InDel molecular marker of wheat hggt gene, primer thereof and application

By developing co-dominant InDel molecular markers IndHggt1 and IndHggt2, a dual-marker validation system was constructed, which solved the problem of synergistic regulation of vitamin E content and DON toxin accumulation in wheat grains, achieving efficient molecular breeding screening and improving breeding efficiency and variety quality.

CN120099225BActive Publication Date: 2025-12-26JIANGSU LIXIAHE REGION AGRI RES INST +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510540162.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-27
Publication Date
2025-12-26
Estimated Expiration
2045-04-27

AI Technical Summary

Technical Problem

Existing technologies make it difficult to accurately identify functional allelic variations of the wheat HGGT gene using molecular markers, resulting in low breeding efficiency and an inability to achieve synergistic regulation of increased vitamin E content and deoxynivalenol (DON) toxin accumulation in wheat grains.

Method used

We developed codominant InDel molecular markers IndHggt1 and IndHggt2, constructed a dual-marker verification system through PCR amplification and electrophoresis, and accurately identified HGGT genotypes carrying favorable allelic variations to achieve molecular breeding with high vitamin E and low DON toxin.

Benefits of technology

It significantly improves wheat breeding efficiency, enabling precise screening of germplasm with high vitamin E and low DON toxin in natural populations, reducing the scale of field trials, and improving breeding efficiency and variety quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099225B_ABST
    Figure CN120099225B_ABST
Patent Text Reader

Abstract

The application discloses a wheat HGGT gene InDel molecular marker, primers thereof and application, and the wheat HGGT gene InDel molecular marker comprises a DNA fragment with a length of 416 bp shown in SEQ ID No. 5 and a DNA fragment with a length of 215 bp shown in SEQ ID No. 6. A specific primer group comprises an IndHggt1 primer pair shown in SEQ ID No. 1-SEQ ID No. 2 and an IndHggt2 primer pair shown in SEQ ID No. 3-SEQ ID No. 4. The application develops a co-dominant molecular marker system IndHggt1 and IndHggt2 based on the HGGT gene sequence polymorphism characteristics, the IndHggt1 marker is typed by detecting whether an amplification band exists or not, and the IndHggt2 marker is typed by characteristic band length difference, and a double verification system is constructed by introducing the markers, so that the target genotype can be accurately locked.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to marker-assisted breeding technology for wheat, specifically to the InDel molecular marker of the wheat HGGT gene, its primers, and its applications. Background Technology

[0002] Wheat scab is caused by Fusarium graminearum (Fusarium graminearum). Fusarium graminearum ) and Asian Fusarium ( Fusarium asiaticum Fusarium head blight is a global disease caused by pathogens such as [list of pathogens]. The winter wheat region in the middle and lower reaches of the Yangtze River in my country is a severely affected area, with annual yield losses reaching 20%-50% due to the disease. Furthermore, the trichothecene toxin secreted by the pathogen—deoxynivalenol (DON, vomitoxin)—seriously threatens food security. DON is listed as one of the most dangerous natural pollutants by the Food and Agriculture Organization of the United Nations (FAO) and the World Health Organization (WHO). It induces oxidative stress, damaging cellular DNA, protein, and lipid metabolism, and causing poisoning symptoms in humans and animals (such as vomiting, immunosuppression, and reproductive disorders). my country's National Food Safety Standard stipulates that the limit for DON in wheat grains is 1000 μg / kg. -1 However, market monitoring in recent years has shown that the DON content in wheat from some producing areas exceeds the standard by more than 30%, and breakthrough technical means are urgently needed to reduce the risk of toxins.

[0003] Traditional Fusarium head blight resistance breeding relies on quantitative trait loci (QTLs) such as Fhb1 to indirectly reduce DON accumulation by inhibiting pathogen spread. However, there is a phenotypic segregation between toxin regulation and disease resistance. For example, some resistant varieties reduce the incidence of diseased ears, but the DON content in the grains still exceeds the standard. Furthermore, genetic engineering strategies based on UGT glycosyltransferases or ABC transporters are difficult to apply on a large scale due to their complexity and low field applicability. Therefore, identifying key genes that directly regulate DON metabolism and developing efficient molecular markers is the core breakthrough for achieving precise toxin control.

[0004] Previous studies have shown that exogenous vitamin E treatment can significantly reduce the DON content of high-susceptible wheat varieties by more than 40%, suggesting that the vitamin E synthesis pathway may be involved in toxin metabolism regulation. Further genetic association analysis confirmed for the first time that the expression level of the hydroxyphenylpyruvate dioxygenase gene (HGGT) was significantly negatively correlated with DON accumulation (p<0.01) (Wu D, Zhu SQ, Zhang YH, et al. Analysis of the relationship between HGGT gene and toxin accumulation in wheat scab grains [J]. Jiangsu Agricultural Sciences, 2020, 48(11): 96-100.). As a key enzyme in vitamin E synthesis, HGGT has been widely reported to enhance plant antioxidant capacity to resist oxidative damage, but the following key issues have not been resolved: existing studies focus on the basic function of HGGT, lack of systematic analysis of HGGT allelic variation (such as insertion-deletion, SNP) and DON accumulation in natural germplasm, which cannot guide the development of molecular markers; the practicability of molecular markers is insufficient, and the reported HGGT markers are mostly based on gene expression or single SNP site design, which cannot distinguish functional allelic variation, and have not been directly associated with DON content; multi-target coordinated regulation technology is blank, HGGT gene has the dual potential of reducing DON toxin and enriching vitamin E, but the existing breeding technology lacks molecular tools integrating "toxin reduction-nutrition enrichment" goals, resulting in low breeding efficiency. SUMMARY

[0005] To address the major needs of "toxin reduction-nutrition enrichment" synergistic optimization in wheat scab control, based on the discovery that vitamin E can negatively regulate DON toxin accumulation, the key gene HGGT in vitamin E synthesis was targeted, and two co-dominant InDel molecular markers IndHggt1 (416 bp, SEQ ID No. 5) and IndHggt2 (215 bp, SEQ ID No. 6) were successfully developed. A double-molecular marker verification detection system was constructed: through the complementary judgment mechanism of band presence or absence (IndHggt1) and length difference (IndHggt2), the high-vitamin E and low-DON toxin content advantage allele genotype of grains was accurately identified. This system breaks through the traditional path of relying on disease-resistant genes, realizes the molecular level synergy of toxin control and nutrition enrichment, improves the "toxin reduction-quality improvement" integrated breeding efficiency, and provides key technical support for the breeding of high-quality specialty wheat varieties.

[0006] SEQ ID No. 5: TTCATGGTGCAATTATAAGGGAGATCAAGCTTCACTCGGAACTCTTTGAGGAATGCAAGTTTACTCACGGAAGTAGGTCAAGAAATTACGAAGCTGATAGTCTGGCAAAGTTTGCTTTATATCAAGATTTTGGTAGACGTGTTTAGCTAATCGATCCGCATAACAATGCAATCATTCCTTTGGAACTTGTTAAATAAAGTTTTAGTCCACCTAAAAAAAATCTCCCCAGCCCGGCTCAGCTTTGGTATTGGAAAACCCTATTTGACGTGCATTAAGTCAAGTAGCCGGGGCTTCGAGTTGTMAAAAAAAAAAGTAGCCGGGGCTTCGCACAGGGGCGCCATGACTGGGCCGACCCGTTTCTCATTTTATTTATGTTTCTATTTTTCTATTATTTTCTTTTTTCTTCCCTTTTCCTT;

[0007] SEQ ID No. 6: TCCGCATAACAATGCAATCATTCCTTTGGAACTTGTTAAATAAAGTTTTAGTCCACCTAAAAAAAATCTCCCCAGCCCGGCTCAGCTTTGGTATTGGAAAACCCTATTTGACGTGCATTAAGTCAAGTAGCCGGGGCTTCGAGTTGTMAAAAAAAAAAGTAGCCGGGGCTTCGCACAGGGGCGCCATGACTGGGCCGACCCGTTTCTCATTTTAT.

[0008] The object of the present application is achieved by the following technical solutions:

[0009] Firstly, according to the correlation between HGGT gene allelic variation and DON toxin accumulation, the HGGT gene (a key gene for vitamin E synthesis) is locked, and the complete gene sequence of HGGT on the 3B chromosome of wheat is obtained through BAC cloning (accession number: KU641029):

[0010]

[0011] Based on the homologous alignment of resequencing varieties, the sequence variation of the gene was analyzed, and the specific amplification primers IndHggt1 and IndHggt2 of the HGGT gene were designed by using Primer Premier5.0 software. The IndHggt1 marker primer information: the forward primer sequence is shown in SEQ ID No. 1, the reverse primer sequence is shown in SEQ ID No. 2. The IndHggt2 marker primer information: the forward primer sequence is shown in SEQ ID No. 3, and the reverse primer sequence is shown in SEQ ID No. 4.

[0012] SEQ ID No. 1: 5'-TTCATGGTGCAATTATAAGGGAG-3';

[0013] SEQ ID No. 2: 5'-AAGGAAAAGGGAAGAAAAAAGAA-3';

[0014] SEQ ID No. 3: 5'-TCCGCATAACAATGCAATCA-3';

[0015] SEQ ID No. 4: 5'-ATAAAATGAGAAACGGGTCGG-3'.

[0016] Then, the application provides a kit or reagent containing the specific primer set of SEQ ID No. 1-SEQ ID No. 4 described above.

[0017] Again, the application provides the application of the InDel molecular marker, the specific primer set, the reagent or the kit described above in any one of the following:

[0018] (1) HGGT gene typing of wheat materials;

[0019] (2) Detection of wheat grain vitamin E and DON toxin content;

[0020] (3) Wheat genetic breeding.

[0021] Further, the application also provides the application of the double molecular marker verification system constructed by IndHggt1 and IndHggt2 in identifying wheat natural population grain high-vitamin E and low-DON toxin germplasm.

[0022] The application of the above-mentioned Indel primer set in identifying natural population grain vitamin E and DON toxin is that, taking wheat genomic DNA to be detected as a template, taking the Indel primer set with the nucleotide sequence shown in SEQ ID No. 1-SEQ ID No. 4 as primers to perform PCR amplification, performing genotyping according to the electrophoresis results of 2% agarose gel or 8% polyacrylamide gel (medium is selected according to the product fragment size), and jointly judging by double markers: IndHggt1 detection: band type 1 (target band) indicates that the HGGT gene carries a beneficial allelic variation, and band type 2 (no band) indicates that it does not carry; IndHggt2 detection: band type 3 (target band) indicates that the beneficial allelic variation is carried, and band type 4 and band type 5 indicate that it is not carried. If there is a band in IndHggt1 detection, and IndHggt2 detection only has a target band with a length of 215 bp, then the wheat genomic DNA carries a beneficial allelic variation, otherwise it does not carry. It is verified by field natural population phenotype that the variety carrying the beneficial allelic variation of the HGGT gene has higher grain vitamin E content and lower DON toxin content.

[0023] The beneficial effects of the present application are that:

[0024] 1. The IndHggt1 and IndHggt2 co-dominant molecular marker system is developed based on the HGGT gene sequence polymorphism characteristics, the IndHggt1 marker is typed by detecting whether the amplified band exists or not, and the IndHggt2 marker is typed by the length difference of the characteristic band, and by introducing the marker to construct a double verification system, the target genotype can be accurately locked.

[0025] 2. The primer combination has high specificity, can realize stable amplification on a conventional PCR instrument, does not need to rely on special detection equipment, and significantly improves the universality and operability of the detection scheme.

[0026] 3. By establishing a molecular marker assisted selection system, it is expected to realize directional polymerization of the double optimal traits of “low DON toxin accumulation + high vitamin E content”, the technology can be applied to natural population screening and early selection of hybrid F1 generation at the same time, reduces the field test scale by 50% compared with the traditional breeding method, and provides an efficient technical solution for cultivating high-quality special wheat varieties meeting the “de-toxication and quality improvement” national strategy. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 is the electrophoresis spectrum of the amplification product of the IndHggt1 marker in the natural population in Example 1 of the present application;

[0028] Figure 2 is the electrophoresis spectrum of the amplification product of the IndHggt2 marker in the natural population in Example 1 of the present application;

[0029] Figure 3is the HGGT gene accumulation correlation analysis with grain vitamin E and DON toxin content in Example 2 of the present application; in the figure, x is the average value, the horizontal line represents the median, the points above and below the figure represent outliers, and the abscissa A and B represent varieties not carrying favorable allelic variants and varieties carrying favorable allelic variants, respectively. * represents a significant difference P <0.05), ** represents a highly significant difference P <0.01). DETAILED DESCRIPTION

[0030] The specific embodiments of the present application are described in detail below. It should be understood that the specific embodiments described herein are only for illustration and explanation of the present application, and are not intended to limit the present application.

[0031] Example 1: Genotyping of natural population using IndHggt1 and IndHggt2 markers

[0032] (1) Experimental materials: 113 national main varieties, strains and part of local varieties were planted in Jiangsu Lixiahe region in 2022 and 2023 (elevation 10-20 m, latitude 32.24 degrees, longitude 119.26 degrees, annual precipitation 1020 mm) in Wangtou base of Jiangsu Academy of Agricultural Sciences (elevation 10-20 m, latitude 32.24 degrees, longitude 119.26 degrees, annual precipitation 1020 mm). 30 seeds / row were sown for each variety, 2 rows for 1 repeat, the test was set up with two repeats, the row length was 150 cm, the row spacing was 30 cm, and the test field management was carried out according to the standard mode of the local area, and no disease control was carried out. 113 wheat varieties are shown in Table 1.

[0033] (2) DNA extraction: tender leaves of the materials at the seedling stage were taken, and the genomic DNA of each material was extracted by CTAB method. The concentration of DNA was detected by ultramicro spectrophotometer, and the concentration of DNA was about 6000 ng / μL, and D260nm / D280nm was between 1.7 and 2.0.

[0034] (3) PCR reaction system: the PCR reaction system adopts 10 μL system, in which 50 ng DNA template, 0.2 μL (10 μmol / L) of upstream and downstream primers, 5 μL 2×Taq Plus Master Mix (Novozyme Company), and the remaining volume is supplemented with ddH2O.

[0035] (4) PCR program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, according to the requirements of the primers, 55-58℃ annealing for 45 s, 72℃ extension for 1 min, 33 cycles; 72℃ extension for 5 min.

[0036] (5) Electrophoresis detection: 2% agarose gel electrophoresis and polyacrylamide gel electrophoresis analysis results.

[0037] AsFigure 1 As shown in Table 1, under the detection of IndHggt1 marker, 21 varieties from No. 1 to No. 21 were type 1 (with bands), and 92 varieties from No. 22 to No. 113 were type 2 (without bands).

[0038] As shown in Table 1, under the detection of IndHggt2 marker, 20 varieties from No. 1 to No. 19 and No. 22 were type 3 (band length was 215 bp), 90 varieties from No. 20 to No. 21 and No. 23 to No. 110 were type 4 (band length was 190 bp), and 3 varieties from No. 111 to No. 113 were type 5 (heterozygous band). Figure 2

[0039] Table 1 Genotyping results of 113 wheat varieties

[0040]

[0041] Note: "+" in the table represents "yes", and "-" represents "no".

[0042] Example 2: Application of double marker detection system in screening of seed high-vitamin E and low-DON toxin germplasm in natural population

[0043] In 2022 and 2023, the seed vitamin E content, DON toxin content under non-inoculation condition, and DON toxin content under inoculation condition of a natural population composed of 113 national main varieties and part of local varieties and lines in Table 1 were collected, and data were obtained. Among them:

[0044] Scab inoculation adopts single flower drop injection method. At the flowering stage of wheat, one of the repeats is inoculated, and the prepared bacterial solution is injected between the inner and outer glumes of the lateral flowers. Ten spikes are inoculated in each row. After 21 days of inoculation, the number of diseased spikes is identified, and the disease spike rate is calculated. The other repeat is not inoculated.

[0045] The determination of grain toxin content is carried out by liquid chromatography-mass spectrometry (LC-MS). The instrument uses QTRAP-4500 ultra-high performance liquid chromatography-tandem mass spectrometer (Sciex Company, USA). At the mature stage of wheat, 10 spikes of inoculated and non-inoculated spikes are harvested for each variety. After threshing, the sample is treated, the standard solution is prepared, the chromatography and mass spectrometry conditions are set, the Analyst software is used for data collection, and the MultiQuant3.0.3 software is used for data processing, to obtain the toxin content in the grain under the conditions of inoculation and non-inoculation of the variety.

[0046] ​The determination of the grain vitamin E content is performed by high performance liquid chromatography (HPLC) combined with fluorescence detector, the instrument uses Agilent 1260 Infinity II HPLC system (Agilent, USA), is equipped with a four-element gradient pump, an automatic sampler, a column oven and a fluorescence detector (FLD). After harvesting, the un-inoculated wheat is threshed, the sample is treated, the standard solution is configured, the chromatographic conditions are set, the Agilent OpenLab CDS software is used to record the chromatographic peak, and the peak area is used to calculate the vitamin E content in the grain based on the standard curve method.

[0047] The genotype data is associated with the average vitamin E content and DON toxin content under the conditions of natural infection (non-inoculation) in two years of field environment, and the average grain DON toxin content measured after inoculation treatment, and it is found that the band type 1 and the band type 3 are both varieties carrying gene advantageous alleles, and other band types are varieties not carrying gene advantageous alleles. As shown in Table 2 and Figure 3 As shown in Table 2 and

[0048] It can be seen that the double marker detection system constructed in the present application can accurately distinguish between varieties carrying and not carrying advantageous alleles, and provides an efficient molecular detection tool for screening wheat germplasm with high vitamin E nutrition and low DON toxin.

[0049] Table 2 Variance analysis of grain vitamin E and DON toxin content of natural population

[0050]

[0051] Note: Data from two years of field trials average; "+" indicates carrying favorable allelic variation, "-" does not carry.

[0052] The above describes the preferred embodiments of the present application in detail, but the present application is not limited to the specific details in the above-described embodiments, and within the technical concept scope of the present application, various simple modifications can be made to the technical solutions of the present application, and these simple modifications all belong to the protection scope of the present application.

[0053] In addition, it should be noted that each specific technical feature described in the above specific embodiments can be combined in any appropriate manner without contradiction, and in order to avoid unnecessary repetition, the present application will not further describe various possible combinations.

[0054] In addition, various different embodiments of the present application can also be combined in any manner, as long as it does not deviate from the idea of the present application, and it should also be considered as disclosed by the present application.

Claims

1. An InDel molecular marker of wheat HGGT gene, characterized in that, a DNA fragment of 416 bp in length as shown in SEQ ID No. 5 and a DNA fragment of 215 bp in length as shown in SEQ ID No.

6.

2. A specific primer set characterized in that, an IndHggt1 primer pair as shown in SEQ ID No. 1-SEQ ID No. 2 and an IndHggt2 primer pair as shown in SEQ ID No. 3-SEQ ID No.

4.

3. A kit containing the specific primer set of claim 2.

4. Use of the InDel molecular marker of claim 1, or the specific primer set of claim 2, or the kit of claim 3 in any of the following: (1) genotyping HGGT gene of wheat materials; (2) detecting vitamin E and DON toxin content of wheat kernels; (3) cultivating wheat with higher vitamin E content and lower DON toxin content.

5. A method for screening wheat grain high vitamin E low DON toxin germplasm, characterized in that, comprising: using the wheat genomic DNA to be tested as a template, performing parallel PCR amplification using the IndHggt1 primer pair and the IndHggt2 primer pair as described in claim 2 respectively; if the IndHggt1 primer pair detects a band and the IndHggt2 primer pair detects a target band of 215 bp in length, the wheat genomic DNA carries a beneficial allelic variation, otherwise it does not carry, wherein the variety carrying the HGGT gene beneficial allelic variation has higher vitamin E content and lower DON toxin content.

6. The screening method of claim 5, wherein, PCR reaction system 10 μL: 50 ng DNA template, 0.2 μL of upstream and downstream primers respectively, 5 μL 2 × Taq Plus MasterMix, ddH2O supplement; PCR reaction program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55-58℃ annealing for 45 s, 72℃ extension for 1 min, 33 cycles; 72℃ extension for 5 min.

Citation Information

Patent Citations

  • Molecular marker related to wheat grain DON toxin accumulation and primer and application thereof

    CN115044697A

  • Molecular marker for detecting gibberellic disease resistant QTL QFhb-yaas-4AL and application

    CN119265344A