2 protein; the S1NOP2 protein is the S1NOP2 protein described in claim 1.

8. A method for plant breeding for the purpose of increasing plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed perimeter and / or seed surface area, comprising the steps of: SlNOP2 Genes are edited to obtain gene-edited plants, and plants with increased plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area relative to the recipient plant are screened from the gene-edited plants; SlNOP2 The gene is a gene encoding S1NOP2 protein, and the S1NOP2 protein is the S1NOP2 protein described in claim 1.

9. A plant breeding method for the purpose of increasing plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed perimeter and / or seed surface area, comprising the following steps: increasing the abundance of S1NOP2 protein in a recipient plant to increase the plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed perimeter and / or seed surface area of ​​the plant; the S1NOP2 protein is the S1NOP2 protein described in claim 1.

10. A method for preparing a plant with increased plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed perimeter and / or seed surface area, comprising the steps of: replacing the DNA molecule of SEQ ID NO: 6 or SEQ ID NO: 7 in the genomic DNA of a recipient plant with the DNA molecule of SEQ ID NO: 6 or SEQ ID NO: 7 SlNOP2 The DNA molecule shown in SEQ ID NO: 5 in the gene obtains a plant with increased plant height and / or fruit number and / or fruit weight and / or root weight and / or seed length and / or seed width and / or seed circumference and / or seed surface area; SlNOP2 The gene is a gene encoding S1NOP2 protein, and the S1NOP2 protein is the S1NOP2 protein described in claim 1.

Citation Information

Patent Citations

  • Gene participating in regulation and control of tomato plant height, fruit shape and yield and application thereof

    CN116410986A