Taqman-MGB probe real-time fluorescent quantitative PCR (polymerase chain reaction) detection system, kit and method for vibrio mimicus and application of Taqman-MGB probe real-time fluorescent quantitative PCR detection system

Abstract

The invention discloses a Taqman-MGB probe real-time fluorescent quantitative PCR (polymerase chain reaction) detection system, a kit, a method and application of vibrio mimicus and discloses a Taqman-MGB probe real-time fluorescent quantitative PCR detection system, a kit, a method and application of the Taqman-MGB probe real-time fluorescent quantitative PCR detection system and the kit. Wzy genes of three O antigen serotypes of vibrio mimicus are used as target genes, Taqman specific primers and MGB probes for each serotype are designed and screened, and a real-time fluorescent PCR detection method is established. The detection system provided by the invention can be used for accurately, quickly and sensitively performing molecular biological detection on the three mimicry vibrios.

Description

Technical Field

[0001] The invention belongs to the technical field of bacteria detection methods, and specifically relates to a Taqman-MGB probe real-time fluorescence quantitative PCR detection system, a kit, a method and an application of Vibrio mimicus. Background Art

[0002] Vibrio mimics is named for its metabolic and genetic similarities to Vibrio cholerae. It is widely distributed in aquatic environments and can cause gastroenteritis, diarrhea and food poisoning in humans. It is one of the pathogens recognized worldwide that causes foodborne and waterborne diarrheal diseases.

[0003] Serological detection methods can effectively distinguish strains of different pathogenicity within a species / genus, which is of great significance for the identification and epidemiological investigation of pathogenic bacteria. At present, most important pathogenic bacteria have established serological typing systems based on surface polysaccharide antigens, and this typing system has been widely used in inspection and quarantine and disease prevention and control systems.

[0004] Bacterial surface polysaccharide antigens mainly include O polysaccharide (O antigen), common antigen (CA), extracellular polysaccharide antigen, spore, and capsular polysaccharide (K antigen). Based on the diversity of the above surface polysaccharide antigens, bacteria can be divided into different serotypes. The diversity of O antigens in different serotypes of the same bacteria is determined by the genetic diversity of genes encoding various enzymes that synthesize O antigens. These genes are often clustered at fixed sites on the genome and are called O antigen gene clusters. In previous studies, we found that the O antigen gene cluster of Vibrio mimics is located between the conserved genes gmhD and rjg on the genome, and the gene cluster information has been deciphered, which makes it possible to use molecular biological methods to target specific genes in the gene cluster to achieve molecular serological detection of Vibrio mimics.

[0005] The principle of TaqMan-MGB real-time fluorescence PCR is: after the Taqman probe labeled with fluorescein is mixed with the template DNA, a thermal cycle of high temperature denaturation, low temperature renaturation, and appropriate temperature extension is completed, and the rules of polymerase chain reaction are followed. The Taqman probe complementary to the template DNA is cut off, and the fluorescein is free in the reaction system and emits fluorescence under specific light excitation. With the increase of the number of cycles, the amplified target gene fragment increases exponentially. By real-time detection of the corresponding fluorescence signal intensity that changes with amplification, the Ct value is obtained, and the type and content of the detected sample can be characterized. TaqMan-MGB probe is a new technology improved on the basis of TaqMan probe in recent years. It adds MGB molecules to the 3′ end of the probe. This substance can increase the annealing temperature (Tm value) of the probe, so that it can distinguish the difference of 1 base, completely match, and have a fluorescent signal; as long as there is a mismatch in one base, there will be no signal.

[0006] Currently, some detection technologies based on molecular biological detection methods have been introduced, including the use of recombinase polymerase amplification (invention patent publication number CN107227378A), real-time fluorescence PCR (invention patent publication number CN119570956A), droplet digital PCR (invention patent publication number CN110669857A), and biochip (invention patent publication number CN108841979A) technology to specifically detect Vibrio mimics in food and aquatic products. These technologies generally have the characteristics of accurate detection results and high sensitivity. However, none of the above technologies can achieve the distinction between specific types of Vibrio mimics, especially different serotypes. Summary of the invention

[0007] A Taqman-MGB probe real-time fluorescence quantitative PCR detection system, a kit, a method and an application of Vibrio mimicus. The LAMP system of the invention is used to detect Vibrio mimicus and perform serological typing on the Vibrio mimicus, which has the advantages of simple operation, rapidity and high efficiency.

[0008] In a first aspect, the present invention discloses a Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimicus, wherein the Taqman-MGB probe real-time fluorescence quantitative PCR detection system comprises a primer set and an MGB probe, wherein the primer set is specifically as follows: Primer Set 1: Upstream primer P1: 5′- TGTTGGGACATGTGTCAGGATT -3′; Downstream primer P2: 5'-TTTATTGAACCAACAAGCATCGA -3'; and / or Primer set 2: Upstream primer P3: 5′- ATCTTACTCTCGTTTACCGC -3′; Downstream primer P4: 5'-AGTATCCATCGAAATCCAGC -3'; and / or Primer set 3: Upstream primer P5: 5′- TCCATTGCGTTTTATGTTATTGATG -3′; Downstream primer P6: 5′- TCTGGACACTAATCTCTCAGGGAA -3′; The 5' end of the MGB probe has a fluorescent marker FAM, and the 3' end is connected to an MGB modification group. Each primer set corresponds to one MGB probe; primer set 1 is conjugated with probe T1, primer set 2 is conjugated with probe T2, and primer set 3 is conjugated with probe T3, as shown below: Probe T1: 5′- CTTGATTTCTCATCTATAGCTGGA -3′; Probe T2: 5′- ACAACTCTCGCCAGTGCAGGA -3′; Probe T3: 5′-TTTGTTCCAGTCTTTTAAAGT-3′.

[0009] There are three types of genes in the O-antigen synthesis gene cluster of Vibrio mimicus, namely: monosaccharide synthase genes, glycosyltransferase genes and oligosaccharide unit processing enzyme genes ( wxya and wy Among them, the oligosaccharide unit processing enzyme gene has the most type specificity, followed by the glycosyltransferase gene, and the monosaccharide synthase gene has poor specificity. Therefore, after a large number of tests and screening, the mimetic Vibrio G2358, G2962, and G3890 were finally selected. wy The gene is used as a specific gene to design specific primers and probes.

[0010] In the present invention, Primer Express 3.0 software is used, and TaqMan-MGB probes and primers are designed according to the specific gene sequence of each serotype. Ensure that the GC% content of primers and probes is between 40-70%, avoid the formation of loop hairpin structure, self dimer and cross dimer. Subsequently, the specificity of primers and probes is verified by comparing their sequences with all sequences in GenBank using BLAST search. Secondly, the probe is designed to be 15-30 nt in length, and Tm is 68-70°C. At the 5' end of the probe, avoid the presence of G bases that may cause fluorescence quenching. In addition, the length of the primer is designed to be about 25 nt, Tm is between 55-60°C, and the corresponding PCR product length is between 50-200 bp.

[0011] Preferably, primer set 1 and probe T1 are used to identify whether it is Vibrio mimics G2358, primer set 2 and probe T2 are used to identify whether it is Vibrio mimics G2962, and primer set 3 and probe T3 are used to identify whether it is Vibrio mimics G3890.

[0012] In a second aspect, the present invention provides a real-time fluorescence PCR detection kit for Vibrio mimics, comprising the Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimics described in the first aspect.

[0013] Preferably, primer set 1 and probe T1 are used to identify whether it is Vibrio mimics G2358, primer set 2 and probe T2 are used to identify whether it is Vibrio mimics G2962, and primer set 3 and probe T3 are used to identify whether it is Vibrio mimics G3890.

[0014] In a third aspect, the present invention provides a method for identifying Vibrio mimicus based on real-time fluorescence PCR technology, comprising the following steps: (1) Extracting genomic DNA from the sample to be tested as a template; (2) using the Taqman-MGB probe real-time fluorescence quantitative PCR detection system of Vibrio mimicus described in the first aspect to perform a real-time fluorescence PCR amplification reaction on the template; (3) After the amplification reaction is completed, the Ct value of the amplification reaction system is used to determine whether an amplification product is obtained in the amplification reaction system to determine whether the sample to be tested is Vibrio mimicus: If the Ct value of the amplification reaction system is less than 26, it means that the sample to be tested contains the corresponding Vibrio mimicus; If the Ct value of the amplification reaction system is greater than 26, it means that the sample to be tested does not contain the corresponding Vibrio mimicus.

[0015] In a fourth aspect, the present invention provides the use of the Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimics described in the first aspect in the identification of Vibrio mimics.

[0016] In a fifth aspect, the present invention provides the application of the Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimicus described in the first aspect in food detection.

[0017] Preferably, the food is aquatic product.

[0018] TaqMan fluorescent probe is an oligonucleotide probe, which carries a fluorescent group at the 5' end, such as FAM, TET, VIC, HEX, etc., and a quenching group at the 3' end, such as TAMRA, BHQ, etc. During PCR amplification, a specific fluorescent probe is added at the same time as a pair of primers. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quenching group; during PCR amplification, the 5'-3' exonuclease activity of the Taq enzyme will enzymatically degrade the probe, separating the reporter fluorescent group and the quenching fluorescent group, so that the fluorescent monitoring system can receive the fluorescent signal, that is, every time a DNA chain is amplified, a fluorescent molecule is formed, achieving complete synchronization between the accumulation of fluorescent signals and the formation of PCR products.

[0019] The present invention mainly provides a technical means for detecting three serotypes of Vibrio mimicus using molecular biological methods. The main difficulty lies in the screening and determination of specific Taqman primers and MGB probes. Compared with the prior art, the present invention has at least the following beneficial effects: (1) The present invention discloses for the first time a technical method for detecting Vibrio mimics using Taqman-MGB probe technology, and for the first time applies TaqMan-MGB technology to the serological typing of Vibrio mimics, overcoming the technical problems of traditional detection methods being time-consuming and existing molecular biological detection methods being unable to distinguish serotypes. It provides an effective method for the detection, clinical detection and epidemiological monitoring of the bacteria in aquatic products.

[0020] (2) The detection method provided by the present invention has high detection sensitivity, and the detection sensitivity for genomic DNA can reach 1ng.

[0021] (3) The detection method provided by the present invention has a short detection time. Using this technical means, the detection can be completed within about 3 hours after obtaining the genomic DNA or pure culture bacteria of the sample to be detected. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a graph of the RT-PCR test results of serotype strain G2358 itself; Figure 2 This is a graph of the RT-PCR test results of serotype strain G2962 itself; Figure 3 This is a graph of the RT-PCR test results of serotype strain G3890 itself; Figure 4 is a graph of the reaction specificity test results for serotype strain G2358; Figure 5 is a graph of the reaction specificity test results for serotype strain G2962; Figure 6 This is a graph showing the reaction specificity test results for serotype strain G3890. DETAILED DESCRIPTION

[0023] In view of the shortcomings of the prior art, the inventors of the present invention have conducted intensive research and provided a real-time fluorescence PCR detection technology that can identify three serotypes of Vibrio mimicus strains, providing an effective technical means for the rapid detection of the pathogenic bacteria. To this end, the present invention provides the following technical solutions: In a first aspect, the present invention discloses a Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimicus, wherein the Taqman-MGB probe real-time fluorescence quantitative PCR detection system comprises a primer set and an MGB probe, wherein the primer set is specifically as follows: Primer Set 1: Upstream primer P1: 5′- TGTTGGGACATGTGTCAGGATT -3′; Downstream primer P2: 5'-TTTATTGAACCAACAAGCATCGA -3'; and / or Primer set 2: Upstream primer P3: 5′- ATCTTACTCTCGTTTACCGC -3′; Downstream primer P4: 5'-AGTATCCATCGAAATCCAGC -3'; and / or Primer set 3: Upstream primer P5: 5′- TCCATTGCGTTTTATGTTATTGATG -3′; Downstream primer P6: 5′- TCTGGACACTAATCTCTCAGGGAA -3′; The 5' end of the MGB probe has a fluorescent marker FAM, and the 3' end is connected to an MGB modification group. Each primer set corresponds to one MGB probe; primer set 1 is conjugated with probe T1, primer set 2 is conjugated with probe T2, and primer set 3 is conjugated with probe T3, as shown below: Probe T1: 5′- CTTGATTTCTCATCTATAGCTGGA -3′; Probe T2: 5′- ACAACTCTCGCCAGTGCAGGA -3′; Probe T3: 5′-TTTGTTCCAGTCTTTTAAAGT-3′.

[0024] There are three types of genes in the O-antigen synthesis gene cluster of Vibrio mimicus, namely: monosaccharide synthase genes, glycosyltransferase genes and oligosaccharide unit processing enzyme genes ( wxya and wyAmong them, the oligosaccharide unit processing enzyme gene has the most type specificity, followed by the glycosyltransferase gene, and the monosaccharide synthase gene has poor specificity. Therefore, the genes of Vibrio mimicus G2358, G2962, and G3890 were selected. wy The gene is used as a specific gene to design specific primers and probes.

[0025] In the present invention, Primer Express 3.0 software is used, and TaqMan-MGB probes and primers are designed according to the specific gene sequence of each serotype. Ensure that the GC% content of primers and probes is between 40-70%, avoid the formation of loop hairpin structure, self dimer and cross dimer. Subsequently, the specificity of primers and probes is verified by comparing their sequences with all sequences in GenBank using BLAST search. Secondly, the probe is designed to be 15-30 nt in length, and Tm is 68-70°C. At the 5' end of the probe, avoid the presence of G bases that may cause fluorescence quenching. In addition, the length of the primer is designed to be about 25 nt, Tm is between 55-60°C, and the corresponding PCR product length is between 50-200 bp.

[0026] As one of the preferred technical solutions, primer set 1 and probe T1 are used to identify whether it is Vibrio mimics G2358, primer set 2 and probe T2 are used to identify whether it is Vibrio mimics G2962, and primer set 3 and probe T3 are used to identify whether it is Vibrio mimics G3890.

[0027] In a second aspect, the present invention provides a real-time fluorescence PCR detection kit for Vibrio mimics, comprising the Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimics described in the first aspect.

[0028] As one of the preferred technical solutions, primer set 1 and probe T1 are used to identify whether it is Vibrio mimics G2358, primer set 2 and probe T2 are used to identify whether it is Vibrio mimics G2962, and primer set 3 and probe T3 are used to identify whether it is Vibrio mimics G3890.

[0029] In a third aspect, the present invention provides a method for identifying Vibrio mimicus based on real-time fluorescence PCR technology, comprising the following steps: (1) Extracting genomic DNA from the sample to be tested as a template; (2) using the Taqman-MGB probe real-time fluorescence quantitative PCR detection system of Vibrio mimicus described in the first aspect to perform a real-time fluorescence PCR amplification reaction on the template; (3) After the amplification reaction is completed, the Ct value of the amplification reaction system is used to determine whether an amplification product is obtained in the amplification reaction system to determine whether the sample to be tested is Vibrio mimicus: If the Ct value of the amplification reaction system is less than 26, it means that the sample to be tested contains the corresponding Vibrio mimicus; If the Ct value of the amplification reaction system is greater than 26, it means that the sample to be tested does not contain the corresponding Vibrio mimicus.

[0030] In a fourth aspect, the present invention provides the use of the Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimics described in the first aspect in the identification of Vibrio mimics.

[0031] In a fifth aspect, the present invention provides the application of the Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimicus described in the first aspect in food detection.

[0032] As one of the preferred technical solutions, the food is aquatic product.

[0033] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments and with reference to the accompanying drawings.

[0034] Example 1 Extraction of sample nucleic acid 1. For the pure cultured bacteria obtained, the following methods are used for processing: (1) Pick a single bacterial colony and place it in 10 µL of deionized water, or 10 µL of overnight cultured bacteria, and place it in a boiling water bath for 15 min.

[0035] (2) Place on ice for 1 min and centrifuge at 8000 rpm for 1 min.

[0036] (3) Take 3 µL of supernatant as template for the next LAMP reaction.

[0037] 2. For food samples, take 10g of solid or semi-solid food samples, or 5mL of liquid food samples, and process them in the following ways: (1) Place the sample in 20 mL of LB medium (containing 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl) and culture at 37°C and 180 rpm for 3 h.

[0038] (2) Take 1 mL of the culture medium in step (1), centrifuge at 8000 rpm for 5 min, and discard the supernatant.

[0039] (3) Add 500 µL of deionized water, resuspend and mix, centrifuge at 8000 rpm for 5 min, and discard the supernatant.

[0040] (4) Add 100 µL of deionized water and place in a boiling water bath for 15 min.

[0041] (5) Place on ice for 1 min and centrifuge at 8000 rpm for 1 min.

[0042] (6) Take 3 µL of supernatant as template for the next real-time fluorescence PCR reaction.

[0043] The genomes of Vibrio mimics G2358, G2962, and G3890 were extracted respectively according to the above method to obtain genomic nucleic acid solutions of Vibrio mimics G2358, G2962, and G3890.

[0044] Example 2 Real-time fluorescence amplification (RT-PCR) detection The nucleic acid solution extracted in Example 1 was used as a template for the reaction and added to each RT-PCR reaction system, respectively, and placed in a real-time fluorescence quantitative gene amplification instrument (in this example, the 7500 real-time fluorescence quantitative PCR instrument of ABI Company of the United States was selected), and the reaction was carried out under the following conditions: The details of the real-time fluorescence amplification (RT-PCR) reaction system are shown in Table 1. The amplification reaction was performed in a total volume of 25 μL, including 12.5 μL of real-time fluorescent PCR premix with hot start function (Premix Ex Taq TM , Takara), 0.3 μL each of 10 μM forward and reverse primers, 0.3 μL 10 μM probe, 0.2 μL ROXII, 0.2 μL nucleic acid DNA of the sample to be tested, and 11.2 μL ddHO 2 O. 7500 RT-PCR system (Applied Biosystems, Foster City, CA, USA) was performed, and then the detection and result analysis were performed using an instrument (such as ABI 7500).

[0045] In the test results, if the Ct value of the amplification reaction system is less than 26, it means that the sample to be tested contains the corresponding Vibrio mimics; if the Ct value of the amplification reaction system is greater than 26, it means that the sample to be tested does not contain the corresponding Vibrio mimics.

[0046] Table 1 The experimental results show: (1) High accuracy: In this embodiment, 0.2 μL of the genomic nucleic acid solutions of Vibrio mimics G2358, G2962, and G3890 extracted in Example 1 were added to systems 1, 2, and 3, respectively, to achieve accurate detection of three serotypes of Vibrio mimics.

[0047] The specific reaction results (CT values) of real-time fluorescence PCR of Vibrio mimics are as follows. It can be seen that for Vibrio mimics G2358, the corresponding real-time fluorescence PCR detection result of system 1 is Ct=16.65; for Vibrio mimics G2962, the corresponding real-time fluorescence PCR detection result of system 2 is Ct=16.72; for Vibrio mimics G3890, the corresponding real-time fluorescence PCR detection result of system 3 is Ct=16.11. It can be seen that the CT value of the real-time fluorescence PCR detection of each system for the corresponding serotype is less than 26, which can be judged as a positive result, such as Figures 1 to 3 shown.

[0048] (2) Good specificity: In addition to being able to detect its own corresponding serotype (CT value less than 26), each system can also perform specific detection when strains of other serotypes are added. The results show that when strains other than G2358 are added to reaction system 1, no amplification curve appears, which can be judged as a negative result; when strains other than G2962 are added to reaction system 2, no amplification curve appears, which can be judged as a negative result; when strains other than G3890 are added to reaction system 3, no amplification curve appears, which can be judged as a negative result; the specific results are as follows: Figures 4 to 6 shown.

[0049] At the same time, other common pathogenic Vibrio in aquatic products were collected to verify the specificity of the technical invention, including: Vibrio cholerae, Vibrio parahaemolyticus, Vibrio fluvii, Vibrio vulnificus and Vibrio alginolyticus. The experimental results show that the technical system of the present invention has no amplification curve for the detection of the above Vibrio, which can be judged as a negative result, indicating that it has good specificity.

[0050] Table 2 Real-time fluorescence PCR specific reaction results of Vibrio mimicus (CT value) .

[0051] (3) Sensitivity test: ① Inoculate each Vibrio mimicus strain into 5 mL LB medium, culture overnight in a shaker at 37°C and 180 rpm, and collect 2 mL of bacteria.

[0052] ② Use the bacterial genomic DNA extraction kit (product number DP302) of Tiangen Biochemical Technology (Beijing) Co., Ltd. and follow its operating procedures to extract bacterial genomic DNA.

[0053] ③ The extracted genome concentration was measured with a NanoDrop OD instrument and adjusted to 500 ng / μL, and then diluted step by step. In this way, the genomic DNA added to the corresponding reaction system was 100 ng, 10 ng, 1 ng, 100 pg, 10 pg and 1 pg respectively.

[0054] ④ According to the above reaction steps, real-time fluorescence PCR reaction was carried out. The results are shown in Table 3. It can be seen from the results that the detection sensitivity for genomic DNA is 1 ng.

[0055] Table 3 Real-time fluorescence PCR sensitivity test results of Vibrio mimicus (CT value) .

[0056] The specific embodiments described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimicus, the Taqman-MGB probe real-time fluorescence quantitative PCR detection system comprising a primer set and an MGB probe, characterized in that: The primer set is specifically as follows: Primer Set 1: Upstream primer P1: 5′- TGTTGGGACATGTGTCAGGATT -3′; Downstream primer P2: 5'-TTTATTGAACCAACAAGCATCGA -3'; and / or Primer set 2: Upstream primer P3: 5′- ATCTTACTCTCGTTTACCGC -3′; Downstream primer P4: 5'-AGTATCCATCGAAATCCAGC -3'; and / or Primer Set 3: Upstream primer P5: 5′- TCCATTGCGTTTTATGTTATTGATG -3′; Downstream primer P6: 5′- TCTGGACACTAATCTCTCAGGGAA -3′; The 5' end of the MGB probe has a fluorescent marker FAM, and the 3' end is connected to an MGB modification group. Each primer set corresponds to one MGB probe; primer set 1 is conjugated with probe T1, primer set 2 is conjugated with probe T2, and primer set 3 is conjugated with probe T3, as shown below: Probe T1: 5′- CTTGATTTCTCATCTATAGCTGGA -3′; Probe T2: 5′- ACAACTCTCGCCAGTGCAGGA -3′; Probe T3: 5′-TTTGTTCCAGTCTTTTAAAGT-3′.

2. The real-time fluorescent PCR detection primer set for Vibrio mimicus according to claim 1, characterized in that: Primer set 1 and probe T1 are used to identify whether it is Vibrio mimics G2358, primer set 2 and probe T2 are used to identify whether it is Vibrio mimics G2962, and primer set 3 and probe T3 are used to identify whether it is Vibrio mimics G3890.

3. A real-time fluorescence PCR detection kit for Vibrio mimicus, characterized in that: The invention comprises the Taqman-MGB probe real-time fluorescence quantitative PCR detection system of Vibrio mimicus according to claim 1 or 2.

4. The real-time fluorescent PCR detection kit for Vibrio mimicus according to claim 3, characterized in that: Primer set 1 and probe T1 are used to identify whether it is Vibrio mimics G2358, primer set 2 and probe T2 are used to identify whether it is Vibrio mimics G2962, and primer set 3 and probe T3 are used to identify whether it is Vibrio mimics G3890.

5. A method for identifying Vibrio mimicus based on real-time fluorescence PCR technology, characterized in that: The following steps are involved: (1) Extracting genomic DNA from the sample to be tested as a template; (2) using the Taqman-MGB probe real-time fluorescence quantitative PCR detection system of Vibrio mimicus described in claim 1 or 2, respectively, to perform a real-time fluorescence PCR amplification reaction on the template; (3) After the amplification reaction is completed, the Ct value of the amplification reaction system is used to determine whether an amplification product is obtained in the amplification reaction system to determine whether the sample to be tested is Vibrio mimicus: If the Ct value of the amplification reaction system is less than 26, it means that the sample to be tested contains the corresponding Vibrio mimicus; If the Ct value of the amplification reaction system is greater than 26, it means that the sample to be tested does not contain the corresponding Vibrio mimicus.

6. Use of the Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimics according to claim 1 or 2 in the identification of Vibrio mimics.

7. Application of the Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimicus according to claim 1 or 2 in food detection.

Images