Genetic thrombophilia gene detection kit and application thereof

Abstract

The invention discloses a hereditary thrombophilia gene detection kit and application thereof, and relates to the technical field of gene detection. The kit comprises three tubes of PCR reaction liquid, and each tube of PCR reaction liquid contains a specific primer and a fluorescent probe and covers 11 SNP sites. According to the hereditary thrombophilia gene detection kit and the application thereof, high-throughput typing of 11 SNP loci is realized through a multi-channel fluorescent PCR and melting curve analysis technology. The kit has the advantages of simplicity and convenience in operation, high sensitivity, low cost and the like, and is suitable for clinical early screening and precise intervention.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a genetic thrombophilia gene detection kit and application thereof. Background Art

[0002] Thrombophilia refers to a disease or state that is prone to thromboembolism due to hereditary or acquired defects in anticoagulant proteins, coagulation factors, fibrinolytic proteins, etc., or the presence of acquired risk factors. It is also called a prothrombotic state, and its main clinical manifestation is venous thromboembolism (VTE). Based on clinical symptoms, signs and laboratory tests, thrombophilia is mainly divided into two categories: hereditary thrombophilia and acquired thrombophilia.

[0003] Hereditary thrombophilia is caused by a certain gene defect in the patient's body, which leads to a decrease or abnormality in the corresponding protein content. Its risk factors mainly include: abnormal procoagulant factors, such as the Leiden mutation of the coagulation factor V gene (F5G1601A) and the G20210A mutation of the prothrombin gene (F2 G20210A); metabolic defects, such as the C677T mutation of the methylenetetrahydrofolate reductase (MTHFR) gene and the C.66A>G mutation of the MTRR gene; anticoagulant protein defects, such as protein C (PROC) gene mutations (such as C.565C>T, C.574-576del), protein S (PROS1) gene mutations (such as C.1680T>A, 252del, etc.), antithrombin (AT) deficiency, etc.; abnormal fibrinolytic system, such as mutations in the plasminogen activator inhibitor-1 (PAI-1).

[0004] Acquired thrombophilia refers to a group of diseases that are extremely likely to cause thrombosis and a dangerous state that is extremely likely to cause thrombosis. The risk factors mainly include: advanced age, surgery, trauma, prolonged immobilization, malignant tumors, oral contraceptives and hormone replacement therapy, pregnancy and postpartum period, antiphospholipid syndrome, paroxysmal nocturnal hemoglobinuria, myeloproliferative diseases, undifferentiated connective tissue disease, autoimmune diseases, and medical complications (hypertension, diabetes, chronic nephritis, etc.), with antiphospholipid syndrome being the most common.

[0005] Currently, the detection methods for inherited thrombophilias have the following limitations:

[0006] (1) PCR-RFLP: The operation is cumbersome, time-consuming, and has the risk of false positives.

[0007] (2) Sequencing method: high cost, long detection cycle, not suitable for large-scale screening.

[0008] (3) qPCR: It requires the design of specific probes, which is costly and difficult to achieve multiplex detection of multiple gene loci.

[0009] The present invention realizes simultaneous detection of multiple gene loci by optimizing the primer-probe combination and the reaction system, thereby improving detection efficiency and accuracy. Summary of the invention

[0010] In order to overcome the deficiencies of the prior art, the present invention provides a genetic thrombophilia detection kit and an application method thereof, aiming to achieve rapid, accurate and low-cost detection of multiple thrombophilia-related gene polymorphic sites.

[0011] To achieve the above objectives, in a first aspect, the present invention provides a hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis, comprising 3 tubes of PCR reaction solution, each tube of PCR reaction solution containing specific primers and fluorescent probes, covering 11 SNP sites.

[0012] Preferably, the three tubes of PCR reaction solution include: PCR reaction solution 1, PCR reaction solution 2 and PCR reaction solution 3;

[0013] The SNP sites detected by PCR reaction solution 1 included F11 C.56-282T>C, THBD C.151G>T, PROS1 C.1351C>T, and SERPINC1 C.218C>T;

[0014] The SNP sites detected by PCR reaction solution 2 included F11 C.481188C>T, PROC C.574-576del, PROS1C.586A>G, ​​and SERPINC1 C.1306G>A;

[0015] The SNP sites detected by PCR reaction solution 3 include F5 G1601A, PROS1 C.701A>G, and SERPINC1 C.391C>T.

[0016] Preferably, the specific primers and fluorescent probe sequences in the PCR reaction solution 1 include:

[0017] Specific primers F11-F and F11-R and fluorescent probe F11-12 designed for F11 C.56-282T>C gene, the sequence number of F11-F is shown in SEQ ID NO.1, the sequence number of F11-R is shown in SEQ ID NO.2, and the sequence number of F11-12 is shown in SEQ ID NO.3;

[0018] and specific primers THB-F, TH BR and fluorescent probe THBD12 designed for THBD C.151G>T gene, the sequence number of THB-F is shown in SEQ ID NO.4, the sequence number of THB-R is shown in SEQ ID NO.5, and the sequence number of THBD12 is shown in SEQ ID NO.6;

[0019] and specific primers P1351-F11 and P135C-R and fluorescent probe P1351C>T designed for PROS1 C.1351C>T gene, the sequence number of P1351-F11 is shown in SEQ ID NO.7, the sequence number of P135C-R is shown in SEQ ID NO.8, and the sequence number of P1351C>T is shown in SEQ ID NO.9;

[0020] And specific primers 218C, 218R and fluorescent probe S218C>T designed for the SERPINC1 C.218C>T gene, the sequence number of 218C is shown in SEQ ID NO.10, the sequence number of 218R is shown in SEQ ID NO.11, and the sequence number of S218C>T is shown in SEQ ID NO.12.

[0021] Preferably, the specific primers and fluorescent probe sequences in the PCR reaction solution 2 include:

[0022] Specific primers F11-2F and F11-2R and fluorescent probe F11-21 designed for the F11 C.481188C>T gene, the sequence number of F11-2F is shown in SEQ ID NO.13, the sequence number of F11-2R is shown in SEQ ID NO.14, and the sequence number of F11-21 is shown in SEQ ID NO.15;

[0023] and specific primers PRO-F, PROC2-R and fluorescent probe PROC21 designed for PROC C.574-576del gene, PRO-F sequence number is shown in SEQ ID NO.16, PROC2-R sequence number is shown in SEQ ID NO.17, PROC21 sequence number is shown in SEQ ID NO.18;

[0024] and specific primers P586-F13 and 586R designed for PROS1 C.586A>G gene and fluorescent probe P586A>G, ​​the sequence number of P586-F13 is shown in SEQ ID NO.19, the sequence number of 586R is shown in SEQ ID NO.20, and the sequence number of P586A>G is shown in SEQ ID NO.21;

[0025] And specific primers S1306F11, 1306R and fluorescent probe S1306-Pb12 designed for the SERPINC1 C.1306G>A gene, the sequence number of S1306F11 is shown in SEQ ID NO.22, the sequence number of 1306R is shown in SEQ ID NO.23, and the sequence number of S1306-Pb12 is shown in SEQ ID NO.24.

[0026] Preferably, the specific primers and fluorescent probe sequences in the PCR reaction solution 3 include:

[0027] Specific primers F5-F and F5-R and fluorescent probe F51 designed for F5 G1601A gene, the sequence number of F5-F is shown in SEQ ID NO.25, the sequence number of F5-R is shown in SEQ ID NO.26, and the sequence number of F51 is shown in SEQ ID NO.27;

[0028] and specific primers 701F and P701-R12 designed for PROS1 C.701A>G gene and fluorescent probe P701A>G, the sequence number of 701F is shown in SEQ ID NO.28, the sequence number of P701-R12 is shown in SEQ ID NO.29, and the sequence number of P701A>G is shown in SEQ ID NO.30;

[0029] And specific primers 391F, S391R12 and fluorescent probe S391-Pb11 designed for the SERPINC1 C.391C>T gene, the sequence number of 391F is shown in SEQ ID NO.31, the sequence number of S391R12 is shown in SEQ ID NO.32, and the sequence number of S391-Pb11 is shown in SEQ ID NO.33.

[0030] In a second aspect, the present invention provides an application of the above-mentioned hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis, including application in hereditary thrombophilia diagnosis for non-medical purposes, thrombosis risk assessment or personalized medication guidance.

[0031] Therefore, the hereditary thrombophilia gene detection kit and its application of the present invention have the following beneficial effects:

[0032] (1) Real-time fluorescence quantitative PCR technology was used in combination with asymmetric PCR, fluorescent probes and melting curve analysis to qualitatively detect the polymorphic SNPs of F11 (C.481188C>T), F11 (C.56-282T>C), F5 (G1601A), PROC (C.574-576del), THBD (C.151G>T), PROS1 (C.1351C>T), PROS1 (C.586A>G), PR OS1 (C.701A>G), SERPINC1 (C.218C>T), SERPINC1 (C.1306G>A) and SERPINC1 (C.391C>T) in DNA samples;

[0033] (2) Using four-channel fluorescent probes of FAM, HEX, ROX, and CY5 or three-channel fluorescent probes of FAM, ROX, and CY5 combined with asymmetric amplification technology to achieve simultaneous amplification of multiple targets;

[0034] (3) Use specific primers and probes to perform high-precision PCR amplification of the target sequence, and perform SNP typing by analyzing and comparing the changes in the Tm value of the melting curve generated by the specific fluorescent probe and the target sequence;

[0035] (4) It has the advantages of simple operation, high sensitivity, and low cost, making it suitable for early clinical screening and precise intervention.

[0036] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0038] Figure 1 This is the detection spectrum of the reaction tube 1 in Example 3 of the present invention;

[0039] Figure 2 This is the detection spectrum of the reaction tube 2 in Example 3 of the present invention;

[0040] Figure 3 This is the detection spectrum of the reaction tube 3 in Example 3 of the present invention. DETAILED DESCRIPTION

[0041] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0042] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0043] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels.

[0044] Embodiment 1

[0045] A hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis, the components of which are shown in Table 1 below:

[0046] Table 1 Kit components

[0047]

[0048] Among them, the primers and fluorescent probe sequences in PCR reaction solution 1 are:

[0049] F11-F, the sequence number is as shown in SEQ ID NO. 1, which is CTCGTTCCAGAC CTGGATGA;

[0050] F11-R, the sequence number is shown in SEQ ID NO. 2, which is CTTGGAGACAAG GAGTGCTTTG;

[0051] Fluorescent probe F11-12, the sequence number is shown in SEQ ID NO. 3, which is FAM-ccggTTGCCAGTAAAGATCCTTGAAATGAccgg-BHQ1;

[0052] THB-F, the sequence number is shown in SEQ ID NO. 4, which is CACTTATAAACT CGAGCCCTGGC;

[0053] THB-R, the sequence number is shown in SEQ ID NO. 5, which is CCCAGACACTT CTTGCCGC;

[0054] Fluorescent probe THBD12, the sequence number is shown in SEQ ID NO. 6, VIC-ccggAGGCTGCCTCGCAGGGGCTGccgg-BHQ1;

[0055] P1351-F11, the sequence number is shown in SEQ ID NO. 7, which is TCTCTTAAT GAAAACCTATACTCATAATCG;

[0056] P135C-R, the sequence number is shown in SEQ ID NO. 8, which is GAATAATTTC CTTTATTCCAGAAGCTCC;

[0057] Fluorescent probe P1351C>T, the sequence number is shown in SEQ ID NO. 9, which is ROX-CGGATGTATACGAAGCTGGAATTTGATCCG-BHQ2;

[0058] 218C, the sequence number is as shown in SEQ ID NO. 10, CCGGAGAAGAA GGCAACTGAG;

[0059] 218R, the sequence number is shown in SEQ ID NO. 11, which is GGTAGCAAAGC GGGAATTGG;

[0060] The fluorescent probe S218C>T, the sequence number is shown in SEQ ID NO.12, which is CY5-ccggACAGAAGATCCCGGAGGCCACCgg-BHQ3.

[0061] The primers and fluorescent probe sequences in PCR reaction solution 2 are:

[0062] F11-2F, the sequence number is shown in SEQ ID NO. 13, which is GGATGAGGAG TTAGCGGTGAGG;

[0063] F11-2R, the sequence number is shown in SEQ ID NO. 14, which is CTCCCTCAGGT TCAGCACGA;

[0064] Fluorescent probe F11-21, the sequence number is shown in SEQ ID NO. 15, which is FAM-atgaGTCTCTCTCTCGCCCTCTCAT-BHQ1;

[0065] PRO-F, the sequence number is shown in SEQ ID NO. 16, which is AGTCTCGGGAG GAGTGCCTG;

[0066] PROC2-R, the sequence number is shown in SEQ ID NO. 17, which is GTCTTCTTG GTCTTCTGTGTCTCG;

[0067] Fluorescent probe PROC21, the sequence number is shown in SEQ ID NO. 18, which is VIC-CGGATGGAGAAGAAGCGCAGTCAtccg-BHQ1;

[0068] P586-F13, the sequence number is shown in SEQ ID NO. 19, which is GGAAGTTAC CACTGTTCCTGTAATAA;

[0069] 586R, the sequence number is shown in SEQ ID NO. 20, which is GTGTTTTAATTC TACCATCCTGCTCTTACC;

[0070] Fluorescent probe P586A>G, ​​the sequence number is shown in SEQ ID NO. 21, which is ROX-ttaTATGCTTTCAAATAAGAAAGATTGTAA-BHQ2;

[0071] S1306F11, the sequence number is shown in SEQ ID NO. 22, which is GCTGGCCGT TCGCTAAAC;

[0072] 1306R, the sequence number is shown in SEQ ID NO. 23, which is CCCATGAAGAT AATAGTGTTCAGAGG;

[0073] The fluorescent probe S1306-Pb12, the sequence number of which is shown in SEQ ID NO. 24, is CY5-ccggACTTTCAAGGCCAACAGGCtccgg-BHQ3.

[0074] The sequences of primers and fluorescent probes in PCR reaction solution 3 are:

[0075] F5-F, the sequence number is shown in SEQ ID NO. 25, which is GCCTCTGGGCTA ATAGGACTACTTC;

[0076] F5-R, the sequence number is shown in SEQ ID NO. 26, which is GAATTCTGAAA GGTTACTTCAAGGAC;

[0077] F51, the sequence number is shown in SEQ ID NO. 27, which is FAM-aCCTGGACA GGCGAGGAATACAGGT-BHQ1;

[0078] 701F, the sequence number is shown in SEQ ID NO. 28, which is TGTGCAAGAACA TCCCAGGAG;

[0079] P701-R12, the sequence number is shown in SEQ ID NO. 29, which is CCATCAGTA ATGATACCACCATCATC;

[0080] P701A>G, the sequence number is shown in SEQ ID NO. 30, which is ROX-CCGAAGGCTACAGATATAATCTCAAATCAttcgg-BHQ2;

[0081] 391F, the sequence number is as shown in SEQ ID NO. 31, CCCTGAGTATCT CCACGGCTT;

[0082] S391R12, the sequence number is shown in SEQ ID NO. 32, which is AGGTGGCTG GGCAGAAGAC;

[0083] S391-Pb11, the sequence number is shown in SEQ ID NO.33, which is CY5-ccgTGTAATGACACCCTCCAGCAACTGAcgg-BHQ3.

[0084] The genetic detection kit for hereditary thrombophilia uses multiple PCR-melting curve analysis technology, using multiple pairs of specific primers to simultaneously amplify multiple target gene sites, each pair of primers corresponding to a gene site to ensure specific amplification. Each pair of primers corresponds to a specific fluorescent probe, which dissociates at a specific temperature after binding to the target sequence, resulting in changes in the fluorescent signal. By monitoring the signal changes of different fluorescent channels, a melting curve is drawn. Based on the differences in Tm values ​​of different gene sites, multiple gene polymorphisms can be distinguished.

[0085] Embodiment 2

[0086] A genetic detection kit for hereditary thrombophilia based on multiplex PCR-melting curve analysis comprises the following steps:

[0087] S1. Sample processing: DNA was extracted from human peripheral blood using commercial nucleic acid extraction reagents. The extracted product could be stored at -20°C for more than 6 months.

[0088] S3. Reagent preparation:

[0089] Take out PCR reaction solution 1, PCR reaction solution 2, PCR reaction solution 3 and enzyme from the test kit, melt and shake at room temperature, and centrifuge at 2000rpm for 10 seconds. Calculate the number of reaction reagents required for testing n. The complete test reaction system of each sample requires 3 tubes of reaction solution for simultaneous testing. Each test reaction system is prepared as follows:

[0090] Table 3 Reaction system configuration

[0091] Components Reaction tube 1 Reaction tube 2 Reaction tube 3 PCR reaction solution 1 17μL PCR reaction solution 2 17μL PCR reaction solution 2 17μL Enzymes 1μL 1μL 1μL Total volume 18μL 18μL 18μL

[0092] The calculation formula for the number of reaction reagent tests n required is:

[0093] n = number of samples + number of negative controls + number of positive controls.

[0094] Calculate the amount of each reagent in the reaction system according to n tests, add it to a centrifuge tube of appropriate volume and mix well. Dispense 18 μL into 8-tube PCR thin-wall tubes, and then transfer to the sample processing area for subsequent sample addition.

[0095] S4, add sample:

[0096] The total volume of a single reaction is 20 μL, so add 2 μL of negative control, 2 μL of positive control, and 2 μL of sample to the PCR thin-walled tube containing 18 μL of reaction solution in step S3 in order, cover the eight-tube strip tightly, then gently mix the eight-tube strip, centrifuge it instantaneously, and finally transfer it to the PCR detection area.

[0097] S5. PCR amplification and fluorescence detection:

[0098] Each reaction tube was sequentially placed in a fluorescent quantitative PCR instrument for PCR amplification. The amplification program is shown in Table 4 below:

[0099] Table 4 PCR reaction program

[0100]

[0101] The reaction volume was 20 μL, and the fluorescence detection options were: FAM channel, HEX channel, quencher group selected none, and reference fluorescence selected none (no quencher group and reference fluorescence).

[0102] Quality control requirements:

[0103] (1) Threshold setting: The threshold line is just above the highest point of the normal negative control. The automatic analysis mode or manual analysis mode can be adjusted according to the situation.

[0104] (2) Negative control: There should be no obvious melting peak corresponding to the Tm. If a melting peak appears, it may be due to reagent contamination or operational contamination. The contamination source must be eliminated and retested.

[0105] (3) Result determination: If all the above requirements are met, the test is successful and the sample can be interpreted; otherwise, it is considered invalid and errors in the instrument, reagents, amplification conditions, etc. need to be checked.

[0106] S6. Results Analysis

[0107] The target genes and melting peak Tm values ​​corresponding to each reaction tube are shown in Tables 5 to 7 below. According to the melting peak Tm value range shown in the table below, the corresponding genotype is interpreted:

[0108] Table 5 Melting peak Tm value range of target gene and positive control in reaction tube 1

[0109]

[0110] Table 6 Melting peak Tm value range of target gene and positive control in reaction tube 2

[0111]

[0112]

[0113] Table 7 Melting peak Tm value range of target gene and positive control in reaction tube 3

[0114]

[0115] Note: “ / ” indicates no obvious melting peak. If the detected peak is at the critical value between the high peak and the low peak, re-test is required.

[0116] Embodiment 3

[0117] An application of a hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis, the application method is the same as that of Example 2, and the detection pattern of the macrostone SLAN-96P real-time fluorescence quantitative PCR instrument is as follows Figures 1 to 3 shown.

[0118] Among them, the blue curve is the FAM channel, the green curve is the HEX channel, the orange curve is the ROX channel, and the red curve is the CY5 channel.

[0119] like Figure 1 As shown, in the FAM channel: the temperatures at which the melting peaks of F11 C.56-282T>C appear are 57.80°C and 61.18°C. According to the interpretation rules, the result should be TC type (heterozygous mutation).

[0120] HEX channel: The temperature at which the melting peak of THBD C.151G>T appears is 74.22°C. According to the interpretation rules, the result should be GG type (wild type).

[0121] ROX channel: The temperature at which the melting peak of PROS1 C.1351C>T appears is 63.57°C. According to the interpretation rules, the result should be CC type (wild type).

[0122] CY5 channel: The temperature at which the melting peak of SERPINC1 C.218C>T appears is 67.00℃. According to the interpretation rules, the result should be CC type (wild type).

[0123] like Figure 2 As shown, in the FAM channel: the temperatures of the melting peaks of F11 C.481188C>T are 56.21°C and 65.57°C. According to the interpretation rules, the result should be CT type (heterozygous mutation).

[0124] HEX channel: The temperature at which the melting peak of PROC C.574-576del appears is 68.03°C. According to the interpretation rules, the result should be AAG type (wild type).

[0125] ROX channel: The temperature at which the melting peak of PROS1 C.586A>G appears is 59.55°C. According to the interpretation rules, the result should be AA type (wild type).

[0126] CY5 channel: The temperature at which the melting peak of SERPINC1 C.1306G>A appears is 63.89°C. According to the interpretation rules, the result should be GG type (wild type).

[0127] like Figure 3 As shown, in the FAM channel: the temperatures at which the melting peaks of F5 G1601A appear are 60.56°C and 66.09°C. According to the interpretation rules, the result should be GA type (heterozygous mutation).

[0128] ROX channel: The melting peak temperature of PROS1 C.701A>G is 57.23℃ and 61.78℃. According to the interpretation rules, the result should be AG type (heterozygous mutation).

[0129] CY5 channel: The melting peak temperature of SERPINC1 C.391C>T is 57.70℃ and 64.46℃. According to the interpretation rules, the result should be CT type (heterozygous mutation).

[0130] Therefore, the present invention provides a genetic thrombophilia gene detection kit and its application, which realizes high-throughput typing of 12 SNP sites through multi-channel fluorescence PCR and melting curve analysis technology. The kit has the advantages of simple operation, high sensitivity, low cost, etc., and is suitable for early clinical screening and precise intervention.

[0131] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. A genetic detection kit for hereditary thrombophilia, characterized in that: It includes 3 tubes of PCR reaction solution, each tube of PCR reaction solution contains specific primers and fluorescent probes, covering 11 SNP sites.

2. A hereditary thrombophilia gene detection kit according to claim 1, characterized in that: The three tubes of PCR reaction solution include: PCR reaction solution 1, PCR reaction solution 2 and PCR reaction solution 3; The SNP sites detected by PCR reaction solution 1 included F11 C.56-282T>C, THBD C.151G>T, PROS1 C.1351C>T, and SERPINC1 C.218C>T; The SNP sites detected by PCR reaction solution 2 included F11 C.481188C>T, PROC C.574-576del, PROS1 C.586A>G, ​​and SERPINC1 C.1306G>A; The SNP sites detected by PCR reaction solution 3 include F5 G1601A, PROS1 C.701A>G, and SERPINC1 C.391C>T.

3. A hereditary thrombophilia gene detection kit according to claim 1 or 2, characterized in that: The specific primers and fluorescent probe sequences in the PCR reaction solution 1 include: Specific primers F11-F and F11-R and fluorescent probe F11-12 designed for the F11 C.56-282T>C gene, the sequence number of F11-F is shown in SEQ ID NO.1, the sequence number of F11-R is shown in SEQ ID NO.2, and the sequence number of F11-12 is shown in SEQ ID NO.3; and specific primers THB-F, TH BR and fluorescent probe THBD12 designed for THBD C.151G>T gene, the sequence number of THB-F is shown in SEQ ID NO.4, the sequence number of THB-R is shown in SEQ ID NO.5, and the sequence number of THBD12 is shown in SEQ ID NO.6; and specific primers P1351-F11 and P135C-R and fluorescent probe P1351C>T designed for PROS1 C.1351C>T gene, the sequence number of P1351-F11 is shown in SEQ ID NO.7, the sequence number of P135C-R is shown in SEQ ID NO.8, and the sequence number of P1351C>T is shown in SEQ ID NO.9; And specific primers 218C, 218R and fluorescent probe S218C>T designed for the SERPINC1 C.218C>T gene, the sequence number of 218C is shown in SEQ ID NO.10, the sequence number of 218R is shown in SEQ ID NO.11, and the sequence number of S218C>T is shown in SEQ ID NO.

12.

4. A hereditary thrombophilia gene detection kit according to claim 1 or 2, characterized in that: The specific primers and fluorescent probe sequences in PCR reaction solution 2 include: Specific primers F11-2F, F11-2R and fluorescent probe F11-21 designed for F11 C.481188C>T gene, the sequence number of F11-2F is shown in SEQ ID NO.13, the sequence number of F11-2R is shown in SEQ ID NO.14, and the sequence number of F11-21 is shown in SEQ ID NO.15; and specific primers PRO-F, PROC2-R and fluorescent probe PROC21 designed for PROC C.574-576del gene, PRO-F sequence number is shown in SEQ ID NO.16, PROC2-R sequence number is shown in SEQ ID NO.17, PROC21 sequence number is shown in SEQ ID NO.18; and specific primers P586-F13 and 586R designed for PROS1 C.586A>G gene and fluorescent probe P586A>G, ​​the sequence number of P586-F13 is shown in SEQ ID NO.19, the sequence number of 586R is shown in SEQ ID NO.20, and the sequence number of P586A>G is shown in SEQ ID NO.21; And specific primers S1306F11, 1306R and fluorescent probe S1306-Pb12 designed for the SERPINC1 C.1306G>A gene, the sequence number of S1306F11 is shown in SEQ ID NO.22, the sequence number of 1306R is shown in SEQ ID NO.23, and the sequence number of S1306-Pb12 is shown in SEQ ID NO.

24.

5. A hereditary thrombophilia gene detection kit according to claim 1 or 2, characterized in that: The specific primers and fluorescent probe sequences in the PCR reaction solution 3 include: Specific primers F5-F and F5-R and fluorescent probe F51 designed for F5 G1601A gene, the sequence number of F5-F is shown in SEQ ID NO.25, the sequence number of F5-R is shown in SEQ ID NO.26, and the sequence number of F51 is shown in SEQ ID NO.27; and specific primers 701F and P701-R12 designed for PROS1 C.701A>G gene and fluorescent probe P701A>G, the sequence number of 701F is shown in SEQ ID NO.28, the sequence number of P701-R12 is shown in SEQ ID NO.29, and the sequence number of P701A>G is shown in SEQ ID NO.30; And specific primers 391F, S391R12 and fluorescent probe S391-Pb11 designed for the SERPINC1 C.391C>T gene, the sequence number of 391F is shown in SEQ ID NO.31, the sequence number of S391R12 is shown in SEQ ID NO.32, and the sequence number of S391-Pb11 is shown in SEQ ID NO.

33.

6. A use of the hereditary thrombophilia gene detection kit according to any one of claims 1 to 5, characterized in that: Application in the diagnosis of inherited thrombophilia for non-medical purposes, assessment of thrombotic risk, or personalized medication guidance.

Images