System for identifying whether a person is in an active state of tuberculosis infection from gene expression in peripheral blood and uses thereof
By detecting the expression levels of specific genes in peripheral blood and using logistic regression models, the problems of insufficient sensitivity and specificity of existing TB detection methods were solved, and efficient screening and diagnosis of high-risk TB populations were achieved.
Patent Information
- Application Number
- CN202510601176.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-12
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2045-05-12
AI Technical Summary
In existing technologies, sputum smear detection of TB has low sensitivity, and the culture method conditions are harsh and the cycle is long. Sputum-based molecular biology detection methods are not effective for children and HIV-infected people, and the positive rate of extrapulmonary tuberculosis detection is low, which cannot effectively screen high-risk groups for TB.
By detecting the expression levels of FCGR1A, FCGR1B, GBP5, GBP6, CXCL10 and KLF2 genes in peripheral blood and combining them with a logistic regression model, a TB infection prediction scoring model was constructed to accurately identify active tuberculosis infection.
It achieved high-sensitivity (91.18%) and high-specificity (86.84%) screening for high-risk TB populations, meeting the testing requirements of the World Health Organization and ensuring the effective application of subsequent confirmation methods.
Smart Images

Figure SMS_2 
Figure SMS_3 
Figure SMS_4
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of disease detection, and particularly relates to a system for identifying whether a human is in an active tuberculosis infection state from gene expression of peripheral blood and application thereof. BACKGROUND
[0002] Traditional TB detection has low sensitivity of sputum smear; and although culture has higher sensitivity, the culture condition is relatively harsh and the culture period is long. The method for detecting TB based on molecular biology directly detects Mycobacterium tuberculosis from sputum; young infected persons and HIV infected persons often cannot produce sputum; detection of tuberculosis from sputum is often accompanied by symptoms of cough and sputum, and part of the tuberculosis patients have non-typical clinical symptoms and are already infectious; in addition, the positive rate of the molecular biology method for directly detecting tuberculosis is very low. According to the goal of ending tuberculosis by 2035 published by the World Health Organization, a non-sputum-based TB diversion method is required, which requires a minimum of 90% sensitivity and 70% specificity to screen out TB high-risk groups, and then a diagnosis method is used. The method for screening TB high-risk groups at present is concentrated in blood samples and urine samples of humans. Gene expression in human blood samples shows good screening performance in existing studies. SUMMARY
[0003] Therefore, in order to solve the above technical problems, the present application provides a system for identifying whether a human is in an active tuberculosis infection state from gene expression of peripheral blood, which is used for simultaneously detecting expression levels of human FCGR1A gene, FCGR1B gene, GBP5 gene, GBP6 gene, CXCL10 gene and KLF2 gene, so as to determine whether the human is in an active tuberculosis infection state.
[0004] In one embodiment, the primer and probe sequences for simultaneously detecting human FCGR1A gene, FCGR1B gene, GBP5 gene, GBP6 gene, CXCL10 gene and KLF2 gene are as follows: the upstream primer, the downstream primer and the probe sequence for detecting FCGR1A gene are respectively SEQ ID NO. 1: GCAAGTGGACACCACAA, SEQ ID NO. 2: CCATTGAGAAACCACTGTGTA, and SEQ ID NO. 3: AAGAGGAAACCGTAACCTTGCA.
[0005] The upstream primer, downstream primer and probe sequence for detecting the FCGR1B gene are SEQ ID NO. 4: GTTGATGGGCAAGTGGAC, SEQ ID NO. 5: CCTCACAGTGCAAGGTTAT, and SEQ ID NO. 6: CTCCATGGGTCAGCGTGTTC, respectively.
[0006] The upstream primer, downstream primer and probe sequence for detecting the GBP5 gene are SEQ ID NO. 7: GGCAACTTGTCACACCAGAT, SEQ ID NO. 8: GAACTCTTTGATCACTACCTTGCT, and SEQ ID NO. 9: ACCTGGAGAATTCCCTAAGGCCA, respectively.
[0007] The upstream primer, downstream primer and probe sequence for detecting the GBP6 gene are SEQ ID NO. 10: GCGATGTGGAAAAGGGTGA, SEQ ID NO. 11: TTGATGGTGCTCATGCTGTTG, and SEQ ID NO. 12: CCCTGGCTGTGCTCCTGTGC, respectively.
[0008] The upstream primer, downstream primer and probe sequence for detecting the CXCL10 gene are SEQ ID NO. 13: TCTAAGTGGCATTCAAGGAGTA, SEQ ID NO. 14: CCTTGGATTAACAGGTTGATTAC, and SEQ ID NO. 15: CTCTAGAACTGTACGCTGTACCTGC, respectively.
[0009] The upstream primer, downstream primer and probe sequence for detecting the KLF2 gene are SEQ ID NO. 34: GCACGCACACAGGTGAGAA, SEQ ID NO. 35: ATCGCACAGATGGCACT, and SEQ ID NO. 36: TCACGCGCCACTACCGAAAGC, respectively.
[0010] In an embodiment, the system is further used for detecting the expression level of the reference gene HPRT1, and the upstream primer, downstream primer and probe sequence for detecting the human reference gene HPRT1 are as follows: SEQ ID NO. 37: TGACACTGGCAAAACAATGCA, SEQ ID NO. 38: GGTCCTTTTCACCAGCAAGCT, and SEQ ID NO. 39: CCATCTTTGGATTATACTGCCTGACCAAGGAA.
[0011] In one embodiment, the present invention provides use of the above system in preparing a product for identifying whether a human is in an active tuberculosis infection state.
[0012] In one embodiment, the present invention provides primers, probes or a combination thereof, which are used to detect the expression levels of human FCGR1A gene, FCGR1B gene, GBP5 gene, GBP6 gene, CXCL10 gene and KLF2 gene simultaneously, thereby determining whether the human is in an active tuberculosis infection state.
[0013] The present invention analyzes a group of genes that are highly expressed in the peripheral blood of people with active tuberculosis infection: BATF2, FCGR1A, FCGR1B, UBE2L6, GBP5, GBP6, SCARF1, CCR6, CXCR5, CXCL10, DUSP3, and KLF2. Then, patients initially diagnosed with tuberculosis infection, other infectious diseases, and autoimmune diseases are collected as a control group; finally, the mRNA expression of 6 genes is screened out. The mRNA of these 6 genes can accurately identify whether the person is in an active tuberculosis infection state from the gene expression in the peripheral blood. The sensitivity of the 6-gene combination detection is 91.18%, and the specificity reaches 86.84%. In accordance with the goal of ending tuberculosis by 2035 issued by the World Health Organization, the method of the present invention can screen out the high-risk population for TB and then use the diagnosis method to confirm the diagnosis. DETAILED DESCRIPTION
[0014] By analyzing peripheral blood gene expression data from both active and non-TB-infected individuals, researchers retrieved data from public databases or published literature and identified a panel of genes highly expressed in the peripheral blood of individuals with active TB infection: BATF2, FCGR1A, FCGR1B, UBE2L6, GBP5, GBP6, SCARF1, CCR6, CXCR5, CXCL10, DUSP3, and KLF2. Primers and probes were designed for each gene's mRNA expression, as detailed in Table 1 below. At least one of the primers and probes spanned an intron to ensure that reverse transcription amplification of the mRNA was not affected by genomic DNA. A control group of patients newly diagnosed with TB infection, other infectious diseases, and autoimmune diseases was then recruited. Finally, the mRNA expression of six genes was screened, and an arithmetic model was constructed to calculate the expression of these six mRNAs. This generated a final TB infection prediction score model. This score accurately identifies individuals with active TB infection based on peripheral blood gene expression.
[0015] Table 1
[0016] .
[0017] The qPCR reaction system of the above primer probe uses the premixed qRT-PCR reaction system produced by Nuoyuan Company. The specific reaction system is shown in Table 2.
[0018] Table 2
[0019] qPCR reaction system Composition 2x qPCR premix 10 μl Upstream primer of HPRT1 gene 0.25 μM (final concentration) Downstream primer of HPRT1 gene 0.25 μM (final concentration) HPRT1 gene probe 0.15 μM (final concentration) Upstream primer of target gene 0.25 μM (final concentration) Downstream primer of target gene 0.25 μM (final concentration) Target gene probe 0.15 μM (final concentration) Nucleic acid template 5 μl
[0020] Supplement water to 20 ml
[0021] The reaction conditions are shown in Table 3.
[0022] Table 3
[0023]
[0024] 60℃ Collect fluorescence. Record the Ct values of the internal reference gene and the target gene.
[0025] Using 68 blood samples infected with TB and 152 blood samples infected with non-TB, the expression abundance of the above 12 genes was detected by reverse transcription fluorescent quantitative PCR, and the relative expression value of each gene was obtained by comparing with the internal reference gene HPRT1; then the gene relative expression value was input into the logistic regression calculation model, different genes were combined, each gene was assigned a judgment parameter, and the TB infection and non-TB infection samples in the training data were distinguished with the maximum accuracy.
[0026] The primers of each gene and the internal reference gene HPRT1 were detected, the probe of the target gene was labeled with FAM fluorescent dye, and the probe of the HPRT1 gene was labeled with VIC fluorescent dye; according to the Ct values of the target gene and the HPRT1 gene, the relative expression value of the target gene relative to HPRT1 was obtained = 2 (HPRT1的Ct-靶基因的Ct) *100, and then an expression score was obtained according to the relative abundance of each target gene, and then the probability p of the sample suffering from TB was obtained according to the Score p = 1-1 / (1+EXP(-score)); the p value <=0.20 was judged as non-TB infection, and the p value >0.20 was judged as TB infection.
[0027] Here, the top 5 gene combinations with the highest accuracy are listed to obtain the Score scoring formula. The number in front of each target gene in the calculation formula is calculated by the logistic regression model according to the known clinical sample grouping. For example, the relative expression abundance of GBP5 according to the Ct value is relatively high, and the logistic regression model finds that the coefficient in front of the GBP5 gene is relatively small during the calculation process, so that the score can distinguish the TB infection group from the non-TB infection group, and the p value is calculated again through the Score, and then the sensitivity and specificity of TB infection are judged according to the p value.
[0028] Combination 1: FCGR1A + FCGR1B + GBP5 + GBP6 + CXCL10 + KLF2 combination
[0029] Score = 4.1 - 0.0016*FCGR1A - 0.0086*FCGR1B - 0.0001*GBP5 + 0.0019*BP6 - 0.0062*CXCL10 + 0.002*KLF2
[0030] Combination 2: BATF2 + FCGR1A + UBE2L6 + DUSP3 combination:
[0031] Score = 3.6 - 0.0028*BATF2 - 0.0102*FCGR1A - 0.0082*UBE2L6 + 0.0021*DUSP3
[0032] Combination 3: FCGR1A + FCGR1B + GBP5 + KLF2 combination:
[0033] Score = 2.5 - 0.0036*FCGR1A - 0.0232*FCGR1B - 0.0132*GBP5 - 0.0018*KLF2
[0034] Combination 4: FCGR1A + GBP5 + CCR6 + CXCR5 + KLF2 combination
[0035] Score = 3.9 - 0.0028*FCGR1A - 0.0102*GBP5 + 0.0008*CCR6 + 0.0011*CXCR5 - 0.0023*KLF2
[0036] Combination 5: FCGR1A + UBE2L6 + GBP5 + SCARF1 + CXCL10 + KLF2 combination
[0037] Score = 5.2 - 0.0045*FCGR1A - 0.021*UBE2L6 - 0.0102*GBP5 + 0.0011*SCARF1 - 0.0013*CXCL10 - 0.021*KLF2
[0038] The score values and p values calculated by combination 1 of 68 cases of clinical tuberculosis infection and 152 cases of non-tuberculosis infection are shown in Tables 4-1 to 4-7.
[0039] Table 4-1
[0040]
[0041] Table 4-2
[0042]
[0043] Table 4-3
[0044]
[0045] Table 4-4
[0046]
[0047] Table 4-5
[0048]
[0049] Table 4-6
[0050]
[0051] Table 4-7
[0052] .
[0053] The sensitivity and specificity of combination 1 were calculated according to the Score and p-value in the above table, and the results are shown in the following table; similarly, for combination 2, combination 3, combination 4 and combination 5, the Score and p-value were calculated (the original data for calculating the Score and p-value are not shown in this application), so as to obtain the corresponding sensitivity and specificity data. The sensitivity and specificity results of the five combinations for 68 cases of clinical tuberculosis infection and 152 cases of non-tuberculosis infection are shown in Table 5.
[0054] Table 5
[0055]
[0056] The sensitivity and specificity of tuberculosis infection according to the p-value are as follows: only combination 1 (FCGR1A+FCGR1B+GBP5+GBP6+CXCL10+KLF2) meets the threshold of the minimum 90% sensitivity and 70% specificity required by the TB diversion method based on non-sputum issued by the World Health Organization.
[0057] It is easy for those skilled in the art to understand that the above advantageous modes can be freely combined and superimposed without conflict.
[0058] The above is only a preferred embodiment of the present application, and is not intended to limit the present application. Any modification, equivalent replacement and improvement made within the spirit and principle of the present application shall be included in the protection scope of the present application. The above is only a preferred embodiment of the present application, and it should be pointed out that, for ordinary skilled in the art, without departing from the technical principles of the present application, a number of improvements and modifications can be made, and these improvements and modifications should be considered as the protection scope of the present application.
Claims
1. A system for identifying whether a person is in an active tuberculosis infection state based on gene expression in peripheral blood, characterized in that: The system is used to simultaneously detect the expression levels of human CGR1A gene, FCGR1B gene, GBP5 gene, GBP6 gene, CXCL10 gene and KLF2 gene, thereby determining whether a person is in an active tuberculosis infection state; the system includes primers and probes for detecting human CGR1A gene, FCGR1B gene, GBP5 gene, GBP6 gene, CXCL10 gene and KLF2 gene, and the primers and probes are as follows: 。 2. The system according to claim 1, wherein: The system also includes primers and probes for detecting the expression level of the internal reference gene HPRT1, and the primers and probes are as follows: 。 3. Use of the system according to any one of claims 1-2 in the preparation of a product for identifying whether a person is in an active tuberculosis infection state.
4. Use of primers, probes or a combination thereof in the preparation of a system for identifying whether a person is in an active tuberculosis infection state from gene expression in peripheral blood, characterized in that: The primers, probes or a combination thereof are used to detect the expression levels of human CGR1A gene, FCGR1B gene, GBP5 gene, GBP6 gene, CXCL10 gene and KLF2 gene, thereby determining whether a person is in an active tuberculosis infection state.
5. The use according to claim 4, characterized in that The primers and probes used to detect human CGR1A gene, FCGR1B gene, GBP5 gene, GBP6 gene, CXCL10 gene, and KLF2 gene are as follows: 。
Citation Information
Patent Citations
Marker for diagnosing tuberculosis infection and application thereof
CN116609530A
Construction method and application of bacterial positive active pulmonary tuberculosis risk assessment model
CN116994646A
Method of Detecting Active Tuberculosis Using Minimal Gene Signature
US20190323065A1