Construction method of humanized zebrafish amyotrophic lateral sclerosis model

By constructing a knock-in donor plasmid containing human mutant SOD1 gene sequence, and inserting human SOD1 gene into the zebrafish genome using sgRNA and Cas9 protein technology, the construction of the ALS model of the unmanned SOD1 gene in zebrafish was solved, and the construction of the humanized ALS model and the precise reproduction of ALS disease genotype were achieved.

CN120099094APending Publication Date: 2025-06-06NANJING HUANTZHIYU BIOTECHNOLOGY CO LTD +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202411211199.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-08-30
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

At present, there is no method in zebrafish to construct amyotrophic lateral sclerosis (ALS) model using human SOD1 gene, and it is difficult to accurately indicate the SOD1 gene expression pattern and reproduce the human ALS disease genotype.

Method used

By constructing a knock-in donor plasmid containing the left homologous arm sequence, human mutant SOD1 gene sequence and zebrafish sod1 gene, and injecting a specific sequence of sgRNA and Cas9 protein into the fertilized egg of zebrafish, the human mutant SOD1 gene was successfully inserted into the zebrafish genome, destroying the expression of the endogenous sod1 gene.

Benefits of technology

The construction of a humanized ALS model has been realized, which can replicate the human ALS disease genotype more accurately, provides a new model for the development of targeted drugs, and can be used to study the pathogenesis and treatment methods of ALS.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099094A_ABST
    Figure CN120099094A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene engineering, and discloses a construction method of a humanized zebrafish amyotrophic lateral sclerosis model. Comprising the following steps: constructing a knock-in donor plasmid containing a left homologous arm sequence, a human mutation SOD1 gene sequence and a 3 'UTR sequence of a zebra fish sod1 gene, wherein the left homologous arm contains a target sequence of sgRNA and a second exon sequence of the zebra fish sod1 gene; the method comprises the following steps: knocking in a donor plasmid and Cas9 protein into sgRNA of which the target sequence is as shown in SEQ ID NO: 1, injecting the donor plasmid and the Cas9 protein into fertilized eggs of zebra fish, culturing into adult fish, and screening out a strain of which the human mutation SOD1 gene is correctly inserted into a zebra fish genome. According to the invention, sgRNA with a specific sequence is matched with a corresponding method, so that the human mutated SOD1 gene can be inserted into a zebra fish genome, the expression of the human mutated SOD1 is realized, the expression of an endogenous sod1 gene in the zebra fish is destroyed, and the construction of a humanized ALS model is realized for the first time.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a method for constructing a humanized zebrafish amyotrophic lateral sclerosis model. Background Art

[0002] Amyotrophic Lateral Sclerosis (ALS), also known as Lou Gehrig's disease, is an adult-onset, progressive, and ultimately fatal neuromuscular disease that primarily affects upper and lower neurons, causing muscle weakness and atrophy, as well as progressive paralysis and respiratory failure. ALS can be divided into sporadic and familial forms, of which about 20% of familial ALS is related to Cu / Zn superoxide dismutase 1 (SOD1) gene mutations and abnormal SOD1 protein pathological aggregation.

[0003] In recent years, some studies have used transgenic technology to overexpress the zebrafish sod1 gene to construct an ALS model for the study of anti-ALS drugs. However, there is currently no method for constructing an ALS model using the human SOD1 gene in zebrafish. The construction of a humanized zebrafish ALS model can accurately indicate the SOD1 gene expression pattern and better reproduce the human ALS disease genotype, providing a new model that can be used to develop targeted drugs. In the later stage, SOD1 point mutation homozygotes can be obtained, thereby seeing a more severe phenotype. Summary of the invention

[0004] In order to solve the above technical problem, that is, there is currently no method for constructing an ALS model in zebrafish using the human SOD1 gene, the present invention provides a method for constructing a humanized zebrafish amyotrophic lateral sclerosis model. The present invention uses sgRNA with a specific sequence and cooperates with corresponding methods to achieve the construction of a humanized ALS model for the first time.

[0005] The specific technical scheme of the present invention is: A method for constructing a humanized zebrafish amyotrophic lateral sclerosis model comprises the following steps: (1) constructing a knock-in donor plasmid containing a left homology arm sequence, a human mutant SOD1 gene sequence, and a 3'UTR sequence of a zebrafish sod1 gene; the left homology arm contains a sgRNA target sequence and a second exon sequence of a zebrafish sod1 gene; (2) The sgRNA with the target sequence shown in SEQ ID NO: 1, the knock-in donor plasmid and the Cas9 protein are injected into zebrafish fertilized eggs, the fish are cultured, and the strains in which the human mutant SOD1 gene is correctly inserted into the zebrafish genome are screened.

[0006] In the present invention, after sgRNA, knock-in donor plasmid and Cas9 protein are co-injected, the knock-in donor plasmid and the sgRNA target in the zebrafish genome are cut, and the linearized knock-in donor plasmid is inserted into the zebrafish genome. The sgRNA of the specific sequence used in the present invention has good specificity, and after cooperating with the corresponding method, the expression of the zebrafish sod1 gene can be successfully destroyed, and the human mutant SOD1 gene is inserted into the zebrafish genome to achieve the expression of the human mutant SOD1, thereby obtaining a humanized ALS model. The humanized ALS model obtained by the present invention can study the cellular mechanism and treatment method in the pathogenesis of ALS, and then the model is applied to the high-throughput screening of anti-ALS drugs.

[0007] Preferably, in step (2), the step of preparing the sgRNA comprises: using the pT7-sgRNA plasmid as a template, using a primer pair with sequences as shown in SEQ ID NO: 16 and SEQ ID NO: 17, performing PCR amplification, and then performing in vitro transcription.

[0008] Preferably, in step (1), the left homology arm sequence is as shown in SEQ ID NO: 2.

[0009] Preferably, in step (1), the human mutant SOD1 gene sequence is a human SOD1-G93A gene sequence.

[0010] Preferably, in step (1), the 3'UTR sequence of the zebrafish sod1 gene is as shown in SEQ ID NO:5.

[0011] Preferably, step (1) specifically comprises: connecting the left homology arm sequence, the human mutant SOD1 gene sequence and the 3'UTR sequence of the zebrafish sod1 gene into the pMD-19T vector to obtain a knock-in donor plasmid.

[0012] Preferably, in step (1), the knock-in donor plasmid also contains a marker gene.

[0013] Furthermore, the marker gene is a zebrafish heart marker green fluorescent protein gene.

[0014] Furthermore, the marker gene is a gene expressing EGFP green fluorescent protein under the control of myl7 promoter.

[0015] Preferably, in step (2), the screening process comprises: screening out strains in which the human mutant SOD1 gene is correctly inserted into the zebrafish genome based on the expression of marker genes and genotype identification.

[0016] Furthermore, the process of genotyping includes: (A) Genomic DNA of zebrafish embryos was extracted and PCR identification was performed using primers with sequences as shown in SEQ ID NO: 18 and SEQ ID NO: 19; (B) F2 generation zebrafish embryos expressing marker genes were collected, total RNA was extracted, reverse transcribed, and RT-PCR identification was performed using primers with sequences shown in SEQ ID NO: 20 and SEQ ID NO: 21.

[0017] Preferably, in step (2), after screening out the strain in which the human mutant SOD1 gene is correctly inserted into the zebrafish genome, the screened strain is subjected to phenotype verification, and the phenotype verification process includes at least one of the following (a) and (b): (a) hybridizing the selected strains with wild-type zebrafish strains, and testing the motor ability of the obtained heterozygotes; (b) Crossing the selected strain with a transgenic zebrafish strain with marked motor neurons, and performing motor ability test and / or motor neuron development test on the obtained heterozygotes.

[0018] In the above (b), by hybridizing the selected strains with transgenic zebrafish strains with marked motor neurons, heterozygotes with marked motor neurons and correctly inserted human mutant SOD1 genes can be obtained, and the motor neuron development status of these heterozygotes can be studied.

[0019] Furthermore, the transgenic zebrafish strain for marking motor neurons is Tg (hlxb9:mGFP).

[0020] Compared with the prior art, the present invention has the following advantages: The present invention utilizes sgRNA of a specific sequence in combination with corresponding methods to insert the human mutant SOD1 gene into the zebrafish genome, thereby achieving the expression of the human mutant SOD1 and simultaneously destroying the expression of the endogenous sod1 gene in zebrafish, thus realizing the construction of a humanized ALS model for the first time. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of site-directed insertion of the human SOD1 (G93A) gene into the zebrafish sod1 gene mediated by non-homologous end joining. Figure 1 In the figure, “Endogenous sod1 locus” is the sod1 gene site in the zebrafish genome, “human SOD1-G93A knockin donor” is the knockin donor plasmid, “Targeted sod1 locus” is the zebrafish genome after knocking in the human SOD1 (G93A) gene, and E1 to E5 are the five exons of the zebrafish sod1 gene.

[0022] Figure 2 This is the knock-in donor plasmid map.

[0023] Figure 3 Schematic diagram of experimental results to verify the correct insertion of human SOD1 (G93A) gene. Figure 3 (A) is a gel image of PCR verification of correct gene insertion; Figure 3 (B) Schematic diagram of sequencing results of RT-PCR verification of correct gene insertion.

[0024] Figure 4 Results of the exercise ability test for adult and juvenile zebrafish. Figure 4 (A) is a typical graph of the total movement distance of control and ALS zebrafish at 6 dpf; Figure 4 (B) Total movement distance of control group and ALS zebrafish in 10 min at 6 dpf; Figure 4 (C) is a typical graph of the total movement distance of control and ALS zebrafish at 3 mpf; Figure 4 (D) is the total distance traveled by the control group and ALS zebrafish at 3 mpf in 10 min. Figure 4 In (A), the black line indicates the slow motion trajectory (the motion speed is below 4 mm / s), the green line indicates the medium-speed motion trajectory (the motion speed is 4-20 mm / s), and the red line indicates the fast motion trajectory (the motion speed is above 20 mm / s). Since the black line, green line and red line cannot be distinguished in the figure without color, Figure 4 (A) Color images were used.

[0025] Figure 5 This is the test result of zebrafish motor neuron development. Figure 5 (A) is a fluorescent photograph of the development of motor neuron axons in zebrafish of the control group; Figure 5 (B) is a fluorescent photograph of the development of motor neuron axons in ALS zebrafish; Figure 5 (C) Axon length of a single motor neuron in control and ALS zebrafish; Figure 5 (D) The number of branch points of a single motor neuron in control and ALS zebrafish. DETAILED DESCRIPTION

[0026] The present invention will be further described below in conjunction with the embodiments.

[0027] Overall embodiment A method for constructing a humanized zebrafish amyotrophic lateral sclerosis model comprises the following steps: (1) constructing a knock-in donor plasmid containing a left homology arm sequence, a human mutant SOD1 gene sequence, and a 3'UTR sequence of a zebrafish sod1 gene; the left homology arm contains a sgRNA target sequence and a second exon sequence of a zebrafish sod1 gene; (2) The sgRNA with the target sequence shown in SEQ ID NO: 1, the knock-in donor plasmid and the Cas9 protein are injected into zebrafish fertilized eggs, the fish are cultured, and the strains in which the human mutant SOD1 gene is correctly inserted into the zebrafish genome are screened.

[0028] As a specific implementation, in step (1), the left homology arm sequence is as shown in SEQ ID NO:2.

[0029] As a specific implementation, in step (1), the human mutant SOD1 gene sequence is a human SOD1-G93A gene sequence.

[0030] As a specific implementation, in step (1), the 3'UTR sequence of the zebrafish sod1 gene is as shown in SEQ ID NO:4.

[0031] As a specific implementation, step (1) specifically includes: connecting the left homology arm sequence, the human mutant SOD1 gene sequence and the 3'UTR sequence of the zebrafish sod1 gene into the pMD-19T vector to obtain a knock-in donor plasmid.

[0032] As a specific embodiment, in step (1), the knock-in donor plasmid also contains a marker gene, such as a zebrafish heart marker green fluorescent protein gene.

[0033] As a specific embodiment, in step (2), the sgRNA preparation step includes: using the pT7-sgRNA plasmid as a template, using a primer pair with sequences as shown in SEQ ID NO: 16 and SEQ ID NO: 17, performing PCR amplification, and then performing in vitro transcription.

[0034] As a specific implementation, in step (2), the screening process includes: screening out strains in which the human mutant SOD1 gene is correctly inserted into the zebrafish genome based on the expression of the marker gene and genotype identification; the genotype identification process includes: (A) Genomic DNA of zebrafish embryos was extracted and PCR identification was performed using primers with sequences as shown in SEQ ID NO: 18 and SEQ ID NO: 19; (B) F2 generation zebrafish embryos expressing marker genes were collected, total RNA was extracted, reverse transcribed, and RT-PCR identification was performed using primers with sequences shown in SEQ ID NO: 20 and SEQ ID NO: 21.

[0035] As a specific implementation, in step (2), after screening out the strain in which the human mutant SOD1 gene is correctly inserted into the zebrafish genome, the screened strain is subjected to phenotype verification, and the phenotype verification process includes at least one of the following (a) and (b): (a) hybridizing the selected strains with wild-type zebrafish strains, and testing the motor ability of the obtained heterozygotes; (b) Crossing the selected strain with a transgenic zebrafish strain with marked motor neurons, and performing motor ability test and / or motor neuron development test on the obtained heterozygotes. Specific embodiments The present invention is described below by specific examples. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention, and the attached claims and any equivalents thereof are the protection scope of the present invention.

[0037] Unless otherwise defined, all technical terms and scientific terms used in the present invention have the same meanings as those commonly understood by ordinary technicians in the field to which the present disclosure belongs. Unless otherwise specified, the raw materials and equipment used in the present invention are conventional raw materials and equipment in the field and can be obtained from conventional commercial channels; unless otherwise specified, the methods used in the present invention are conventional methods in the field.

[0038] Example 1: Construction of a knock-in donor plasmid for the human SOD1 (G93A) gene Using the zebrafish genome as a template, the left homology arm sequence and the 3'UTR sequence of the zebrafish sod1 gene were obtained by PCR amplification.

[0039] Using human hepatocyte cDNA as a template, the human mutant SOD1 gene sequence, namely the human SOD1-G93A gene sequence, was obtained by PCR amplification.

[0040] Using the EGFP plasmid that marks the zebrafish heart as a template, the heart-marking green fluorescent protein gene sequence (ie, T-myl7-EGFP-pA-fusion sequence) was obtained by PCR amplification.

[0041] In the above process, the primer sequences used are shown in Table 1, where LF and LR are the upstream and downstream primers used to amplify the left homologous arm sequence; SOD1-F and SOD1-R are the upstream and downstream primers used to amplify the human SOD1 gene sequence; RF and RR are the upstream and downstream primers used to amplify the zebrafish sod1 gene 3'UTR sequence; TF and TR are the upstream and downstream primers used to amplify the T-myl7-EGFP-pA sequence; SOD-G93A-F and SOD-G93A-R are the upstream and downstream primers used for SOD1 point mutations.

[0042] Table 1 Primer sequences for constructing knock-in donor plasmids The amplified left homology arm sequence, human SOD1 (G93A) sequence, zebrafish sod1 gene 3'UTR sequence and heart marker green fluorescent protein gene sequence were sequentially connected into the pMD-19T vector (purchased from Takara) to obtain a knock-in donor plasmid. Figure 2 The map of the resulting knock-in donor plasmid is shown, which contains a left homology arm, a human SOD1 (G93A) sequence, a 3'UTR sequence of the zebrafish sod1 gene, and a cardiac marker green fluorescent protein gene sequence that can be used for screening. Among these sequences: the left homology arm sequence is shown in SEQ ID NO: 2, with a length of 300 bps, and contains a nuclease recognition site sgRNA target sequence and a 6-amino acid coding sequence of the second exon of the zebrafish sod1 gene; the human SOD1 (G93A) sequence and the 3'UTR sequence of the zebrafish sod1 gene are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively, with lengths of 465 bps and 442 bps, respectively; in order to improve the efficiency of screening, the selection marker (1252 bps, sequence as shown in SEQ ID NO: 5) can express EGFP under the control of the myl7 promoter.

[0043] The specific sequence mentioned above is as follows: Left homology arm sequence (SEQ ID NO: 2): GAGCTTGGGTGATTTATGACTTGTATTGATAAACCTCTCATAAAATAAGTGACATTGCAAaAAAGCAAAATAAGgATATTGTCACTTTTGATTCCGTGTTGAGATAAACATGCAGTGCATTCCAGGTGTACATTTGGAAACAAATTGTCTGTATGATGTGTTTTGCAGCCAAGCATAACTTGGTTAACTGCGCTTTTGTTTTGTGAAATGATATGAAACCtTGTTTTCTGAAGTGATgTGAAACCGTTGTTAACCACACAAgGGATCTGTATGTTTTAGGGTGAAAAGAAGCCAGTCTAG; Human SOD1 (G93A) sequence (SEQ ID NO: 3): ATGGCGACGAAGGCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGCAGGGCATCATCAATTTCGAGCAGAAGGAAAGTAATGGACCAGTGAAGGTGTGGGGAAGCATTAAAGGACTGACTGAAGGCCTGCATGGATTCCATGTTCATGAGTTTGGAGATAATACAGCAGGCTGTACCAGTGCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGGTGGGCCAAAGGATGAAGAGAGGCATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGcTGTGGCCGATGTGTCTATTGAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCCGCACACTGGTGGTCCATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGAAACGCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAA; 3' UTR sequence of zebrafish sod1 gene (SEQ ID NO: 4): TGAATCTGCTCTAATGGAAGAGCCGGTTGAAATATTGGTGACCAATGTGGATGCCTCTGAAAGCACTTAGCCCGCTGACAATTACATCTCTATTTTTGTTAGGTAACGTTGAAAGAATTGTACTTTAGCCTTGTTAAGCTGTTTTTCTGTGCATTTCTATGTGGGCAACCTTTTATTTGTTATCTGCTTAATTCATTAAACATTGAGCAGACTGGAAATGTGGATGTGTGTGTCTTTTATGAACTACATTTAATAAAATTGTGCAAGTCCATTATTAGAATGAATGCTAATCAGTGTTTATTTGTAATTTAAAATTACAATTTTATTGCTAAAATTACTAAAATTGTAGCATAAAAATATATAATAGCATAAAATAATATTAAAATAGCAGGTTTTTTTTCTGGGATAATTGATTAATTTGCAATCCAGCCACTTTATTAGG; Selection marker myl7-EGFP-pA sequence (SEQ ID NO:5):

[0044] Example 2: Synthesizing sgRNA The DNA sequence used to prepare sgRNA (target sequence of sgRNA) is shown in SEQ ID NO: 1, and is as follows: GCAGTTAACCAAGTTATGCT (on the antisense strand).

[0045] Using pT7-sgRNA plasmid (obtained from the School of Life Sciences, Peking University) as a template (this plasmid is a universal template for constructing sgRNA), sod1 4s-F (containing the target site of the sgRNA required by the present invention, SEQ ID NO: 1) and T7 gRNA-R primers, the primer sequences are shown in Table 2, PCR amplification was performed to obtain an in vitro transcription template, and HiScribe TM T7 (lot number 10158087, New England Biolabs, USA) was used for in vitro transcription and mirVana TM The miRNA Isolation Kit (Ambion) was used to recover and obtain sgRNA.

[0046] Table 2 Primer sequences for sgRNA in vitro transcription template amplification Example 3: Zebrafish strains, husbandry and microinjection Adult zebrafish were cultured using the Beijing Aisheng Company Aquatic Animal Culture System in an environment with a water temperature of 28°C, pH 7-8, and a photoperiod of 14 h light / 10 h dark.

[0047] Embryos were maintained in a 10-fold diluted Hank's solution. The composition of Hank's solution is as follows: 140mmol / L NaCl, 5.4mmol / L KCl, 0.25mmol / L Na 2 HPO 4 , 0.44mmol / L KH 2 PO 4 , 1.3mmol / L CaCl 2 , 1.0mmol / LMgSO 4 and 4.2mmol / L NaHCO 3 ; pH 7.2.

[0048] A liquid containing 800ng / μL Cas9 protein, 320ng / μL sgRNA (obtained in Example 2) and 15ng / μL knock-in donor plasmid (obtained in Example 1) was injected into one-cell stage zebrafish fertilized eggs by microinjection, with 1nL of liquid injected into each fertilized egg. The process of inserting the human SOD1 (G93A) gene into the zebrafish genome is as follows Figure 1 As shown, the sgRNA4 target is indicated by a red arrow. After the knock-in donor plasmid is co-injected with sgRNA4 and Cas9 protein, the knock-in donor plasmid and the zebrafish genome are cut at the sgRNA target site, and the linearized plasmid is inserted into the zebrafish genome, thereby achieving the knockout of the original sod1 in the zebrafish genome and the insertion of the human SOD1 (G93A) gene. The fertilized eggs develop into zebrafish under in vitro culture conditions (i.e., the embryonic rearing conditions described above).

[0049] Example 4: Fluorescence and genotype identification and screening to obtain a humanized zebrafish ALS model. Through fluorescence and genotype identification, the strains in which the human SOD1 (G93A) gene was correctly inserted into the zebrafish genome were screened from the zebrafish obtained after microinjection in Example 3, that is, the humanized zebrafish ALS model was obtained. The specific screening process is as follows: (1) PCR verification of gene insertion: The fertilized eggs produced by the zebrafish that completed microinjection and in vitro culture in Example 3 were collected, genomic DNA was extracted, and the strains with the human SOD1 (G93A) gene correctly inserted were screened by the PCR method. The primers used are shown in Table 3, the PCR system is shown in Table 4, and the PCR program is as follows: 95°C for 5 min; 94°C for 30 s, 58°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 5 min.

[0050] Table 3 Knock-in verification primer sequences Primer name Primer sequences Sequence number JF-1 5'-CACTGAATGAATGTGCGGATGTA-3' SEQ ID NO:18 JR-1 5'-TTATTGGGCGATCCCAATTACACCA-3' SEQ ID NO:19 Table 4 PCR system <![CDATA[dd H 2 The]]> 35.75μL 10×buffer 5μL dNTP 4μL JF-1 2μL JR-1 2μL template 1μL Extaq enzyme 0.25μL Total volume 50μL The PCR product was subjected to gel electrophoresis, and the resulting gel image was as follows: Figure 3 (A) As shown. In the gel image of the strain with the human SOD1 (G93A) gene correctly inserted, there is a band of 856 bps, while in the gel image of the strain with the human SOD1 (G93A) gene incorrectly inserted, there is no such band. (2) RT-PCR identification: Twenty F2 zebrafish embryos with bright green hearts were collected, and total RNA was extracted by Trizol (Invitrogen), reverse transcribed (HifairTM II 1st Strand cDNA Synthesis SuperMix for qPCR, Yisheng), and RT-PCR identification was performed. The primers used were shown in Table 5, the PCR system was shown in Table 3 above, and the PCR program was as follows: 95°C for 5 min; 94°C for 30 s, 58°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 5 min.

[0051] Table 5 RT-PCR identification primer sequences Primer name Primer sequences Sequence number SOD1-F 5'-ATGGCGACGAAGGCCGTGTG-3' SEQ ID NO:20 SOD1-R 5'-TTATTGGGCGATCCCAATTACACCA-3' SEQ ID NO:21 The RT-PCR products were sequenced, and the sequencing results of the correct and incorrect insertion of the human SOD1 (G93A) gene were as follows: Figure 3 (B) shown.

[0052] Example 5: Phenotypic Verification of Humanized Zebrafish ALS Model (Motor Ability Test) The methods for testing the athletic ability of juvenile and adult fish are as follows: (1) Juvenile fish (6 dpf): The motor ability of juvenile fish was tested using a behavior analyzer (V3.11, ViewPoint Life Sciences, France). The strain in which the human SOD1 (G93A) gene screened and verified in Example 4 was correctly inserted was hybridized with AB wild-type zebrafish, and 10 6 dpf heterozygous zebrafish (denoted as "ALS") were randomly selected from the obtained 6 dpf in a 96-well plate, with 6 dpf AB wild-type zebrafish as a control. Data was collected using a behavior analyzer, and the total movement distance of the zebrafish was analyzed. The statistical analysis results of this indicator were used to evaluate the motor ability of ALS zebrafish. The statistical processing results are expressed as mean ± SE. SPSS26.0 software was used for statistical analysis, and p < 0.05 indicated that the difference was statistically significant.

[0053] (2) Adult fish (3mpf): The motor ability of adult fish was tested using a behavior analyzer (Zebra Lab 3.22.3.31, Viewpoint, France). The strain with the correctly inserted human SOD1 (G93A) gene screened and verified in Example 4 was hybridized with AB wild-type zebrafish. Five 3mpf heterozygous zebrafish (denoted as "ALS") were randomly selected and placed in a culture tank. AB wild-type zebrafish of the same size and culture conditions were used as controls. They were placed in 10cm×10cm×10cm (length×width×height) fish tanks, 300mL / tail. After the camera captured the video, the total movement distance and activity of the zebrafish were analyzed using a behavior analyzer. The statistical analysis results of the above indicators were used to evaluate the motor ability of ALS zebrafish. The statistical processing results are expressed as mean±SE. SPSS26.0 software was used for statistical analysis, and p<0.05 indicated that the difference was statistically significant.

[0054] Figure 4 (A) and Figure 4 (C) shows the movement of juvenile and adult fish; Figure 3 (B) and Figure 4 (D) shows the total distance traveled by juveniles and adults within 10 min. Figure 4 It can be seen that compared with the control group (WT), the ALS zebrafish have reduced movement and weakened motor ability.

[0055] Example 6: Phenotypic Validation of Humanized Zebrafish ALS Model (Analysis of Motor Neuron Development) The strains in which the human SOD1 (G93A) gene screened and verified in Example 4 was correctly inserted were hybridized with the transgenic strain Tg (hlxb9: mGFP) marking motor neurons to obtain the knock-in strains (denoted as "ALS") of humanized SOD1 (G93A) that simultaneously marked motor neurons, from which 30hpf zebrafish were randomly selected, and 30hpf Tg (hlxb9: mGFP) transgenic zebrafish were used as controls. A laser confocal microscope (model AX, Nikon, Japan) was used to collect continuous fluorescence images in the Z-axis direction with a 10x zoom 3. The resolution of all images is 1024×1024. The structural morphology was reconstructed by ImageJ software (NIH) at a later stage. The axon length, number of segments, and number of branch points of a single motor neuron were statistically analyzed, and the statistical processing results were expressed by mean±SE, and statistical analysis and mapping were performed using GraphPad Prism 8 software, and p<0.05 indicated that the difference was statistically significant.

[0056] Figure 5 (A) and Figure 5(B) is a fluorescent image showing the development of motor neuron axons in ALS and control zebrafish; Figure 5 (C) and Figure 5 (D) shows the axon length and branch point number of a single motor neuron. Figure 4 It can be seen that compared with the control group, the neuronal axon development of ALS zebrafish is poor, the axon length is shorter, and the number of branch points is more.

[0057] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A method for constructing a humanized zebrafish amyotrophic lateral sclerosis model, characterized in that: The following steps are involved: (1) constructing a knock-in donor plasmid containing a left homology arm sequence, a human mutant SOD1 gene sequence, and a 3'UTR sequence of a zebrafish sod1 gene; the left homology arm contains a target sequence of an sgRNA and a second exon sequence of a zebrafish sod1 gene; (2) Injecting the sgRNA with the target sequence shown in SEQ ID NO:1, the knock-in donor plasmid and the Cas9 protein into zebrafish fertilized eggs, culturing the fish, and screening out strains in which the human mutant SOD1 gene is correctly inserted into the zebrafish genome.

2. The construction method according to claim 1, characterized in that: In step (2), the sgRNA preparation step includes: using the pT7-sgRNA plasmid as a template, using the primer pair with sequences as shown in SEQ ID NO: 16 and SEQ ID NO: 17, performing PCR amplification, and then performing in vitro transcription.

3. The construction method according to claim 1, characterized in that: In step (1), the left homology arm sequence is shown as SEQ ID NO:

2.

4. The construction method according to claim 1, characterized in that: In step (1), the human mutant SOD1 gene sequence is a human SOD1-G93A gene sequence.

5. The construction method according to claim 1, characterized in that: In step (1), the 3'UTR sequence of the zebrafish sod1 gene is shown in SEQ ID NO:

4.

6. The construction method according to claim 1, characterized in that: Step (1) specifically includes: connecting the left homology arm sequence, the human mutant SOD1 gene sequence and the 3'UTR sequence of the zebrafish sod1 gene into the pMD-19T vector to obtain a knock-in donor plasmid.

7. The construction method according to claim 1 or 6, characterized in that: In step (1), the knock-in donor plasmid also contains a marker gene.

8. The construction method according to claim 7, characterized in that: In step (2), the screening process includes: screening out strains in which the human mutant SOD1 gene is correctly inserted into the zebrafish genome based on the expression of the marker gene and genotype identification.

9. The construction method according to claim 8, characterized in that: The process of genotyping includes: (A) Genomic DNA of zebrafish embryos was extracted, and PCR identification was performed using primers with sequences shown in SEQ ID NO: 18 and SEQ ID NO: 19; (B) F2 generation zebrafish embryos expressing marker genes were collected, total RNA was extracted, reverse transcribed, and RT-PCR identification was performed using primers with sequences shown in SEQ ID NO: 20 and SEQ ID NO:

21.

10. The construction method according to claim 1, characterized in that: In step (2), after screening out a strain in which the human mutant SOD1 gene is correctly inserted into the zebrafish genome, the screened strain is subjected to phenotype verification, and the phenotype verification process includes: hybridizing the screened strain with a transgenic zebrafish strain with marked motor neurons, and performing a motor ability test and / or a motor neuron development test on the obtained heterozygotes.

Citation Information

Patent Citations

  • Construction method and related vector of zebra fish heart specific expression model

    CN108949756A

  • Method for establishing ALS disease model dog

    CN116004717A

  • GRNA combination for constructing ALS fruit fly model with human FUS gene knocked in and application of gRNA combination

    CN116042619A

  • SgRNA for targeted knockout of zebrafish SIGIRR gene, CRISPR / Cas9 system of sgRNA and application of sgRNA and CRISPR / Cas9 system

    CN118147139A