Reagent and system for detecting canine adenovirus and / or typing and application

By designing a dual-target detection method for specific primers and probes, the problem of insufficient detection of CAdV-1 type in the prior art canine adenovirus is solved, and the accurate detection and typing of CAdV-1 and CAdV-2 is achieved, which improves the accuracy of clinical diagnosis.

CN120099228APending Publication Date: 2025-06-06GUANGDONG RUNPENG BIOLOGICAL TECH CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311650927.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-04
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

In the prior art, the detection of canine adenovirus is often only targeted to CAdV-2 type, making it difficult to effectively detect CAdV-1 type, and cannot accurately classify, which increases the difficulty of clinical diagnosis.

Method used

A reagent and system for detecting adenovirus and/or typing was designed to perform dual-target detection of canine adenovirus types 1 and 2 through specific primers and probes to achieve accurate detection and typing of CAdV-1 and CAdV-2.

Benefits of technology

This method can quickly, efficiently and accurately detect canine adenovirus type 2, and further realize the accurate typing of CAdV-1 and CAdV-2 through dual-target detection methods, meeting the needs of clinical applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099228A_ABST
    Figure CN120099228A_ABST
Patent Text Reader

Abstract

The invention discloses a reagent and a system for detecting canine adenovirus and / or typing and application. Wherein the reagent comprises a reagent for detecting an amplified fragment 1 and / or an amplified fragment 2 of the canine adenovirus type 2, the amplified fragment 1 is selected from any fragment of SEQ ID NO: 13, and the amplified fragment 2 is selected from any fragment of SEQ ID NO: 17. By applying the technical scheme of the invention, the canine adenovirus type 2 can be detected, for example, typically, a universal single-target gene can be firstly used to determine whether the canine adenovirus exists or not; then, more accurate canine adenovirus typing is further realized aiming at the two subtypes of CADV-1 and CADV-2 respectively.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a reagent, system and application for detecting canine adenovirus and / or typing it. Background Art

[0002] Adenovirus is a DNA virus, including adenoviruses that can infect humans and various animals. Among them, canine adenovirus (CAdV) belongs to the Adenoviridae family and the genus Canine mastadenovirus, and is currently known to be the most pathogenic virus in this genus.

[0003] Adenovirus particles have no envelope, and the outer shell has a characteristic icosahedral symmetry. The capsid is composed of 252 capsomers, including 240 hexons and 12 penton matrices. Hexons are the most numerous capsid structure in adenovirus particles. Each hexon is composed of a trimer of hexon proteins; each penton is composed of a spike protein and a penton base. Among them, during the process of virus infection of the host, the penton base and the spike protein can help the virus invade the host cell, and the spike protein mediates the interaction between the virus and the receptors on the cell surface, thereby completing the adsorption of the virus on the host cell.

[0004] Canine adenovirus can be divided into two categories according to different serotypes: CAdV-1 and CAdV-2. Among them, some scholars believe that CAdV-2 is a variant of CAdV-1. Both serotypes have common complement binding antigens and are highly pathogenic, but their biochemical characteristics and nucleic acid homology are different. The infected hosts and infection routes of the two are different: CAdV-1 infects dogs, foxes, wolves, bears, giant pandas, etc., mainly through the respiratory tract, digestive tract, placenta, and external parasites. Therefore, the main source of infection of this disease is the feces, urine, saliva, etc. of sick dogs and infected dogs; CAdV-2 only infects dogs, mainly through the respiratory tract, and can infect the non-ciliated cells of the upper respiratory tract, bronchi and alveolar type 2 epithelium.

[0005] It is generally believed that CAdV-1 mainly causes canine infectious hepatitis (ICH) and fox and bear encephalitis, and can cause eye loss. CAdV-2, after infection, generally has no obvious clinical symptoms or mild symptoms. Common symptoms include severe dry cough, runny nose, vomiting, leading to canine infectious respiratory disease (CIRD). In rare cases, it can cause canine enteritis or neurological symptoms. In addition, canine adenovirus is often mixed with canine distemper virus, canine parainfluenza virus, canine mycoplasma, canine influenza virus and Bordetella bronchiseptica, which increases the complexity of clinical symptoms. Common products on the market usually only target CAdV-2 type for canine adenovirus detection, and combine detection with other respiratory pathogens. Its representative products include: Canine Respiratory Pentavalent Test from Shouqiu, Canine Respiratory Quadruple Test from Gangzhu, Canine Respiratory Seven-Test from Aigene, Canine Respiratory Six-Test from Jiling and Canine Respiratory Quadruple Test from Kezhida, etc., respiratory pathogen nucleic acid detection kits. However, some literature indicates that dogs infected with CAdV-1 also have respiratory symptoms such as fever, swollen tonsils, cough and lower respiratory tract rales. CAdV-1 can even cause upper bronchial pneumonia. It is difficult to distinguish clinically from CAdV-2 or other respiratory pathogens in terms of symptoms, and mixed infection with other pathogens increases the difficulty of diagnosis. At present, common products on the market only include CAdV-2 in the detection of canine adenovirus projects, and there is a possibility of missing CAdV-1 when conducting multiple respiratory tests, such as the "A Nucleic Acid Composition and Its Kit and Method for Detecting Multiple Canine Respiratory Pathogens" (Patent No. CN112609025A) applied by Shanghai Jiling Biological and the "Primer Probe Composition, Kit and Preparation Method for Detecting Canine Parainfluenza Virus, Canine Adenovirus Type II and Canine Mycoplasma" (Patent No. CN114574634B) applied by Shandong Kanghua Biological. Summary of the invention

[0006] The present invention aims to provide a reagent, system and application for detecting and / or typing canine adenovirus, so as to solve the technical problem of missed detection or failure to type canine adenovirus in the prior art.

[0007] In order to achieve the above object, according to one aspect of the present invention, a reagent for detecting and / or typing canine adenovirus is provided. The reagent comprises: a reagent for detecting amplified fragment 1 and / or amplified fragment 2 of canine adenovirus type 2, wherein amplified fragment 1 is selected from any fragment of SEQ ID NO: 13, and amplified fragment 2 is selected from any fragment of SEQ ID NO: 17.

[0008] Furthermore, amplified fragment 1 is selected from any fragment between bases (1-3) to (70-74) in SEQ ID NO: 13; and / or amplified fragment 2 is selected from any fragment between bases (1-5) to (80-83) in SEQ ID NO: 17.

[0009] Further, the reagent includes a primer pair, the nucleotide sequence of the primer pair has a nucleotide sequence that is complementary or identical to 20 to 26 consecutive nucleotides between bases (1 to 3) to (70 to 74) of the amplified fragment 1; and / or

[0010] The reagents include a primer pair, the nucleotide sequence of the primer pair has a nucleotide sequence that is complementary or identical to 20 to 26 consecutive nucleotides between bases (1 to 5) to (80 to 83) of the amplified fragment 2.

[0011] Further, the primer pair for detecting the canine adenovirus universal amplification fragment SEQ ID NO: 1 has the nucleotide sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4; and / or

[0012] The primer pair for detecting canine adenovirus type 1-amplified fragment 1 SEQ ID NO: 5 has the nucleotide sequences shown in SEQ ID NO: 7 and SEQ ID NO: 8; and / or

[0013] The primer pair for detecting canine adenovirus type 1-amplified fragment 2 SEQ ID NO: 9 has the nucleotide sequences shown in SEQ ID NO: 11 and SEQ ID NO: 12; and / or

[0014] The primer pair for detecting canine adenovirus type 2-amplified fragment 1 SEQ ID NO: 13 has the nucleotide sequences shown in SEQ ID NO: 15 and SEQ ID NO: 16; and / or

[0015] The primer pair for detecting canine adenovirus type 2-amplified fragment 2 SEQ ID NO: 17 has the nucleotide sequences shown in SEQ ID NO: 19 and SEQ ID NO: 20.

[0016] Furthermore, the reagent also includes a probe, the probe includes a probe for detecting the universal amplified fragment of canine adenovirus SEQ ID NO: 1 and has a nucleotide sequence shown in SEQ ID NO: 2; and / or

[0017] The probe for detecting canine adenovirus type 1-amplified fragment 1 SEQ ID NO: 5 has the nucleotide sequence shown in SEQ ID NO: 6; and / or

[0018] The probe for detecting canine adenovirus type 1-amplified fragment 2 SEQ ID NO: 9 has the nucleotide sequence shown in SEQ ID NO: 10; and / or

[0019] The probe for detecting canine adenovirus type 2-amplified fragment 1 SEQ ID NO: 13 has the nucleotide sequence shown in SEQ ID NO: 14; and / or

[0020] The probe for detecting canine adenovirus type 2-amplified fragment 2 SEQ ID NO:17 has the nucleotide sequence shown in SEQ ID NO:18.

[0021] Furthermore, the 5' end and 3' end of the probe have a fluorescent reporter group and a fluorescent quencher group, respectively;

[0022] Preferably, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5 or Cy7; the fluorescent quencher group is selected from BHQ, TAMRA, Dabcyl or Eclipse;

[0023] More preferably, the 5' end of the probe is a FAM group, and the 3' end is a BHQ group.

[0024] Furthermore, the reagents also include Real time PCR reaction reagents;

[0025] Preferably, the Real time PCR reaction reagent includes a qPCR premix, and the qPCR premix includes a qPCR buffer and AK Taq DNA polymerase. Preferably, the concentration of the AK Taq DNA polymerase is 5 U / μL.

[0026] According to another aspect of the present invention, a system for detecting canine adenovirus and / or typing is provided. The system comprises: a nucleic acid extraction device configured to extract sample nucleic acid; a detection device comprising a real-time fluorescence quantitative PCR analyzer and any of the above reagents for detecting canine adenovirus and / or typing; and a data analysis device configured to analyze the data file of the real-time fluorescence quantitative PCR analyzer and output the result.

[0027] Furthermore, the program settings of the real-time fluorescence quantitative PCR analyzer are as follows: pre-denaturation treatment is 92-98°C, 30s-90s; denaturation treatment is 92-98°C, 2-8s, annealing / collecting fluorescence signal treatment is 58-62°C, 8-12s, and 40-44 cycles.

[0028] According to another aspect of the present invention, a reagent for detecting and / or typing canine adenovirus or a system for detecting and / or typing canine adenovirus is provided, and its use in detecting and / or typing canine adenovirus is provided.

[0029] By applying the technical solution of the present invention, the typing of canine adenovirus type 2 can be detected. For example, typically, a universal single target gene can be used first to determine the presence of canine adenovirus; then, a dual-target gene detection method is used for the two subtypes of CAdV-1 and CAdV-2, and a total of four sets of specific sequences are designed, which further achieves more accurate typing of canine adenovirus. In a preferred embodiment of the present invention, a highly specific primer probe is used to efficiently and accurately identify canine adenovirus and its type, and the target fragment can be amplified in the eye, nasopharyngeal swab and other suspicious samples of dogs. It is fast and efficient, the results are accurate, the cost is controllable, and it better meets the needs of subsequent clinical applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The drawings constituting a part of the present application are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0031] Figure 1 The amplification curve diagram of P1-F3-R1 of Example 1 is shown;

[0032] Figure 2 The amplification curve diagram of P1-F1-R1 of Example 1 is shown;

[0033] Figure 3 The amplification curve diagram of P1-F3-R3 of Example 1 is shown;

[0034] Figure 4 The amplification curve diagram of P1-F1-R3 of Example 1 is shown;

[0035] Figure 5 The amplification curve diagram of P2-F2-R2 of Example 1 is shown;

[0036] Figure 6 The amplification curve diagram of P2-F4-R2 of Example 1 is shown;

[0037] Figure 7 The amplification curve diagram of P2-F2-R4 of Example 1 is shown;

[0038] Figure 8 An amplification curve diagram of P2-F4-R4 of Example 1 is shown;

[0039] Fig. 9 Amplification curves of P1-F1-R1 and P2-F2-R2 of Example 2 are shown;

[0040] Fig.10 Amplification curves of P1-F3-R1 and P2-F2-R2 of Example 2 are shown;

[0041] Fig.11 Amplification curves of P1-F1-R1 and P2-F2-R4 of Example 2 are shown;

[0042] Fig.12 Amplification curves of P1-F3-R1 and P2-F2-R4 of Example 2 are shown;

[0043] Fig.13 shows a standard curve amplification graph of the CADV universal primer-probe system of Example 3; and

[0044] Fig.14 The standard curve diagram of the CADV universal primer-probe system of Example 3 is shown;

[0045] Fig.15 The standard curve amplification diagram of the canine adenovirus type 1 dual-target primer-probe system of Example 3 is shown;

[0046] Figure 16-1 The standard curve graph of the canine adenovirus type 1 target 1 primer-probe system of Example 3 is shown;

[0047] Figure 16-2 The standard curve graph of the canine adenovirus type 1 target 2 primer-probe system of Example 3 is shown;

[0048] Fig.17 The standard curve amplification diagram of the canine adenovirus type 2 dual-target primer-probe system of Example 3 is shown;

[0049] Figure 18-1 The standard curve graph of the canine adenovirus type 2 target 1 primer-probe system of Example 3 is shown;

[0050] Figure 18-2 The standard curve graph of the canine adenovirus type 2 target 2 primer-probe system of Example 3 is shown;

[0051] Fig.19 The amplification curve of the CADV universal reagent of Example 4 for 20 negative controls is shown;

[0052] Fig. 20 The amplification curve of the canine adenovirus type 1 (dual target) detection reagent of Example 4 for 20 negative controls is shown;

[0053] Fig.21 The amplification curve of the canine adenovirus type 2 (dual target) detection reagent of Example 4 for 20 negative controls is shown;

[0054] Fig. 22 The amplification diagram of the CADV universal reagent of Example 4 for Bordetella bronchiseptica and Mycoplasma canis samples is shown;

[0055] Fig.23 The amplification diagram of the canine adenovirus type 1 (dual target) detection reagent of Example 4 for Bordetella bronchiseptica and Mycoplasma canis samples is shown;

[0056] Fig.24 The amplification diagram of canine adenovirus type 2 (dual target) detection reagent of Example 4 for Bordetella bronchiseptica and Mycoplasma canis samples is shown

[0057] Fig.25 The CADV universal reagent of Example 5 is shown to be used to detect 10 canine adenovirus negative and positive clinical samples;

[0058] Fig.26 The canine adenovirus type 1 (dual target) detection reagent of Example 5 is shown to be used for comparative detection and typing of clinical samples;

[0059] Fig. 27 The control reagent (canine adenovirus type 1) of Example 5 is shown to be used for comparative detection of clinical samples;

[0060] Fig.28 The canine adenovirus type 2 (dual target) detection reagent of Example 5 is shown to be used for comparative detection and typing of clinical samples; and

[0061] Fig.29 The control reagent (canine adenovirus type 2) of Example 5 is shown to be used for comparative detection of clinical samples. DETAILED DESCRIPTION

[0062] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present invention will be described in detail below with reference to the accompanying drawings and in combination with the embodiments.

[0063] As described in the background technology of this application, the two subtypes of CAdV-1 and CAdV-2 (typing) are difficult to distinguish in the clinical diagnosis of the early stage of infection, and there may be similar respiratory symptoms, but the complications in the middle and late stages are different: the symptoms of CAdV-2 infection are not obvious or mild, and CAdV- is asymptomatic in the early stage, making it difficult to diagnose or distinguish. However, the symptoms of CAdV-1 are more obvious in the middle and late stages, and the symptoms are more serious. In addition, the typing diagnosis of CAdV-1 and CAdV-2 is also significant in early medication guidance: CAdV-1 can be treated with high immune serum in the early stage of the disease to inhibit the spread of the virus. However, once obvious clinical symptoms appear, even a large dose of high immune serum is difficult to have a therapeutic effect. The current medication for CAdV-2 is simple, and the right medicine can be used. Generally, antitussives, expectorants, electrolyte supplements, glucose, etc. can prevent secondary infection.

[0064] Therefore, in clinical diagnosis, it is crucial to determine whether the patient is infected with canine adenovirus and which type of canine adenovirus the patient is infected with. First answering the question "whether the patient is infected with canine adenovirus" and then answering the question "which serotype of canine adenovirus the patient is infected with" is crucial for guiding early medication and timely seizing the cure window.

[0065] To this end, the inventors compared the whole genome, FIBER gene and Hexon gene sequences of canine adenovirus types 1 and 2 registered in Genbank and found that the above-mentioned amplification segment has the characteristics of universal primer design or typing design, and designed specific primers and probes accordingly.

[0066] According to a typical embodiment of the present invention, a reagent for detecting and / or typing canine adenovirus is provided. The reagent comprises: a reagent for detecting amplified fragment 1 and / or amplified fragment 2 of canine adenovirus type 2, wherein amplified fragment 1 is selected from any fragment of SEQ ID NO: 13, and amplified fragment 2 is selected from any fragment of SEQ ID NO: 17.

[0067] By applying the technical solution of the present invention, canine adenovirus type 2 can be accurately detected.

[0068] In one embodiment of the present invention, amplified fragment 1 is selected from any fragment between bases (1-3) to (70-74) in SEQ ID NO: 13; and / or amplified fragment 2 is selected from any fragment between bases (1-5) to (80-83) in SEQ ID NO: 17. Preferably, the reagent includes a primer pair, the nucleotide sequence of the primer pair has a nucleotide sequence that is complementary or identical to 20 to 26 consecutive nucleotides between bases (1-3) to (70-74) of amplified fragment 1; and / or the reagent includes a primer pair, the nucleotide sequence of the primer pair has a nucleotide sequence that is complementary or identical to 20 to 26 consecutive nucleotides between bases (1-5) to (80-83) of amplified fragment 2. For the detection of canine adenovirus type 2-amplified fragment 1 and the detection of canine adenovirus type 2-amplified fragment 2, the amplification can also be appropriately extended to the upstream or downstream of the fragment by several bases. It can be understood that all are within the scope of the inventive concept of the present invention.

[0069] Preferably, it also includes a reagent for detecting the universal amplified fragment of canine adenovirus SEQ ID NO: 1, a reagent for detecting the amplified fragment 1 of canine adenovirus type 1 SEQ ID NO: 5, and a reagent for detecting the amplified fragment 2 of canine adenovirus type 1 SEQ ID NO: 9. In one embodiment of the present invention, a universal single target gene can be used first to determine the presence of canine adenovirus; then a dual-target gene detection method is used for the two subtypes of CAdV-1 and CAdV-2, and a total of four sets of specific sequences are selected, thereby further achieving more accurate canine adenovirus typing.

[0070] According to a typical embodiment of the present invention, the reagent includes a primer pair, the primer pair including a primer pair for detecting canine adenovirus type 2-amplified fragment 1 SEQ ID NO: 13 and a primer pair for detecting canine adenovirus type 2-amplified fragment 2 SEQ ID NO: 17; preferably, it also includes a primer pair for detecting canine adenovirus universal amplified fragment SEQ ID NO: 1, a primer pair for detecting canine adenovirus type 1-amplified fragment 1 SEQ ID NO: 5, and a primer pair for detecting canine adenovirus type 1-amplified fragment 2 SEQ ID NO: 9.

[0071] According to a typical embodiment of the present invention, the primer pair for detecting the universal amplified fragment of canine adenovirus SEQ ID NO: 1 has the nucleotide sequence shown in SEQ ID NO: 3 and SEQ ID NO: 4; and / or the primer pair for detecting canine adenovirus type 1-amplified fragment 1 SEQ ID NO: 5 has the nucleotide sequence shown in SEQ ID NO: 7 and SEQ ID NO: 8; and / or the primer pair for detecting canine adenovirus type 1-amplified fragment 2 SEQ ID NO: 9 has the nucleotide sequence shown in SEQ ID NO: 11 and SEQ ID NO: 12; and / or the primer pair for detecting canine adenovirus type 2-amplified fragment 1 SEQ ID NO: 13 has the nucleotide sequence shown in SEQ ID NO: 15 and SEQ ID NO: 16; and / or the primer pair for detecting canine adenovirus type 2-amplified fragment 2 SEQ ID NO: 17 has the nucleotide sequence shown in SEQ ID NO: 19 and SEQ ID NO: 20.

[0072] The above highly specific primers can efficiently and accurately identify canine adenovirus and its type. The target fragment can be amplified from the dog's eye, nasopharyngeal swabs and other suspicious samples. It is fast and efficient, the results are accurate, the cost is controllable, and it can better meet the needs of subsequent clinical applications.

[0073] In order to further improve the accuracy of detection and / or typing, in a preferred embodiment of the present application, the reagent also includes a probe. The probe includes a probe for detecting a universal amplified fragment of canine adenovirus SEQ ID NO: 1, a probe for detecting a canine adenovirus type 1-amplified fragment 1 SEQ ID NO: 5, a probe for detecting a canine adenovirus type 1-amplified fragment 2 SEQ ID NO: 9, a probe for detecting a canine adenovirus type 2-amplified fragment 1 SEQ ID NO: 13, and a probe for detecting a canine adenovirus type 2-amplified fragment 2 SEQ ID NO: 17; preferably, the probe for detecting the universal amplified fragment of canine adenovirus SEQ ID NO: 1 has a nucleotide sequence as shown in SEQ ID NO: 2; and / or the probe for detecting a canine adenovirus type 1-amplified fragment 1 SEQ ID NO: 5 has a nucleotide sequence as shown in SEQ ID NO: 6; and / or the probe for detecting a canine adenovirus type 1-amplified fragment 2 SEQ ID NO: 9 has a nucleotide sequence as shown in SEQ ID NO: 10; and / or the probe for detecting a canine adenovirus type 2-amplified fragment 1 SEQ ID NO: 13 has a nucleotide sequence as shown in SEQ ID NO: 14; and / or the probe for detecting a canine adenovirus type 2-amplified fragment 2 SEQ ID NO: 17 has a nucleotide sequence as shown in SEQ ID NO: The nucleotide sequence shown in ID NO:18.

[0074] In the above primer-probe combination, the 5' end and 3' end of the probe have a fluorescent reporter group and a fluorescent quencher group, respectively. The fluorescent reporter group and the fluorescent quencher group facilitate accurate, efficient and rapid detection using the fluorescent quantitative PCR method. Therefore, any group that emits fluorescence and can absorb fluorescence of the corresponding wavelength is suitable for this application.

[0075] In some preferred embodiments, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5 or Cy7.; the fluorescent quencher group is selected from BHQ, TAMRA, Dabcyl or Eclipse. When the fluorescent reporter group and the fluorescent quencher group are used, they are reasonably selected and matched according to the wavelength of the emitted fluorescence and the wavelength of the absorbed fluorescence.

[0076] From the perspective of cost, effect, wide application and convenience, in some more preferred embodiments, the 5' end of the probe uses a FAM group, and the 3' end uses a BHQ group (specifically, BHQ1, BHQ2 or BHQ3).

[0077] The specific primers and probes described in the preferred embodiment of the present application include the designed universal primers CADV-F1, CADV-R1 and probe CADV-P1; canine adenovirus type 1 primers CADV1-F1, CADV1-F2, CADV1-R1, CADV1-R2 and probes CADV1-P1, CADV1-P2; canine adenovirus type 2 primers CADV2-F1, CADV2-F2, CADV2-R1, CADV2-R2 and probes CADV2-P1, CADV2-P2. The primers and probes are DNA fragments synthesized by Sangon Biotech (Shanghai) Co., Ltd. according to the following base sequences.

[0078] CADV-P1 (SEQ ID NO: 2): 5'-ROX-CACATTGCTGGCCAGGACGCCG-BHQ2-3'

[0079] CADV-F1 (SEQ ID NO: 3):CGTCGATGCTGCCCACAATGG

[0080] CADV-R1 (SEQ ID NO: 4):TGGTTGCTTGGGCAAACTGAA

[0081] CADV1-P1 (SEQ ID NO: 6): 5'-FAM-CCCTGGGGCTCACCTTACGACCCC-BHQ1-3'

[0082] CADV1-F1 (SEQ ID NO: 7):TTAAGCAGCGGGAAACTCCA

[0083] CADV1-R1 (SEQ ID NO: 8):GGGAATGCTACCCGAGTAAGTAAA

[0084] CADV1-P2 (SEQ ID NO: 10): 5'-ROX-ATGCCCGTGACCGCSCCTG-BHQ2-3' (S=G / C)

[0085] CADV1-F2 (SEQ ID NO: 11): CCATACTCCCCGCAGTCATCTA

[0086] CADV1-R2 (SEQ ID NO: 12): AGTTCCTTGCCAGCCTCTGC

[0087] CADV2-P1 (SEQ ID NO: 14): 5'-FAM-TCCAGCCTCCCGCAACCACC-BHQ1-3'

[0088] CADV2-F1 (SEQ ID NO: 15): CCGTGATTAACGAACAGTTGCA

[0089] CADV2-R1 (SEQ ID NO: 16): GTTTTGGAAAGAGGCTCGTTGT

[0090] CADV2-P2 (SEQ ID NO: 18): 5'-ROX-TCCTTGTCAGTGTCCACCGTTTGGC-BHQ2-3'

[0091] CADV2-F2 (SEQ ID NO: 19): TGGGTGGGATAAATACCACATTTC

[0092] CADV2-R2 (SEQ ID NO: 20): AGCATTGTAGTGCAGACCTTTTGT

[0093] In order to further improve the convenience of the reagent detection, in some preferred embodiments, the above reagent also includes at least one of the following: qPCR premix, the qPCR premix includes qPCR buffer and AK Taq DNA polymerase, preferably, the concentration of AKTaq DNA polymerase is 5U / μL. The specific qPCR buffer can be selected from existing known products for application. It will not be described in detail here. It should be noted that the DNA polymerase used in the qPCR premix is ​​AK Taq DNA polymerase produced by Feipeng Biology, and the use of other DNA polymerases with similar efficacy is not excluded here.

[0094] In a typical embodiment of the present application, the reagent also includes a positive control and a negative control, wherein the positive control is a gene fragment containing the object to be detected. In a preferred embodiment of the present application, the above-mentioned positive control is canine adenovirus universal amplification fragment SEQ ID NO: 1, canine adenovirus type 1-amplification fragment 1 SEQ ID NO: 5, canine adenovirus type 1 typing-amplification fragment 2 SEQ ID NO: 9, canine adenovirus type 2-amplification fragment 1 SEQ ID NO: 13 and canine adenovirus type 2-amplification fragment 2 SEQ ID NO: 17. The negative control in the reagent is a plasmid that does not contain the target gene fragment, and the target fragment will not be amplified. Preferably, the negative control is deionized water.

[0095] Among them, the universal amplification fragment of canine adenovirus is (Hexon gene):

[0096] CGTCGATGCTGCCACAATGGTCTTACATGCACATTGCTGGCCAGGACGCCGCCGAATACT TGTCTCCCGCCCTGGTTCAGTTTGCCCAAGCAACCA (SEQ ID NO: 1)

[0097] Canine adenovirus type 1 - Amplified segment 1 is (Hexon gene):

[0098] TTAAGCAGCGGGAAACTCCAGCCCTGGGCTCACCTTACGACCCCTACTTTACTTACTCGGGTAGCATTCCC (SEQ ID NO: 5)

[0099] Canine adenovirus type 1 - Amplified fragment 2 is (full genome):

[0100] CCATACTCCCCGCAGTCATCTAATATGCCCGTGACCGCSCCTGTAAGGAGCAGAGGCTGGCAAGGAACT (SEQ ID NO: 9)

[0101] Canine adenovirus type 2 - amplified fragment 1 is (FIBER gene):

[0102] CCGTGATTAACGAACAGTTGCAAGCTGTCCAGCCTCCCGCAACCACCTACAACGAGCCTTCTTCCAAAACTGAC (SEQ ID NO: 13)

[0103] Canine adenovirus type 2 - Amplified fragment 2 is (full genome):

[0104] TGCTTGGGTGGGATAAATACCACATTTCCCTCCTTGTCAGTGTCCACCGTTTGGCCACAAAAGGTCTGCACTACAATGCTCCC (SEQ ID NO: 17)

[0105] According to a typical embodiment of the present application, a kit for detecting canine adenovirus and / or typing is provided, and the kit comprises the above-mentioned reagent for detecting canine adenovirus and / or typing of the present invention.

[0106] According to a typical embodiment of the present application, a system for detecting canine adenovirus and / or typing is provided. The system includes a nucleic acid extraction device, a detection device and a data analysis device, wherein the nucleic acid extraction device is configured to extract sample nucleic acid, the detection device includes a real-time fluorescence quantitative PCR analyzer and any of the above-mentioned reagents for detecting canine adenovirus and / or typing of the present invention, and the data analysis device is configured to analyze the data file of the real-time fluorescence quantitative PCR analyzer and output the result.

[0107] Preferably, the program setting of the real-time fluorescence quantitative PCR analyzer is as follows: pre-denaturation treatment is 92-98°C, 30s-90s; denaturation treatment is 92-98°C, 2-8s, annealing / collecting fluorescence signal treatment is 58-62°C, 8-12s, and 40-44 cycles.

[0108] According to a typical embodiment of the present application, a method for detecting canine adenovirus and / or typing by fluorescent quantitative PCR is provided, and the method comprises using the above-mentioned primer-probe combination or the above-mentioned reagent to perform fluorescent quantitative PCR detection.

[0109] In some preferred embodiments, the conditions for fluorescence quantitative PCR detection are: pre-denaturation at 92-98°C (preferably 95-98°C) for 30s-90s (preferably 30s-60s); denaturation treatment at 95-98°C for 2-8s (preferably 2-5s), 58-62°C (preferably 59-61°C), annealing for 8-12s or collecting fluorescence signal processing, for a total of 40-44 cycles.

[0110] In some more preferred embodiments, the conditions for fluorescence quantitative PCR detection are: pre-denaturation at 95°C for 1 min; denaturation at 95°C for 5 s, annealing at 60°C for 10 s or collecting fluorescence signal processing, for a total of 42 cycles.

[0111] According to a typical embodiment of the present application, the application of the above reagent or system in canine adenovirus detection is provided. The present application uses primers or primer-probe combinations that can identify canine adenovirus to amplify target fragments from canine eye, nasopharyngeal swabs and other suspicious samples, which is fast and efficient, with accurate results and controllable costs, and better meets the needs of subsequent clinical applications.

[0112] The beneficial effects of the present application will be further explained in detail below in conjunction with specific examples. It should be noted that the primers in the following examples are synthesized by Sangon Biotech (Shanghai) Co., Ltd. Unless otherwise specified, the relevant reagents are all from commercially available products.

[0113] The reagents, amplification systems and procedures used in the following examples are as follows:

[0114] The canine adenovirus and / or typing nucleic acid detection kit includes the following components:

[0115] (I) qPCR premix: main components are 2×qPCR Mix, AK Taq enzyme (5U / μl) (Guangdong Runpeng Biotechnology);

[0116] (ii) Forward primer F, reverse primer R and probe P:

[0117] Universal primers CADV-F1, CADV-R1 and probe CADV-P1; canine adenovirus type 1 primers CADV1-F1, CADV1-F2, CADV1-R1, CADV1-R2 and probes CADV1-P1, CADV1-P2; canine adenovirus type 2 primers CADV2-F1, CADV2-F2, CADV2-R1, CADV2-R2 and probes CADV2-P1, CADV2-P2;

[0118] (III) Positive control: The positive control is a recombinant plasmid containing the target gene fragment. The CADV universal plasmid contains the universal canine adenovirus amplicon fragment, and the CADV1 / 2 plasmid contains the specific amplicon fragments targeted by the typing design of the two subtypes respectively;

[0119] (iv) Negative control: deionized water.

[0120] The amplification system is shown in Table 1:

[0121]

[0122]

[0123] Reaction procedure:

[0124] Pre-denaturation treatment was 95°C, 1 min; denaturation treatment was 95°C, 5 s, and annealing / fluorescence signal collection treatment was 60°C, 10 s, for 42 cycles.

[0125] Example 1: Primer screening for canine adenovirus type 2-target 1 and target 2

[0126] The recombinant plasmid CADV1 / 2 containing the amplified fragment synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. was used. The plasmid contained SEQ ID NO: 13 and SEQ ID NO: 17. The plasmid concentration was measured using a NanoDrop 2000C (Thermo Scientific, America) ultramicro spectrophotometer and converted into copies / mL as a plasmid standard. The constructed plasmid standard was diluted 10-fold in three gradients and then diluted 5-fold in three gradients, for a total of 6 concentration gradients, for screening primers for the two targets. A 25 μL Real-time PCR reaction system was established and the PCR was performed on an Applied Biosystems.TM The DNA was amplified on a 7500 real-time fluorescence quantitative PCR system.

[0127] CADV2-F1 (SEQ ID NO: 15): CCGTGATTAACGAACAGTTGCA

[0128] CADV2-F3 (SEQ ID NO: 21): GTGATTAACGAACAGTTGCAAGCT

[0129] CADV2-R1 (SEQ ID NO: 16): GTTTTGGAAAGAGGCTCGTTGT

[0130] CADV2-R3 (SEQ ID NO: 22): GTCAGTTTTGGAAAGAGGCTCG

[0131] Then, the upstream and downstream primers were cross-combined to form a total of four primer combinations (different primer combinations were matched with equal amounts of CADV2-P1 probes). A 25μL Real-time PCR reaction system was established and the fully automatic medical PCR analysis system of Shanghai Hongshi Medical Technology Co., Ltd. Amplify on.

[0132] The amplification curves of the above four different primer combinations were analyzed (see Figures 1 to 4 ), the results showed that all four primer combinations targeting canine adenovirus type 2-amplified fragment 1 could be effectively amplified, and two sets of primer combinations with relatively better amplification effects were preliminarily screened out for subsequent dual-target combination pairing: P1-F1-R1 (probe CADV2-P1, combination of primers CADV2-F1 and CADV2-R1, other names also follow this rule) and P1-F3-R1 (probe CADV2-P1, combination of primers CADV2-F3 and CADV2-R1).

[0133] Two upstream primers CADV2-F2 and CADV2-F4 and two downstream primers CADV2-R2 and CADV2-R4 were designed and synthesized for canine adenovirus type 2-amplified fragment 2. The specific sequence information is as follows:

[0134] CADV2-F2 (SEQ ID NO: 19): TGGGTGGGATAAATACCACATTTC

[0135] CADV2-F4 (SEQ ID NO: 23): TGCTTGGGTGGGATAAATACCCA

[0136] CADV2-R2 (SEQ ID NO: 20): AGCATTGTAGTGCAGACCTTTTGT

[0137] CADV2-R4 (SEQ ID NO: 24):GGGAGCATTGTAGTGCAGACCT

[0138] Then, the upstream and downstream primers were cross-combined to form a total of four primer combinations (different primer combinations were matched with equal amounts of CADV2-P2 probes). A 25μL Real-time PCR reaction system was established and the fully automatic medical PCR analysis system of Shanghai Hongshi Medical Technology Co., Ltd. Amplify on.

[0139] The amplification curves of the above four different primer combinations were analyzed (see Figures 5 to 8 ), the results showed that all four primer combinations targeting canine adenovirus type 2-amplified fragment 2 could be effectively amplified, and two sets of primer combinations with relatively better amplification effects were preliminarily screened out for subsequent dual-target combination pairing: P2-F2-R2 (probe CADV2-P2, a combination of primers CADV2-F2 and CADV2-R2, other names are similar) and P2-F2-R4 (probe CADV2-P2, a combination of primers CADV2-F2 and CADV2-R4).

[0140] Example 2: Screening of primer-probe combinations for dual-target detection of canine adenovirus type 2

[0141] Outsourcing America Vaccines (canine distemper, adenovirus type 2, parainfluenza, and parvovirus) were reconstituted and diluted to medium and low concentrations, and extracted using a viral DNA / RNA extraction kit (magnetic bead method) (Guangdong Runpeng Biological, RK1001). The specific operation steps were carried out according to the instructions; ddH 2 O is the negative control.

[0142] The two sets of primer probes "P1-F1-R1" and "P1-F3-R1" with relatively better amplification effect of target 1 obtained in Example 1, and the two sets of primer probes "P2-F2-R2" and "P2-F2-R4" with relatively better amplification effect of target 2, were combined in pairs to obtain four primer probe combinations for dual-target detection of canine adenovirus type 2:

[0143] Table 2

[0144]

[0145]

[0146] Set up a 25 μL real-time PCR reaction system at Applied Biosystems TM The DNA was amplified on a 7500 real-time fluorescence quantitative PCR system.

[0147] The amplification curves of the above four primer-probe combinations were analyzed (see Figures 9 to 12 ), the results showed that the four primer-probe combinations for dual-target detection of canine adenovirus type 2 can all be effectively amplified, and the dual-target primer-probe combinations with the best amplification effect were determined to be: "P1-F1-R1" and "P2-F2-R2".

[0148] Example 3: Linear Detection

[0149] The recombinant plasmids CADV Universal and CADV1 / 2 containing the amplified fragment synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. were measured for plasmid concentration using NanoDrop 2000C (Thermo Scientific, America) ultra-micro spectrophotometer and converted into copies / mL as plasmid standards. The constructed plasmid standards were diluted 10-fold in five gradients to prepare the standard curve. A 25 μL Real-time PCR reaction system was established and the results were analyzed using an Applied Biosystems PCR system. TM The amplification was performed on the 7500 real-time fluorescence quantitative PCR system. After the reaction was completed, a standard curve was prepared using EXCEL.

[0150] The linear performance test was performed using CADV universal plasmid at a concentration of 10^7 to 10^3 copies / mL (see Fig.13 For the design suitable for CADV universal type, the amplification efficiency Efficiency = 103.2%, the correlation coefficient R2 = 0.994, indicating that there is a good linear relationship between the Ct value and the standard, y = -3.248x + 47.57 (see Fig.14 ).

[0151] The linearity test was performed using CADV1 plasmids at concentrations of 10^9 to 10^5 copies / mL (see Fig.15 ). Among them, for the dual-target design for canine adenovirus type 1, target 1: amplification efficiency Efficiency = 101.0%, correlation coefficient R2 = 0.997, indicating that there is a good linear relationship between the Ct value and the standard, y = -3.299x + 44.44; target 2: amplification efficiency Efficiency = 104.6%, correlation coefficient R2 = 0.995, indicating that there is a good linear relationship between the Ct value and the standard, y = -3.217x + 44.26 (see Figure 16-1 and Figure 16-2).

[0152] In addition, the linear performance test was performed using CADV2 plasmids at concentrations of 10^8 to 10^4 copies / mL (see Fig.17 ). For the dual-target design for canine adenovirus type 2, target 1: amplification efficiency Efficiency = 104.9%, correlation coefficient R2 = 0.997, indicating that there is a good linear relationship between the Ct value and the standard, y = -3.211x + 44.59; target 2: amplification efficiency Efficiency = 104.8%, correlation coefficient R2 = 0.998, indicating that there is a good linear relationship between the Ct value and the standard, y = -3.213x + 45.23 (see Figure 18-1 and Figure 18-2 ).

[0153] Example 4: Non-specific (NTC, other pathogens)

[0154] The kit designed in the present invention for detecting canine adenovirus or typing is used with ddH 2 O is a negative control, and the reaction parameters in the present invention are run to obtain a Realtime PCR amplification curve through computer analysis software. The negative control is tested 20 times to determine whether all primer-probe design combinations are non-specifically amplified.

[0155] Set up a 25 μL real-time PCR reaction system at Applied Biosystems TM The DNA was amplified on a 7500 real-time fluorescence quantitative PCR system.

[0156] The results showed that the universal primers CADV-F1, CADV-R1 and probe CADV-P1 ( Fig.19 ); canine adenovirus type 1 primers CADV1-F1, CADV1-F2, CADV1-R1, CADV1-R2 and probes CADV1-P1, CADV1-P2 ( Fig. 20 ); and canine adenovirus type 2 primers CADV2-F1, CADV2-F2, CADV2-R1, CADV2-R2 and probes CADV2-P1, CADV2-P2, no nonspecific amplification was observed after combination ( Fig.21 ).

[0157] In addition, nasopharyngeal swab samples from dogs with Bordetella bronchiseptica and Mycoplasma canis were used as test samples, and the viral DNA / RNA extraction kit (magnetic bead method) (Guangdong Runpeng Biology, RK1001) was used for extraction. The specific operation steps were carried out according to the instructions. The recombinant plasmid was used as a positive control, and ddH 2O is a negative control. The reaction parameters of the present invention are run, and a Realtime PCR amplification curve is obtained by computer analysis software, which is compared with the PCR amplification curve of the positive control to determine whether there is cross-amplification of the non-canine adenovirus full genome, FIBER gene and Hexon gene sequence.

[0158] Set up a 25 μL real-time PCR reaction system at Applied Biosystems TM 7500 real-time fluorescence quantitative PCR system ( Figures 22-24 ).

[0159] The results showed that the kit of the present invention had no cross amplification against Bordetella bronchiseptica and Mycoplasma canis.

[0160] Example 5: Clinical sample comparison test

[0161] First, the CADV universal detection kit assembled in the present invention is used to perform a clinical sample comparison test. The extraction is performed using a viral DNA / RNA extraction kit (magnetic bead method) (Guangdong Runpeng Biology), and the specific operating steps are performed with reference to the instructions. 10 canine eye and nasopharyngeal swab samples that have been clinically diagnosed and confirmed to be infected with canine adenovirus were used as tested samples, including: 3 canine adenovirus-positive samples and 7 canine adenovirus-negative samples. Run the reaction parameters in the present invention, obtain the Realtime PCR amplification curve through computer analysis software, and compare it with the clinical diagnosis results of clinical samples to determine whether the CADV universal detection kit can accurately detect clinical samples.

[0162] Set up a 25 μL real-time PCR reaction system at Applied Biosystems TM The DNA was amplified on a 7500 real-time fluorescence quantitative PCR system.

[0163] The results are shown in Table 3 and Fig.25 .

[0164] Table 3

[0165]

[0166]

[0167] Note: Positive and negative judgment:

[0168] 1) The ROX channel has an obvious S-shaped amplification curve and the Ct value is ≤37, which is considered positive;

[0169] 2) There is no amplification curve in the ROX channel or the Ct value is greater than 37, and the Ct value of the CY5 channel is ≤37, which is judged as negative.

[0170] 3) There is no amplification curve in the CY5 channel, and no amplification curve in other channels. The test results are invalid and need to be repeated.

[0171] The results showed that after testing, the CADV universal detection kit detected 3 positive samples, namely samples 2, 6, and 8; and 7 negative samples, namely samples 1, 3, 4, 5, 7, 9, and 10. The test results were consistent with the original clinical diagnosis results of the samples, and the positive and negative coincidence rates were both 100%.

[0172] Then, for the above-mentioned 10 canine adenovirus clinical samples, canine adenovirus type 1 (dual target) and canine adenovirus type 2 (dual target) detection kits were used, and two control kits (Gangzhu Medical) for detecting canine adenovirus type 1 and canine adenovirus type 2 were used to perform a comparison test of clinical samples. Clinical samples were extracted using a viral DNA / RNA extraction kit (magnetic bead method) (Guangdong Runpeng Biology), and the specific operation steps were carried out with reference to the instructions. The reaction parameters in the present invention were run, and the Realtime PCR amplification curve was obtained by computer analysis software, which was compared with the clinical diagnosis results of clinical samples to determine whether the CADV detection kit can accurately detect clinical samples.

[0173] Set up a 25 μL real-time PCR reaction system at Applied Biosystems TM The DNA was amplified on a 7500 real-time fluorescence quantitative PCR system.

[0174] The results show:

[0175] Comparison of the test results of the canine adenovirus type 1 (dual target) detection kit and the canine adenovirus type 1 control kit (Gangzhu Medical, GZP016): This kit detected 2 positive samples, namely sample 2 (Ct values: 33.7, 34.26) and sample 8 (Ct values: 29.82, 30.54); and 8 negative samples, namely 1, 3, 4, 5, 6, 7, 9, and 10. Results are shown in Fig.26 .

[0176] The control kit detected 2 positive samples, namely sample 2 (Ct values: 33.70) and sample 8 (Ct values: 28.02); and 8 negative samples, namely 1, 3, 4, 5, 6, 7, 9, and 10. Fig. 27 .

[0177] The test results of this kit were consistent with those of the control kit, with both the positive and negative coincidence rates being 100%.

[0178] Comparison of the test results of the canine adenovirus type 2 (dual target) detection kit and the canine adenovirus type 2 control kit (Gangzhu Medical, GZP017): This kit detected a positive sample of 1, sample No. 6 (Ct values ​​were: 26.72, 28.47); and detected 9 negative samples, No. 1, 2, 3, 4, 5, 7, 8, 9, and 10. Results are shown in Fig.28 .

[0179] The control kit detected 1 positive sample, sample No. 6 (Ct value: 30.84); and 9 negative samples, No. 1, 2, 3, 4, 5, 7, 8, 9, and 10. The results are shown in Fig.29 .

[0180] The test results of this kit were consistent with those of the control kit, with both the positive and negative coincidence rates being 100%.

[0181] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A reagent for detecting and / or typing canine adenovirus, It is characterized in that The reagent comprises: a reagent for detecting amplified fragment 1 and / or amplified fragment 2 of canine adenovirus type 2, wherein the amplified fragment 1 is selected from any fragment of SEQ ID NO: 13, and the amplified fragment 2 is selected from any fragment of SEQ ID NO:

17.

2. The reagent according to claim 1, It is characterized in that The amplified fragment 1 is selected from any fragment between bases (1-3) to (70-74) in SEQ ID NO: 13; and / or the amplified fragment 2 is selected from any fragment between bases (1-5) to (80-83) in SEQ ID NO:

17.

3. The reagent according to claim 2, It is characterized in that The reagent comprises a primer pair, the nucleotide sequence of the primer pair having a nucleotide sequence complementary to or identical to 20 to 26 consecutive nucleotides between bases (1 to 3) to (70 to 74) of the amplified fragment 1; and / or The reagents include a primer pair, the nucleotide sequence of which has a nucleotide sequence that is complementary or identical to 20 to 26 consecutive nucleotides between bases (1 to 5) to (80 to 83) of the amplified fragment 2.

4. The reagent according to claim 1, It is characterized in that The primer pair for detecting the canine adenovirus universal amplification fragment SEQ ID NO: 1 has the nucleotide sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4; and / or The primer pair for detecting canine adenovirus type 1-amplified fragment 1 SEQ ID NO: 5 has the nucleotide sequences shown in SEQ ID NO: 7 and SEQ ID NO: 8; and / or The primer pair for detecting canine adenovirus type 1-amplified fragment 2 SEQ ID NO: 9 has the nucleotide sequences shown in SEQ ID NO: 11 and SEQ ID NO: 12; and / or The primer pair for detecting canine adenovirus type 2-amplified fragment 1 SEQ ID NO: 13 has the nucleotide sequences shown in SEQ ID NO: 15 and SEQ ID NO: 16; and / or The primer pair for detecting canine adenovirus type 2-amplified fragment 2 SEQ ID NO: 17 has the nucleotide sequences shown in SEQ ID NO: 19 and SEQ ID NO:

20.

5. The reagent according to any one of claims 1 to 4, It is characterized in that The reagent further comprises a probe, wherein the probe comprises the probe for detecting the universal amplified fragment of canine adenovirus SEQ ID NO: 1 and has a nucleotide sequence shown in SEQ ID NO: 2; and / or The probe for detecting canine adenovirus type 1-amplified fragment 1 SEQ ID NO: 5 has a nucleotide sequence shown in SEQ ID NO: 6; and / or The probe for detecting canine adenovirus type 1-amplified fragment 2 SEQ ID NO: 9 has a nucleotide sequence shown in SEQ ID NO: 10; and / or The probe for detecting canine adenovirus type 2-amplified fragment 1 SEQ ID NO: 13 has a nucleotide sequence shown in SEQ ID NO: 14; and / or The probe for detecting canine adenovirus type 2-amplified fragment 2 SEQ ID NO: 17 has a nucleotide sequence shown in SEQ ID NO:

18.

6. The reagent according to claim 5, It is characterized in that The 5' end and 3' end of the probe respectively have a fluorescent reporter group and a fluorescent quencher group; Preferably, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5 or Cy7; the fluorescent quencher group is selected from BHQ, TAMRA, Dabcyl or Eclipse; More preferably, the 5' end of the probe is a FAM group or a ROX group, and the 3' end is a BHQ group.

7. The reagent according to claim 6, It is characterized in that The reagents also include Real time PCR reaction reagents; Preferably, the Real time PCR reaction reagent includes a qPCR premix, and the qPCR premix includes a qPCR buffer and AK Taq DNA polymerase. Preferably, the concentration of the AK Taq DNA polymerase is 5 U / μL.

8. A system for detecting and / or typing canine adenovirus, It is characterized in that include: A nucleic acid extraction device, configured to extract sample nucleic acid; A detection device, comprising a real-time fluorescence quantitative PCR analyzer and a reagent for detecting and / or typing canine adenovirus according to any one of claims 1 to 7; The data analysis device is configured to analyze the data file of the real-time fluorescence quantitative PCR analyzer and output the result.

9. The system according to claim 8, It is characterized in that The program settings of the real-time fluorescence quantitative PCR analyzer are as follows: pre-denaturation treatment at 92-98°C, 30s-90s; denaturation treatment at 92-98°C, 2-8s, annealing / collecting fluorescence signal treatment at 58-62°C, 8-12s, 40-44 cycles.

10. Use of the reagent for detecting and / or typing canine adenovirus according to any one of claims 1 to 7 or the system for detecting and / or typing canine adenovirus according to claim 8 or 9 in detecting and / or typing canine adenovirus.

Citation Information

Patent Citations

  • Nucleic acid composition for detecting multiple respiratory pathogens of dogs as well as kit and method thereof

    CN112609025A