Detection method and application of liver cancer gene mutation

By designing a primer-probe combination for exon deletion mutations of TP53 gene No. 7, and combining digital PCR technology, the problems of complex detection, high cost and low sensitivity in the existing technology are solved, and high sensitivity and specific liver cancer gene mutation detection is achieved, supporting early screening and personalized treatment of liver cancer.

CN120099179APending Publication Date: 2025-06-06SHANDONG BOHONG GENE TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510269149.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-07
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The existing liver cancer gene detection technology has problems such as complex operation, long detection cycle, high cost, different sensitivity and specificity, and it is difficult to meet the needs of early screening of liver cancer and personalized treatment.

Method used

A primer-probe combination was designed to target exon 7 deletion mutations of TP53 gene, combined with digital PCR technology, and through the design of specific primers and fluorescent probes, the precise identification of specific mutation sites of TP53 gene was ensured.

Benefits of technology

The sensitivity and specificity of liver cancer gene mutation detection have been improved, and the sensitivity of early screening of liver cancer has reached 93.33%, providing an important basis for early detection and intervention of liver cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099179A_ABST
    Figure CN120099179A_ABST
Patent Text Reader

Abstract

The invention discloses a liver cancer gene mutation detection method and application, and belongs to the technical field of liver cancer gene detection. The invention finds that deletion mutation of the No.7 exon of the TP53 gene is closely related to the occurrence of liver cancer for the first time, and the research result of the invention can make the early screening sensitivity of liver cancer reach 93.33%, and has important significance for the early detection and intervention of liver cancer. The specific primer pair and the fluorescent probe for digital PCR detection are designed for deletion mutation of the No.7 exon of the TP53 gene, and accurate recognition of specific mutation sites of the TP53 gene is ensured by combining high-fidelity polymerase. According to the invention, the designed detection specific primer is combined with a digital PCR technology, so that the sensitivity of liver cancer gene mutation detection is improved, and the accuracy and reliability of experiments are ensured.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of liver cancer gene detection, and in particular relates to a method for detecting liver cancer gene mutation and its application. Background Art

[0002] Liver tumors are the fifth most common cancer in men and the ninth most common cancer in women worldwide, with the second highest mortality rate among malignant tumors. About 70%-90% of liver tumors worldwide are hepatocellular carcinoma (HCC). Most HCCs are related to chronic infection with hepatitis B virus (HBV), and about 350 million people worldwide are chronically infected with HBV. Currently, the main methods of HCC treatment are surgical intervention and chemotherapy. However, surgical resection is not suitable for most patients due to the metastasis of early tumors, and the treatment effects of drug data and palliative treatment methods on hepatocellular carcinoma are also unsatisfactory.

[0003] In recent years, with the development of molecular biology and genetics, people have found that the occurrence of liver cancer is closely related to a variety of gene mutations. For example, ALK gene rearrangement, KRAS gene mutation, etc., the abnormal expression or mutation of these genes is closely related to the occurrence, development and prognosis of liver cancer. Therefore, by detecting the mutation status of these genes, it can provide important basis for the early diagnosis, treatment selection and prognosis evaluation of liver cancer.

[0004] Existing gene detection technologies include PCR amplification, fluorescence in situ hybridization (FISH), immunohistochemistry, etc. However, these methods have certain limitations, such as complex operation, long detection cycle, high cost, and different sensitivity and specificity, which restrict the early diagnosis and personalized treatment of liver cancer. Summary of the invention

[0005] In view of the deficiencies of the prior art, the purpose of the present invention is to provide a method and application for detecting liver cancer gene mutations, which has the advantages of simple operation, low cost, high sensitivity and specificity, and to a certain extent overcomes the deficiencies of the prior art for early screening of liver cancer.

[0006] To achieve the above object, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a primer-probe combination for detecting liver cancer gene mutations, the primer-probe combination comprising: a specific primer pair and a fluorescent probe;

[0008] The specific primer pair and fluorescent probe are designed for the deletion mutation of exon 7 of the TP53 gene, and the nucleotide sequence of the specific primer pair is shown in SEQ ID NO.1-SEQ ID NO.2;

[0009] The fluorescent probe is a single-stranded DNA labeled with a fluorescent group FAM at one end and MGB-NFQ at the other end, and the nucleotide sequence of the fluorescent probe is shown in SEQ ID NO.3;

[0010] In a second aspect, the present invention provides the use of the above primer-probe combination in the preparation of a product for visual detection of early liver cancer.

[0011] In a third aspect, the present invention provides a kit for detecting liver cancer gene mutations, wherein the kit contains the above-mentioned primer-probe combination.

[0012] The kit also includes: dNTPs and high-fidelity polymerase.

[0013] In a fourth aspect, the present invention provides a method for detecting liver cancer gene mutation based on the above kit, comprising the following steps:

[0014] (1) Collecting a peripheral blood sample from the patient, centrifuging the collected blood sample at a relative centrifugal force of 1500g-2000g for 5-10 minutes at room temperature to separate plasma and blood cells, and extracting DNA from the plasma;

[0015] (2) The extracted DNA is diluted and used as a template, a digital PCR reaction system is configured to perform digital PCR amplification, and the fluorescence signal is collected.

[0016] Preferably, to ensure the quality of the extracted DNA, a purification operation may be performed during the DNA extraction process.

[0017] The purification operation may use binding buffer, magnetic beads, washing buffer and elution buffer. The binding buffer is used to promote the binding of circulating tumor DNA to the solid phase carrier (magnetic beads) and contains a high salt concentration to enhance the interaction between DNA and the carrier. The surface of the magnetic beads is coated with polyethyleneimine (PEI), a chemical substance that can specifically bind to circulating tumor DNA, and is used to capture circulating tumor DNA from plasma. The washing buffer is used to remove impurities and proteins that are not specifically bound during the binding process. The elution buffer is used to release the bound circulating tumor DNA from the magnetic beads and contains a low salt concentration and a mild surfactant Triton X-100.

[0018] In step (2), the DNA dilution includes the following steps: a. Determine the initial concentration of the extracted tumor DNA by ultraviolet spectrophotometer or fluorescence quantitative method; b. Calculate the dilution multiple required to achieve this goal based on the quantitative results of a maximum of one DNA molecule and circulating tumor DNA per reaction unit; c. Perform fine dilution using a precise micropipette and diluent according to the calculated dilution ratio, ensuring that all operations are performed under sterile conditions; d. Perform a preliminary experiment or a test run using a small amount of sample to check whether the diluted circulating tumor DNA concentration is suitable for digital PCR analysis. If not, adjust the dilution ratio based on the results.

[0019] The reaction system includes a digital PCR chip or a microfluidic device with at least 10,000 independent micro-reaction units to achieve high-throughput single-molecule detection.

[0020] In step (2), the degree of DNA dilution is such that there is at most one DNA molecule in each reaction unit in the digital PCR.

[0021] In step (2), the digital PCR amplification conditions are: denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 60 seconds, for a total of 40 cycles.

[0022] In step (2), the standard for collecting the fluorescence signal and interpreting the result is:

[0023] The fluorescent signals collected by digital PCR analysis software are used to calculate the number of positive and negative reaction units and determine the frequency of target gene mutations. If a deletion mutation is detected in exon 7 of the TP53 gene, it indicates that the patient has liver cancer, otherwise it does not.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] 1. The TP53 gene is an important tumor suppressor gene, and its mutation is associated with a variety of cancers. Through long-term analysis and detection of blood samples from liver cancer patients, the present invention has found for the first time that deletion mutations in exon 7 of the TP53 gene are closely related to the occurrence of liver cancer. Early screening of liver cancer has always been a challenge. The sensitivity of commonly used markers such as alpha-fetoprotein (AFP) for early screening is approximately between 40% and 60%. The research results of the present invention can make the sensitivity of early screening of liver cancer reach 93.33%, which is of great significance for early detection and intervention of liver cancer.

[0026] 2. This application designs specific primer pairs and fluorescent probes for digital PCR detection for deletion mutations in exon 7 of the TP53 gene, combined with high-fidelity polymerase, to ensure accurate identification of specific mutation sites of the TP53 gene. Digital PCR is a highly sensitive nucleic acid detection technology that can detect gene mutations, especially in the detection of low-frequency mutations. This application combines the designed detection-specific primers with digital PCR technology to improve the sensitivity of liver cancer gene mutation detection and ensure the accuracy and reliability of the experiment. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 It is a schematic diagram of the process of the present invention. DETAILED DESCRIPTION

[0028] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0029] The following detailed description is for illustrative purposes only and is intended to provide further explanation of the present application, rather than to limit the scope of the present invention.

[0030] Embodiment 1:

[0031] Specific primers and fluorescent probes were designed for the exon 7 deletion mutation of the TP53 gene. The specific primers had an upstream primer and a downstream primer. The sequence of the upstream primer was: 5'-CCTGGATTCAGGAAGAGCT-3' (SEQ ID NO. 1);

[0032] The sequence of the downstream primer is: 5'-CTCCTCGAATGTCAGCAGCA-3' (SEQ ID NO. 2);

[0033] The sequence of the fluorescent probe is:

[0034] 5'-(6-FAM)CCACACAGCAAGTGCAAGTCCACGTA(MGB-NFQ)-3' (SEQ ID NO. 3).

[0035] Embodiment 2:

[0036] (1) Collect peripheral blood samples from patients, with the sampling volume controlled between 5 and 10 ml. Centrifuge the collected blood samples at a relative centrifugal force of 1500 g to 2000 g for 5 to 10 minutes at room temperature to separate plasma and blood cells, and extract DNA from the plasma;

[0037] (2) The extracted DNA was diluted as a template until there was at most one DNA molecule in each reaction unit in the digital PCR. The digital PCR reaction system (dNTPs: 0.15 μL, high-fidelity polymerase 1 μL, buffer 1.5 μL, upstream primer 1.5 μL, downstream primer 1.5 μL, DNA 3 μL, ultrapure water 6.35 μL) was prepared and subjected to the following reaction conditions: denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 60 seconds for 40 cycles for digital PCR amplification, and the fluorescence signal was collected.

[0038] The fluorescent signals collected by digital PCR analysis software are used to calculate the number of positive and negative reaction units and determine the frequency of target gene mutations. If a deletion mutation is detected in exon 7 of the TP53 gene, it indicates that the patient has liver cancer, otherwise it does not.

[0039] Embodiment 3:

[0040] In the early stage of this embodiment, blood samples from 50 confirmed liver cancer patients and 50 healthy people were collected. The collected blood samples were used to detect the deletion mutation in exon 7 of the TP53 gene using the primer probe combination provided in the present application. It was found that the deletion mutation in exon 7 of the TP53 gene was detected in the blood samples of the 50 confirmed liver cancer patients; while the deletion mutation in exon 7 of the TP53 gene was not detected in the blood samples of the healthy people. The test results show that the deletion mutation in exon 7 of the TP53 gene is indeed closely related to liver cancer.

[0041] Furthermore, blood samples from 150 patients suspected of liver cancer were collected, and the deletion mutation at exon 7 of the TP53 gene was detected in the collected blood samples using the primer probe combination provided in this application. 112 cases of liver cancer were detected, and 150 patients suspected of liver cancer were followed up continuously, and 120 cases of liver cancer were later confirmed. According to the test results, the sensitivity of the detection method provided in this application for early positive screening of liver cancer reached 93.33%, and the research results are of great significance for early detection and intervention of liver cancer.

[0042] Table 1: Positive detection rate of liver cancer

[0043]

[0044] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A primer-probe combination for detecting liver cancer gene mutations, characterized in that: The primer-probe combination includes: a specific primer pair and a fluorescent probe; The nucleotide sequences of the specific primer pairs are shown in SEQ ID NO.1-SEQ ID NO.2; The fluorescent probe is a single-stranded DNA with a fluorescent group FAM labeled at one end and MGB-NFQ labeled at the other end. The nucleotide sequence of the fluorescent probe is shown in SEQ ID NO.

3.

2. Use of the primer-probe combination of claim 1 in the preparation of a product for visual detection of early liver cancer.

3. A kit for detecting liver cancer gene mutations, characterized in that: The kit contains the primer-probe combination of claim 1.

4. The kit according to claim 3, characterized in that The kit also includes: dNTPs and high-fidelity polymerase.

5. A method for detecting liver cancer gene mutation based on the kit according to claim 3 or 4, characterized in that: The steps include: (1) Collecting a peripheral blood sample from the patient, centrifuging the collected blood sample at room temperature to separate plasma and blood cells, and extracting DNA from the plasma; (2) The extracted DNA is diluted and used as a template, a digital PCR reaction system is configured to perform digital PCR amplification, and the fluorescence signal is collected.

6. The method for detecting liver cancer gene mutation according to claim 5, characterized in that: In step (2), the degree of DNA dilution is such that there is at most one DNA molecule in each reaction unit in the digital PCR.

7. The method for detecting liver cancer gene mutation according to claim 5, characterized in that: In step (2), the digital PCR amplification conditions are: denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 60 seconds, for a total of 40 cycles.

8. The method for detecting liver cancer gene mutation according to claim 5, characterized in that: In step (2), the standard for collecting the fluorescence signal and interpreting the result is: The fluorescent signals collected by digital PCR analysis software are used to calculate the number of positive and negative reaction units and determine the frequency of target gene mutations. If a deletion mutation is detected in exon 7 of the TP53 gene, it indicates that the patient has liver cancer, otherwise it does not.