A SNP molecular marker related to body weight trait of local chicken and application thereof

Abstract

The application provides a SNP molecular marker related to a body weight trait of a local chicken and an application thereof, and belongs to the technical field of molecular biology and breeding. The SNP molecular marker is located at the 77325222th nucleotide of chromosome 4 in the international chicken reference genome GRCg6a Primary Assembly version, has C / T polymorphism, and the 18-week average body weight of an individual with a CT or TT genotype is significantly higher than that of an individual with a CC genotype. The application further provides a primer combination for detecting the above SNP marker and an application thereof. The SNP molecular marker and the primer combination can be used to establish a high-efficiency and accurate molecular marker-assisted breeding technology for the body weight trait of the local chicken, so that the body weight trait of the local chicken is effectively improved, and the high-quality development of the local chicken industry is promoted.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular biology and breeding technology, and particularly relates to a SNP molecular marker related to the body weight trait of local chicken and application thereof. BACKGROUND

[0002] The poultry industry is not only a pillar industry of China's agriculture, but also an important industry related to the national economy and social stability. With the development of social economy and the improvement of people's living standards, the market demand for diversified, characteristic and personalized poultry products is growing rapidly, and the consumption demand for high-quality characteristic local chicken products is increasing. China's local chicken germplasm resources are rich in characteristics, with excellent meat quality, and also have the advantages of low requirement for feeding environment, strong disease resistance and high survival rate. However, due to the lack of high-intensity systematic breeding, there are defects such as slow growth, low body weight and poor egg production performance, which leads to low production efficiency and greatly restricts the high-quality development of the local chicken industry. Jianghan chicken, as a local characteristic chicken breed in Hubei Province, has the advantages of roughage tolerance, strong disease resistance and tender meat, but its growth rate is significantly lower than that of commercial broiler breeds (such as white feather chicken). According to the 2023 Hubei Province Livestock and Poultry Genetic Resources Survey data, the average body weight of adult Jianghan chicken is only 1.2-1.5 kg, which is far lower than the level of white feather chicken at the same period.

[0003] The body weight trait of chicken reflects the growth performance of chicken, which is an important economic trait. The genetic improvement of such traits directly affects the economic benefits, and such traits have always been the target traits in chicken breeding. In addition, the body weight and uniformity of 18-week-old chicken flock are key factors to determine the egg production rate and the duration of the egg production peak. In order to improve the body weight trait of chicken, breeding methods are generally used to select individuals with fast growth rate, but traditional breeding methods are through family selection, which is slow and seriously limits the genetic improvement of body weight trait. Therefore, it is urgent to identify some key molecular markers, and then use molecular marker assisted selection or genome selection to improve the breeding of related traits. SUMMARY

[0004] In order to solve the above technical problems, the application provides a SNP molecular marker related to the body weight trait of local chicken and application thereof.

[0005] In order to achieve the above purpose, the following technical scheme is adopted in the application:

[0006] A SNP molecular marker related to the body weight trait of local chicken, which is located at the 77325222th base of chromosome 4 in the international chicken reference genome GRCg6a Primary Assembly version, the 77325222th base is C or T, and the mutation leads to polymorphism.

[0007] The application is based on 490 local breeds Jianghan chicken, by measuring and recording 18 weeks old weight, using SNP typing data obtained by whole genome sequencing for GWAS analysis, further analyzing the GWAS result, finally identifying that the nucleotide site at 77325222 of chromosome 4 is significantly associated with 18 weeks old weight. The research result shows that the polymorphism of the SNP site is C / T, and the 18 weeks old weight of the individual with CT and TT genotype is significantly higher than that of the individual with CC genotype.

[0008] In breeding, the TT genotype is preferred, which can significantly improve the 18 weeks old weight of local chicken.

[0009] Preferably, the nucleotide sequence containing the above-mentioned SNP molecular marker is shown as SEQ ID NO. 3, and the base Y at the 108th position of the sequence is the SNP molecular marker site, Y represents C or T.

[0010] Further, the SNP molecular marker is a fragment containing the base at the 108th position in the nucleotide sequence shown as SEQ ID NO. 3. By detecting the base site of the specific fragment, the genotype of the chicken individual can be distinguished.

[0011] The application provides specific primers for specifically amplifying the above-mentioned molecular marker. In an embodiment of the application, the specific primers include an upstream primer having the nucleotide sequence shown as SEQ ID NO. 1 and a downstream primer having the nucleotide sequence shown as SEQ ID NO. 2.

[0012] Further, the application provides a detection reagent for detecting the molecular marker or a kit containing the detection reagent. Preferably, it includes the above-mentioned specific primers.

[0013] Further, the application also provides the application of the above-mentioned molecular marker or the above-mentioned specific primers or the above-mentioned detection reagent or kit in identifying chicken weight traits or chicken auxiliary breeding. In identification or auxiliary breeding, the molecular marker site genotype TT is selected as the dominant genotype.

[0014] The application also provides a method for detecting the SNP molecular marker related to chicken weight traits as described above, which comprises the following steps:

[0015] (1) obtaining the genomic DNA of each individual of the chicken breed or strain to be detected;

[0016] (2) detecting the genotype of the SNP molecular marker in the genomic DNA;

[0017] (3) selecting the individual with TT genotype, and eliminating the individuals with CC and CT genotypes.

[0018] The method as described above, preferably, in step (1), the genomic DNA of the chicken is DNA extracted from wing vein blood.

[0019] The method as described above, preferably, in step (2), the method of identification employs PCR amplification, and the amplified product is sequenced for typing.

[0020] The SNP molecular marker as described above is used for marker-assisted selection of chicken weight traits.

[0021] The use as described above, preferably, the chicken weight traits are mainly used in 18-week-old weight selection.

[0022] The SNP molecular marker as described above, the primer set, the kit as described above or the method as described above are used in chicken breeding.

[0023] Preferably, the breeding is screening for superior individuals with significantly increased growth rate.

[0024] The SNP molecular marker with TT genotype is selected as a breeder, which has the superior trait of increasing 18-week-old weight.

[0025] The beneficial effects of the present application are:

[0026] The present application provides a SNP molecular marker related to chicken weight traits, which significantly affects the 18-week-old weight of local chickens. By determining the genotype of the polymorphism, it can effectively identify individuals with fast growth rate, providing a detection technique for early selection and improving breeding efficiency. The present application also provides a reliable molecular marker for the selection of local chicken weight traits, which has important significance for genetic improvement of chickens.

[0027] The present application can be used to select TT genotype as a breeder to increase the individual weight of local chickens, which helps to improve the economic benefits of local chicken breeding. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 It is a Manhattan plot of the 18-week-old weight GWAS results in Example 1 of the present application.

[0029] Figure 2 It is the phenotype value of individuals with different genotypes of the SNP in Example 1 of the present application.

[0030] Figure 3 It is a result determination diagram of three genotypes of the designed primer pair in Example 2 of the present application. DETAILED DESCRIPTION

[0031] The application is based on a local resource Jianghan chicken population owned by the applicant team, GWAS research on the body weight trait is carried out by determining and recording the body weight at 18 weeks old, SNP typing data obtained by whole genome sequencing is used, further analysis is carried out on the GWAS result, and a SNP molecular marker significantly associated with the body weight at 18 weeks old is identified. The SNP molecular marker can be used to carry out marker assisted selection on the body weight index at 18 weeks old, early selection is carried out, and breeding efficiency is improved. The application provides a reliable molecular marker detection method for genetic improvement of the body weight trait of local chickens.

[0032] The following examples are used to further illustrate the application, but should not be construed as limiting the application. Modifications or substitutions made to the application without departing from the spirit and essence of the application all belong to the scope of the application.

[0033] If not specifically indicated, the technical means used in the examples are conventional means familiar to those skilled in the art, and unless otherwise specified, the reagents used in the application are analytical pure or above.

[0034] Example 1: Obtaining of SNP site affecting chicken body weight at 18 weeks old

[0035] 1. Test material

[0036] 490 Jianghan chickens of local breed were taken as the research object, the body weight phenotype data of all individuals at 18 weeks old were determined, and the wing vein blood was collected for genomic DNA extraction.

[0037] 2. Test method

[0038] 2.1. DNA extraction

[0039] The DNA extraction adopts the commonly used phenol-chloroform crude extraction method (the phenol-chloroform crude extraction method can be referred to Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual [M]. 2nd Edition. Jin Dongyan, Li Mengfeng. Beijing: Science Press, 1999. 465-467) or other extraction methods recognized as having the same efficiency, and these methods are commonly reported methods.

[0040] 2.2. Chicken whole genome SNP typing method based on whole genome sequencing

[0041] Through whole genome sequencing of 490 individuals, the sequencing depth is 10x, after read alignment, sorting, marker duplication, base quality correction and variation detection, 20.78 million SNP sites are preliminarily identified. The Plink software is used to calculate the individual missing rate, SNP site missing rate and minimum allele frequency MAF, and the quality control standard is formulated, and finally 87.2 million high-quality SNP markers are obtained.

[0042] 2.3、 Whole genome association analysis

[0043] The GWAS analysis of 18-week-old body weight was performed based on the mixed linear model of GEMMA software. The analysis model was as follows:

[0044] y = Wa + Xb + u + e

[0045] Wherein, y represents the trait phenotype value matrix; W represents the covariance matrix, a represents the vector corresponding to the coefficient including the intercept; X represents the SNP genotype vector, b represents the effect size of SNP; u represents the random effect; e represents the error effect.

[0046] The GWAS results are shown in Figure 1 The SNP site (4: 77325222) (C / T) on the 4th chromosome of the international chicken reference genome GRCg6aPrimary Assembly version is the most significantly associated site (P = 2.21 x 10 -11 For the total sample of 490, there are 116 CC, 227 CT and 146 TT, and 1 individual genotype is missing. The specific detection results are shown in Table 1. The research results show that the polymorphism of the SNP site is C / T, and the 18-week-old body weight of the individuals with CT and TT genotypes is significantly higher than that of the individuals with CC genotype, and the results are shown in Figure 2 The TT genotype can be used for breeding selection, and the polymorphic site can be used for marker-assisted selection for 18-week-old body weight trait index, early breeding and improvement of breeding efficiency. It provides a reliable detection basis for genetic improvement of body weight traits of local chickens.

[0047] Table 1 Comparison of 18-week-old body weight phenotypic values of Jianghan chicken individuals with different genotypes

[0048]

[0049] The values in the table are "mean ± standard deviation", and the same row and different lowercase letters represent significant differences (P < 0.05), and the same letters represent no significant difference.

[0050] Example 2 Genotyping identification

[0051] 1. Detection primer design

[0052] According to the SNP site C / T at nucleotide site 77325222 of chromosome 4 obtained in Example 1, a primer combination for detecting the site was designed for PCR detection of the SNP site. The upstream and downstream primers are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively. The amplified product sequence is shown in SEQ ID NO. 3, wherein the base Y at position 108 of the sequence is the SNP site, Y represents C or T, resulting in C / T polymorphism of the site in 18-week-old body weight traits.

[0053] Specifically as follows:

[0054] SEQ ID NO. 1: 5'-GCACATTCTGTATCCCTG-3'

[0055] SEQ ID NO. 2: 5'-TCCTTCTGCCACTTATTT-3'

[0056] SEQ ID NO. 3: GCACATTCTGTATCCCTGGCACAGAGCAGGCGCTCAGAGATTGCCATCCTCAAAGTAAAATGGTAGTTCTAGAGGAATATCAGGGTCAGATGGAAAGTCCAGGTGTGYATCAGGTAGCCTATGGCATGCTGACAGGTAACACTGCCCAATAGTGGATTTTCTGGGGAAATAAGTGGCAGAAGGA

[0057] 2, DNA template

[0058] According to the whole genome DNA sequencing results, the genomic DNA of three individuals with CC, CT and TT genotypes of SNP site was selected as the template.

[0059] 3, PCR amplification of target fragment

[0060] The PCR reaction system was 20 μL: r-Taq 0.1 µL, 10×Buffer 2 µL, dNTP Mix 1.6 µL, two pairs of upstream and downstream primers (10 µmol / L) 1.0 uL each, DNA template 2.0 µL (50 ng / uL), ddH2O 12.3 uL. The PCR reaction program was: 95 °C pre-denaturation for 3 min, 95 °C denaturation for 30 s, annealing at 58 °C for 30 s, 72 °C extension for 30 s, a total of 35 cycles; 72 °C for 5 min, 4 °C storage.

[0061] 4, sequence sequencing and identification

[0062] PCR amplified products were sequenced by Sanger sequencing at Okbio (Wuhan) Biotechnology Co., Ltd. The obtained sequences were aligned with the reference genome GRCg6a Primary Assembly of chicken to obtain the corresponding SNP marker site mutations, as shown in Table 1. Figure 3 Table 1. SNP marker site mutations of the chicken GPR98 gene

Claims

1. The application of specific primers for specifically amplifying SNP molecular markers associated with the weight trait of local chickens, or detection reagents or kits containing said specific primers, in the identification of the weight trait of Jianghan chickens, wherein the SNP molecular marker associated with the weight trait of local chickens is located at base 77325222 on chromosome 4 of the international chicken reference genome GRCg6a Primary Assembly version, wherein base 77325222 is C or T, and this mutation leads to polymorphism.

2. The application as described in claim 1, characterized in that, The nucleotide sequence containing the SNP molecular marker is shown in SEQ ID NO.3, where the 108th base Y is the SNP molecular marker site, where Y represents C or T.

3. The application as described in claim 1, characterized in that, The fragment containing the SNP molecular marker is a nucleotide sequence with the nucleotide sequence shown in SEQ ID NO.3 containing the base at position 108.

4. The application as described in claim 1, characterized in that, The specific primers include an upstream primer having the nucleotide sequence shown in SEQ ID NO.1 and a downstream primer having the nucleotide sequence shown in SEQ ID NO.

2.

5. The application as described in claim 1, characterized in that, The TT genotype was selected as the dominant genotype for the molecular marker locus.

6. A method for breeding chickens that can improve the body weight trait, characterized in that, Includes the following steps: (1) Obtain the genomic DNA of each individual of the chicken breed or strain to be tested; (2) Detect the genotypes of SNP molecular markers related to the weight trait of local chickens in the genomic DNA; (3) Select individuals with the TT genotype and eliminate individuals with the CC and CT genotypes; The SNP molecular marker associated with the weight trait of local chickens is located at base 77325222 on chromosome 4 of the international chicken reference genome GRCg6aPrimary Assembly version. The base at position 77325222 is either C or T, and this mutation leads to polymorphism.

Images