BTK-reducing molecules for treatment of cancer and immune system disorders

Abstract

The present disclosure relates generally to methods of treating diseases or disorders associated with dysfunctional phosphatidylinositol-specific phospholipase C [gamma] 2 (PLC [gamma] 2), such as cancer and immune system disorders, using Bruton's tyrosine kinase (BTK) reducing molecules, such as BTK degrading agent molecules.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application No. 63 / 365,509, filed on May 31, 2022, the entire contents of which are hereby incorporated by reference in their entirety.

[0003] Sequence Listing

[0004] The sequence listing associated with this application is submitted in electronic format as an XML file and is hereby incorporated by reference in its entirety into the specification. The name of the XML file containing the sequence listing is 0437_0002_PCT_SL.xml, and the size of the text file is 11KB.

[0005] FIELD OF THE DISCLOSURE

[0006] The present disclosure generally relates to methods of using Bruton's tyrosine kinase (BTK) reducing molecules, such as BTK degrader molecules, to treat diseases or disorders associated with dysfunctional phosphatidylinositol-specific phospholipase Cγ2 (PLCγ2), such as cancer and immune system disorders.

[0007] BACKGROUND OF THE DISCLOSURE

[0008] B-cell receptor signaling pathway is important for appropriate B cell development, activation, proliferation, differentiation and therefore for adaptive immune response.Phosphotidyl inositol-specific phospholipase Cγ2 (PLCγ2) is a signal transducer activated by a variety of cell surface receptors (including B cell receptor).These receptors recruit kinases, such as tyrosine-protein kinases SYK and LYN, Bruton's tyrosine kinase (BTK) and B-cell junction proteins (BLNK), to phosphorylate and activate PLCγ2, which then produces important second messenger molecules inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG).IP3 and DAG subsequently mediate a variety of biological functions, including cell proliferation, endocytosis and calcium flux.

[0009] Although the interactions and interdependencies between the various components of the B cell receptor pathway are not fully understood, it is generally accepted that the signaling of the B cell receptor pathway depends on activated BTK, which is then transduced to downstream effectors through PLCγ2. Therefore, gain-of-function mutations in downstream PLCγ2 are considered to be one of the main acquired resistance mechanisms to BTK inhibitors in B-cell lymphomas such as chronic lymphocytic leukemia (CLL). See, for example, Woyach et al., J.Clinical Oncology, 2017, 35(13): 1437-1443; Ahn et al., Blood, 2017, 129(11): 1469-1479.

[0010] PLCγ2 dysfunction is also associated with a variety of diseases, including diseases with an immunological basis, such as inflammation, autoimmunity, immunodeficiency and allergy, and hematological malignancies. See, for example, Jackson et al., J. Biol. Chem., 2021, 297(2): 100905. Therefore, manipulation of PLCγ2 activity can be considered a treatment for certain malignancies and immune disorders.

[0011] Therefore, there remains a need for new drugs to treat diseases or disorders associated with PLCγ2 dysfunction.

[0012] Summary of the Disclosure

[0013] The present application demonstrates that BTK reduction or elimination achieved by, for example, proteolytic degradation of BTK or reduction of BTK expression (as distinct from simply inhibiting the catalytic function of BTK) can be used to target and kill cells with constitutively activated PLCγ2. Given the downstream position of PLCγ2 relative to BTK in the signaling cascade and the clinical observation that gain-of-function mutations in PLCγ2 lead to acquired resistance to BTK inhibitors, it is unexpected that BTK reduction molecules can be used to treat diseases or disorders associated with constitutively active PLCγ2.

[0014] Disclosed herein is a method for treating a disease or disorder (such as cancer and immune system disorders) associated with constitutively activated PLCγ2, the method comprising applying an effective amount of Bruton's tyrosine kinase (BTK) to a subject in need thereof to reduce molecules. In certain embodiments, before applying BTK to the subject to reduce molecules, the subject has been determined to have constitutively activated PLCγ2 in one or more cells. In certain embodiments, the method further comprises determining the cells obtained from the subject as having constitutively activated PLCγ2 relative to control cells, or determining the cells obtained from the subject as having one or more functional gain mutations in the gene encoding PLCγ2. In certain embodiments, the subject is a person.

[0015] In certain embodiments, the constitutively activated PLCγ2 in the subject is caused by one or more gain-of-function mutations in the gene encoding PLCγ2, such as a deletion of one or more nucleotides in the gene encoding PLCγ2, or one or more mutations causing substitutions at P139, T168, I169, D334, Y482, N571, P664, R665, S707, A708, S718, R742, L845, L848, D993, D1140, M1141, F1142, or D1144 of PLCγ2 (SEQ ID NO: 1). In certain embodiments, the one or more gain-of-function mutations comprise one or more of the following mutations: P139S, T168A, I169V, D334H, Y482H, N571S, P664S, R665W, S707Y, S707P, S707F, A708P, S718R, R742P, L845F, L845V, L848P, D993Y, D993H, D1140G, D1140Y, D1140N, D1140E, D1140V, M1141L, M1141R, M1141K, F1142L, D1144N, or D1144G of SEQ ID NO: 1, or NO:1 or a deletion of at least amino acids L845-L848 or at least amino acids S707-A708, or a deletion of one or more nucleotides in exons 19-22 of a gene encoding PLCγ2. In certain embodiments, the one or more gain-of-function mutations are located in the regulatory domain and / or calcium binding domain of PLCγ2, such as mutations at amino acids Y482, N571, P664, R665, S707, A708, S718, R742, L845, L848, D1140, M1141, F1142, or D1144 of SEQ ID NO:1.

[0016] In certain embodiments, the disease or disorder associated with constitutively activated PLCγ2 is a cancer, such as a solid tumor or a hematological cancer (e.g., a B-cell malignancy, including, but not limited to, non-Hodgkin's lymphoma (NHL), such as chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), mantle cell lymphoma (MCL), marginal zone lymphoma (MZL) or Waldenstrom's macroglobulinemia (WM)). In certain embodiments, the cancer is resistant to a BTK inhibitor (such as ibrutinib, acalabrutinib, zanubrutinib or tirabrutinib).

[0017] In certain embodiments, the disease or disorder associated with constitutively activated PLCγ2 is an immune system disorder, such as PLCγ2-associated antibody deficiency and immunodysregulation syndrome (PLAID), familial cold autoinflammatory syndrome (FCAS3), autoinflammatory, antibody deficiency and immunodysregulation syndrome (APLAID), or common variable immunodeficiency (CVID).

[0018] In certain embodiments, the BTK reducing molecule is a BTK degrader molecule, such as a compound of Formula I (e.g., Formula IA-IP) disclosed herein. In certain embodiments, the BTK reducing molecule is a nucleic acid inhibitor molecule, such as an antisense oligonucleotide, microRNA, RNAi molecule, antagomiR, aptamer or ribozyme. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate certain embodiments and, together with the written description, serve to explain certain principles of the methods and apparatus disclosed herein.

[0021] Figures 1A-1C Depicted are the effects of conventional small molecule BTK inhibitor ibrutinib and BTK degraders of Formula ID of the present disclosure in inhibiting cancer cell growth in vitro 6 days after administration. Figure 1A : parental REC-1 cells; Figure 1B : Engineered REC-1 cells with PLCγ2S707Y knock-in mutation; Figure 1C : Engineered REC-1 cells with PLCγ2L845F knock-in mutation.

[0022] Figure 2A-2C Depicted are the effects of ibrutinib and the BTK degraders of Formula ID of the present disclosure in inhibiting tumor growth in vivo 14 days after administration. Figure 2A :REC-1 mouse model; Figure 2B :REC-1PLCγ2S707Y Knock-in mouse models; Figure 2C :REC-1PLCγ2 L845F Knock-in mouse model.

[0023] Detailed Description of the Disclosure

[0024] Reference will now be made in detail to various exemplary embodiments, examples of which are illustrated in the accompanying drawings. It should be understood that the following detailed description is provided to provide the reader with a more complete understanding of certain embodiments, features and details of some aspects of the present disclosure, and should not be construed as limiting the scope of the present disclosure.

[0025] definition

[0026] In order to make the present disclosure more easily understood, certain terms are first defined below. The following terms and other definitions of other terms may be set forth through the specification. If the definition of a term described below is inconsistent with the definition in the application or patent incorporated by reference, the definition described in the present application should be used to understand the meaning of the term.

[0027] As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a method" includes one or more methods and / or steps of the type described herein and / or which will become apparent to those skilled in the art upon reading this disclosure and so forth.

[0028] The term "about" is used herein to represent within the typical tolerance range of this field. For example, "about" can be understood as about 2 standard deviations from the mean value. According to certain embodiments, when referring to measurable values ​​such as amounts, "about" is intended to cover changes from ± 20%, ± 10%, ± 5%, ± 1%, ± 0.9%, ± 0.8%, ± 0.7%, ± 0.6%, ± 0.5%, ± 0.4%, ± 0.3%, ± 0.2% or ± 0.1% of a specified value, because such changes are suitable for performing the disclosed method and / or making and using the disclosed device. When "about" appears before a series of numbers or ranges, it should be understood that "about" can modify each number in the series or range.

[0029] As used herein, the term "administering" means directly administering a compound or a pharmaceutically acceptable salt or ester of the compound, or a composition comprising the compound or a pharmaceutically acceptable salt or ester of the compound to a patient.

[0030] As used herein in the specification and in the claims, the term "and / or" should be understood to mean "either or both" of the elements so conjoined, i.e., elements that appear conjoined in some cases and separated in other cases. In addition to the elements expressly identified by the "and / or" clause, other elements may optionally be present, whether related or unrelated to those elements expressly identified, unless expressly indicated to the contrary. Thus, as a non-limiting example, when used in conjunction with open language such as "comprising", a reference to "A and / or B" may, in one embodiment, mean A, but not B (optionally including elements other than B); in another embodiment, mean B, but not A (optionally including elements other than A); in another embodiment, mean A and B (optionally including other elements); etc.

[0031] The term "at least" (e.g., "at least two") preceding a number or a series of numbers should be understood to include the numbers adjacent to the term "at least", as well as all subsequent numbers or integers that can be logically included as clearly seen from the context. When "at least" appears before a series of numbers or a range, it should be understood that "at least" can modify each number in the series or range.

[0032] The terms "disease," "disorder," and "condition" are used interchangeably herein.

[0033] As used herein, the term "in certain embodiments" refers to embodiments of all aspects of the present disclosure, unless the context clearly dictates otherwise.

[0034] The term "BTK reducing molecule" as used herein means a molecule that reduces or eliminates the amount of BTK, which is different from a molecule that may inhibit BTK function (e.g., a BTK inhibitor that inhibits kinase activity) but does not reduce the amount of BTK. Reducing or eliminating the amount of BTK will not only reduce or eliminate the kinase activity of BTK, but also reduce or eliminate the ability of BTK to interact with other molecules (including other molecules in the signaling cascade, such as PLCγ2).

[0035] As used herein and defined above, "BTK degrader molecule" refers to a molecule that reduces or eliminates the amount of BTK by inducing proteolytic degradation of BTK. In certain embodiments, the BTK degrader molecule of the present disclosure is a chimera targeted for proteolysis.

[0036] As used herein, "BTK inhibitor" refers to a molecule that blocks the catalytic function of BTK, for example, by binding to the catalytic region of the kinase. Because BTK inhibitors only block the catalytic function of BTK, but otherwise do not reduce or eliminate the amount of BTK in cells, "BTK inhibitors" as used herein are not "BTK reducing molecules" or "BTK degrader molecules" as defined herein. Examples of BTK inhibitors include, but are not limited to, ibrutinib, acalabrutinib, zanubrutinib, and tirabrutinib.

[0037] As used herein, an "effective amount" of a compound means an amount sufficient to elicit a desired biological response. One of ordinary skill in the art will appreciate that the effective amount of a compound or molecule of the present disclosure may vary with factors such as the desired biological endpoint, the pharmacokinetics of the compound, the disease being treated, the mode of administration, and the age, health, and condition of the subject. An effective amount includes both therapeutic and prophylactic treatments.

[0038] The term "gain of function mutation" as used herein refers to any mutation in a gene, wherein the protein encoded by the gene (i.e., mutant protein) obtains a function that is generally not associated with the normal wild-type protein. A gain of function mutation can be a deletion, addition or substitution of one or more nucleotides in a gene, which results in a change in the function of the encoded protein. In certain embodiments, the gain of function mutation changes the function of the mutant protein or causes an interaction with other proteins. In other embodiments, the gain of function mutation causes a reduction or removal of a normal wild-type protein, for example, by the interaction of the altered mutant protein with the normal wild-type protein. In the context of the present disclosure, in certain embodiments, PLCγ2 mutants that exhibit higher PLCγ2 activity than normal, wild-type PLCγ2 are considered to be gain-of-function mutants and can be identified as such using an assay suitable for detecting PLCγ2 activity, such as the assay described by Everett et al. (J. Biol. Chem., 2009, 284(34): 23083-23093) for analyzing phosphoinositide formation in COS-7 cells transfected with wild-type or mutant PLCγ2, or the assays described by Woyach et al. (N. Engl. J. Med., 2014, 370: 2286-2294) and Novice et al. (J. Clin. Immunology, 2020, 40: 267-276), all of which are incorporated herein by reference in their entirety. Functional gain mutations in PLCγ2 generally result in higher levels of phospholipase activity compared to suitable control cells, as measured using suitable cell assays, such as described in Novice et al. (J.Clin.Immunology, 2020, 40: 267-276). However, in some cases, as has been observed in some non-malignant immune cells, functional gain mutations in PLCγ2 that lead to constitutively activated PLCγ2 may result in reduced PLCγ2-dependent signaling and function. This loss of PLCγ2 downstream function in some immune cells may be a direct result of chronic signaling caused by functional gain mutations in PLCγ2, which is similar to how chronic B cell receptor stimulation leads to reduced amplitude calcium flow, changes in signaling cascades, and ultimately leads to proliferation incompetence (Ombrello et al., N.Engl.J.Med., 2012, 366: 330-338).However, in these cases where gain-of-function mutations in PLCγ2 result in reduced PLCγ2-dependent signaling and function, the PLCγ2 mutant may still be identified as a gain-of-function mutation if it exhibits higher PLCγ2 activity than normal, wild-type PLCγ2 in an assay for analyzing phosphoinositide formation in COS-7 cells transfected with wild-type or mutant PLCγ2 (as described by Everett et al. (J. Biol. Chem., 2009, 284(34):23083-23093)) or in DT40 cells stably expressing wild-type or mutant PLCγ2 (as described by Woyach et al. (N. Engl. J. Med., 2014, 370:2286-2294)).

[0039] The term "identity" or "identical" as known in the art refers to the relationship between two or more polypeptide sequences or two or more polynucleotide sequences determined by comparing the sequences. In the art, "identity" or "identical" also refers to the degree of sequence relatedness between polypeptide or polynucleotide sequences, as determined by the match between such sequence strings. "Identity" and "similarity" can be readily calculated by known methods, including, but not limited to, those described in Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., Siam J. Applied Math., 48:1073 (1988). Typical methods for determining identity are intended to produce the maximum match between the sequences tested. Methods for determining identity and similarity are incorporated into publicly available computer programs. Typical computer program methods for determining identity and similarity between two sequences include, but are not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research 12 (1): 387 (1984)), BLASTP, BLASTN and FASTA (Atschul, SF et al., J. Molec. Biol. 215: 403-410 (1990). BLAST X programs are publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBINLM NIH Bethesda, Md. 20894: Altschul, S., et al., J. Mol. Biol. 215: 403-410 (1990).The well-known Smith Waterman algorithm can also be used to determine identity.

[0040] As used herein, "pharmaceutically acceptable carrier" means a non-toxic carrier, adjuvant or vehicle that does not destroy the pharmacological activity of the compound formulated therewith. Pharmaceutically acceptable carriers, adjuvants or vehicles that can be used in the compositions described herein include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silicon dioxide, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block copolymers, polyethylene glycol and lanolin.

[0041] As used herein, "pharmaceutically acceptable salts" means salts that are suitable for contact with human and lower animal tissues within the scope of reasonable medical judgment, without undue toxicity, irritation, allergic response, etc., and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66: 1-19. Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are salts formed of an amino group with an inorganic acid such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid, or an organic acid such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid, or by using other methods used in the art (such as ion exchange). Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like. Pharmaceutically acceptable salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N + (C 1-4 alkyl) 4 Salts. Representative alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. Other pharmaceutically acceptable salts include, where appropriate, non-toxic ammonium, quaternary ammonium and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkyl sulfonates and aryl sulfonates.

[0042] As used herein, a "subject" contemplated for administration includes, but is not limited to, humans (i.e., males or females of any age group, e.g., pediatric subjects (e.g., infants, children, adolescents) or adult subjects (e.g., young adults, middle-aged adults, or elderly adults)) and / or non-human animals, e.g., mammals such as primates (e.g., cynomolgus monkeys, rhesus monkeys), cattle, pigs, horses, sheep, goats, rodents, cats, and / or dogs. In certain embodiments, the subject is a human. In certain embodiments, the subject is a non-human animal. The terms "human," "patient," and "subject" are used interchangeably herein.

[0043] As used herein, the terms "target nucleic acid sequence," "target region," "target gene," and the like are used interchangeably and refer to an RNA or DNA sequence that is "targeted," e.g., for cleavage mediated by a nucleic acid inhibitor molecule that contains a nucleic acid sequence that is partially, substantially, completely or sufficiently complementary to the target sequence.

[0044] As used herein, and unless otherwise indicated, a "therapeutically effective amount" of a compound is an amount sufficient to provide a therapeutic benefit in the treatment of a disease, disorder, or condition, or to delay or minimize one or more symptoms associated with the disease, disorder, or condition. A therapeutically effective amount of a compound refers to an amount of a therapeutic agent, alone or in combination with other therapies, that provides a therapeutic benefit in the treatment of a disease, disorder, or condition. The term "therapeutically effective amount" may include an amount that improves overall treatment, reduces or avoids symptoms or causes of a disease or condition, or enhances the therapeutic effect of another therapeutic agent.

[0045] The embodiments disclosed herein are not intended to be limited in any way by the above exemplary lists of chemical groups and substituents. Those skilled in the art will recognize that several embodiments are possible within the scope and spirit of the present disclosure. The following description illustrates the present disclosure and certainly should not be interpreted in any way as limiting the scope of the invention described herein.

[0046] Treatment

[0047] Provided herein is a method for treating a disease or disorder associated with constitutively activated PLCγ2 by administering an effective amount of BTK to a subject in need thereof to reduce a molecule.PLCγ2 plays an important role in both the adaptive immune system and the innate immune system.Particularly in the adaptive immune system, PLCγ2 plays a fundamental role in B cell development, thereby affecting the survival and antibody production of mature B cells, and is also a constitutive and adjacent component of the B cell receptor (BCR) signaling cascade, which occurs when BCR is combined with its cognate antigen and stimulated.In addition to BCR engagement, there are alternative signaling pathways such as CD38, CD40, IL-4R initiated by extracellular immunology receptors, which also rely on PLCγ2 to transduce signals.

[0048] The application confirms that the reduction or elimination of BTK achieved by, for example, proteolytic degradation of BTK or reduction of BTK expression (different from simply inhibiting the catalytic function of BTK) is synthetically lethal for cells with constitutively activated PLCγ2. Unexpectedly, BTK reduction molecules can be used to treat obstacles with constitutively active PLCγ2, especially when functional gain mutations in PLCγ2 are considered to be one of the main acquired resistance mechanisms to therapeutic BTK inhibitors in B-cell lymphomas. See, for example, Woyach et al., J.Clinical Oncology, 2017, 35(13): 1437-1443; Ahn et al., Blood, 2017, 129(11): 1469-1479. In view of the downstream position of PLCγ2 relative to BTK in the signal transduction cascade and the clinical observation that the functional gain mutation in PLCγ2 leads to acquired resistance to BTK inhibitors, those skilled in the art would not expect that reducing or eliminating the amount of BTK in the cell would have any effect on constitutively active PLCγ2. Without wishing to be bound by any theory, it seems that reducing or eliminating the amount of BTK will not only reduce or eliminate the kinase activity of BTK, but also reduce or eliminate BTK-mediated scaffold interactions with other molecules (such as PLCγ2) in the signal transduction cascade.

[0049] Since PLCγ2 dysfunction has been associated with a variety of diseases, including those with an immunological basis such as inflammation, autoimmunity, immunodeficiency and allergy, as well as hematological malignancies (Jackson et al., J. Biol. Chem., 2021, 297(2):100905), this finding has important implications for the treatment of diseases or disorders associated with constitutively activated PLCγ2, such as cancer and immune system disorders.

[0050] Thus, in one aspect, the disclosure provides the use of a BTK reducing molecule for treating a disease or disorder associated with constitutively activated PLCγ2 in a subject in need thereof.

[0051] In another aspect, the disclosure provides use of a BTK reducing molecule in the preparation of a medicament for treating a disease or disorder associated with constitutively activated PLCγ2 in a subject in need thereof.

[0052] In another aspect, the disclosure provides a method of treating a disease or disorder associated with constitutively activated PLCγ2, the method comprising administering to a subject in need thereof an effective amount of a BTK reducing molecule. In certain embodiments, the subject does not have a mutation in the BTK gene.

[0053] In certain embodiments, the disease or disorder associated with constitutively activated PLCγ2 is cancer, such as hematological cancer or solid tumor. In certain embodiments, the cancer is resistant to BTK inhibitors (such as ibrutinib, acalabrutinib, zanubrutinib or tirabrutinib). In certain embodiments, the cancer is ibrutinib-resistant. In certain embodiments, the disease or disorder associated with constitutively activated PLCγ2 is an immune system disorder.

[0054] Hematological cancers (such as B-cell malignancies) may include, but are not limited to, leukemias, lymphomas, B-cell lymphomas, non-Hodgkin's lymphoma (NHL), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), mantle cell lymphoma (MCL), marginal zone lymphoma (MZL), Waldenstrom's macroglobulinemia (WM), transformed CLL or Richter's transformation, diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL), central nervous system (CNS) lymphoma, endemic Burkitt's lymphoma (EBL) and mucosa-associated lymphoid tissue (MALT)-related gastric lymphoma, Hodgkin's lymphoma (HL) and multiple myeloma (MM). Therefore, in certain embodiments, the disease or disorder associated with constitutively activated PLCγ2 according to the present disclosure is a B-cell malignancy. In certain embodiments, the disease or disorder associated with constitutively activated PLCγ2 according to the present disclosure is leukemia, lymphoma, B-cell lymphoma, NHL, CLL, SLL, MCL, MZL, WM, transformed CLL or Richter's transformation, DLBCL, FL, CNS lymphoma, EBL, MALT-associated gastric lymphoma, HL or MM. In certain embodiments, the disease or disorder associated with constitutively active PLCγ2 according to the present disclosure is CLL, SLL, MCL, MZL or WM.

[0055] Solid tumors may include, but are not limited to, skin cancer, bladder cancer, breast cancer, uterine cancer, ovarian cancer, urothelial cancer, prostate cancer, lung cancer, colorectal cancer, cervical cancer, liver cancer, head and neck cancer, pancreatic cancer, kidney cancer, gastric cancer, brain cancer, sarcoma, osteosarcoma, esophageal squamous cell carcinoma, esophageal adenocarcinoma, and mesothelioma. Therefore, in certain embodiments, the disease or disorder associated with constitutively activated PLCγ2 according to the present disclosure is skin cancer, bladder cancer, breast cancer, uterine cancer, ovarian cancer, urothelial cancer, prostate cancer, lung cancer, colorectal cancer, cervical cancer, liver cancer, head and neck cancer, pancreatic cancer, kidney cancer, gastric cancer, brain cancer, sarcoma, osteosarcoma, esophageal squamous cell carcinoma, esophageal adenocarcinoma, or mesothelioma. In certain embodiments, the disease or disorder associated with constitutively activated PLCγ2 according to the present disclosure is lung cancer, breast cancer, prostate cancer, colorectal cancer, urothelial cancer, pancreatic cancer, or liver cancer.

[0056] Immune system disorders may include, but are not limited to, allergies, autoinflammatory diseases, chronic inflammatory disorders, autoimmune diseases, rheumatoid arthritis (RA), osteoarthritis (OA), systemic lupus erythematosus (SLE), multiple sclerosis (MS), Sjögren's syndrome, systemic sclerosis, pemphigus, immune thrombocytopenic purpura (ITP), idiopathic pulmonary fibrosis (IPF), myositis, atopic dermatitis (AD), psoriasis, chronic graft-versus-host disease (GvHD), atherosclerosis, asthma, chronic obstructive pulmonary disease (COPD) and inflammatory bowel disease (IBD). Immune system disorders caused by PLCγ2 dysfunction (especially constitutively activated PLCγ2) may include, but are not limited to PLCγ2-related antibody deficiency and immune dysregulation syndrome (PLAID), familial cold autoinflammatory syndrome 3 (FCAS3), autoinflammation, antibody deficiency and immune dysregulation syndrome (APLAID), common variable immunodeficiency (CVID). Therefore, in certain embodiments, the disease or disorder associated with constitutively activated PLCγ2 according to the present disclosure is allergy, autoinflammatory disease, chronic inflammatory disorder, autoimmune disease, autoinflammatory disease, chronic inflammatory disorder, RA, OA, SLE, MS, Sjogren's syndrome, systemic sclerosis, ITP, IPF, AD, psoriasis, chronic GvHD, atherosclerosis, asthma, COPD or IBD. In certain embodiments, the disease or disorder associated with constitutively activated PLCγ2 according to the present disclosure is PLAID, FCAS3, APLAID or CVID.

[0057] In certain embodiments, before administering a BTK reducing molecule to the subject, the subject has been determined to have constitutively activated PLCγ2 in one or more cells. Therefore, in certain embodiments, the method of the present disclosure further comprises determining the cancer cells or immune cells obtained from the subject as having constitutively activated PLCγ2 relative to control cells. Because the PLCγ2 constitutively activated in cancer cells is due to somatic mutations, the control cells used to determine whether cancer cells have constitutively activated PLCγ2 can be non-cancerous cells obtained from the same subject. On the contrary, because the PLCγ2 constitutively activated in immune cells is due to germline mutations, the control cells used to determine whether immune cells have constitutively activated PLCγ2 can be cells obtained from healthy subjects. "Healthy subjects" used herein means subjects who do not have or are not suspected of having any disease or disorder (especially immune system disorder). Preferably, the cells obtained from healthy subjects are from the same tissue as the immune cells obtained from the subject.

[0058] Thus, in certain embodiments, provided herein are methods for treating cancers associated with constitutively activated PLCγ2 in a subject in need thereof, the methods comprising determining cancer cells obtained from the subject as having constitutively activated PLCγ2 relative to non-cancerous cells obtained from the same subject and administering an effective amount of a BTK reducing molecule to the subject. In certain embodiments, provided herein are methods for treating immune system disorders associated with constitutively activated PLCγ2 in a subject in need thereof, the methods comprising determining immune cells obtained from the subject as having constitutively activated PLCγ2 relative to cells obtained from a healthy subject and administering an effective amount of a BTK reducing molecule to the subject.

[0059] Whether a cell, such as a cancer cell or an immune cell, has constitutively activated PLCγ2 can be determined by any method known in the art. For example, because PLCγ2 catalyzes the activation of the cell membrane lipid phosphatidylinositol 4,5-bisphosphate (PIP 2 ) to generate inositol 3,4,5-triphosphate (IP 3 ) and diacylglycerol (DAG), and thus can be measured by measuring the substrate PIP 2 IP produced by hydrolysis 3 To determine the activity of PLCγ2. Cells with constitutively activated PLCγ2 will have increased production of IP compared to control cells. 3The ability of the cell population to express the active (1,4,5) isomer can be determined using standard chemical or radioactive labeling techniques known in the art. For example, IP can be performed based on isotopic labeling of the cell population followed by extraction and HPLC separation of the active (1,4,5) isomer from the inactive (1,3,4) isomer. 3 Alternatively, a radioreceptor assay can be used to measure IP in a cell population. 3 Absolute mass change of 100 μM (Matsu-ura et al., Journal of Cell Biology, 2006, 173(5):755-765). It can also be used to track intracellular IP in single living cells and cell populations. 3 IP created due to changes 3 Sensors (Gulyás et al., PLoS ONE, 2015, 10(5): e0125601). It is also possible to measure the 3 The level of stimulated calcium flux increases to determine constitutively activated PLCγ2 (Novice et al., J.Clin.Immunology, 2020, 40: 267-276). Other methods for determining PLCγ2 activity are also known in the art, and may include detecting PLCγ2 phosphorylation by using Western blot analysis, immunohistology and / or enzyme assays, or detecting the activity of one or more components of a signaling pathway.

[0060] In certain embodiments, the constitutively activated PLCγ2 is caused by one or more gain-of-function mutations in the gene encoding PLCγ2. Human PLCγ2 (GenBank Accession No. P16885, NP_002652.2) is a multidomain protein of 1265 amino acids in length and having the following amino acid sequence:

[0061]

[0062] The gene encoding human PLCγ2 is located on chromosome 16 and contains 33 exons (HGNC:9066). The mRNA (GenBank accession number NM_002661.5) contains 8666 nucleotides and the coding region is located at nucleotides 182-3979 with the following nucleotide sequence:

[0063]

[0064] Although not shown herein, the complete sequence of this database sequence corresponding to the mRNA encoding PLCγ2 (NM_002661.5) is incorporated herein by reference. The positions of the 33 exons within the mRNA encoding PLCγ2 are as follows:

[0065]

[0066]

[0067] Many gain-of-function mutations in PLCγ2 are known in the art and have been associated with a variety of pathologies. For example, after BTK inhibition (e.g., using the BTK inhibitor ibrutinib) to treat chronic lymphocytic leukemia, somatic gain-of-function mutations in PLCγ2 associated with cancer may occur, resulting in constitutive downstream signaling and lymphocyte proliferation. Such gain-of-function somatic mutations of PLCγ2 associated with cancer may include, but are not limited to, D334H (Maddocks et al., JAMA Oncol., 2015, 1(1):80-87), P664S (Ahn et al., Blood, 2017, 129(11):1469-1479), R665W (Woyach et al., N. Engl. J. Med., 2014, 370:2286-2294), S707Y (Woyach et al., N. Engl. J. Med., 2014, 370:2286-2294), S707P (Maddocks et al., JAMA Oncol., 2015, 1(1):80-87), S707F (Maddocks et al., JAMA Oncol., 2015, 1(1):80-87), Oncol., 2015, 1(1):80-87), A708P (Jones et al., Leukemia, 2017, 31:1645-1647), R742P (Maddocks et al., JAMA Oncol., 2015, 1(1):80-87), L845F (Woyach et al., N. Engl. J. Med., 2014, 370:2286-2294), L845V (Jones et al., Leukemia, 2017, 31:1645-1647), D993Y (Woyach et al., N. Engl. J. Med., 2014, 370:2286-2294), D993H (Jones et al., Leukemia, 2017, 31:1645-1647), D1140G (Maddocks et al., JAMA Oncol., 2015, 1(1):80-87), Oncol., 2015, 1(1):80-87), D1140Y (Jones et al., Leukemia, 2017, 31:1645-1647), D1140N (Jones et al., Leukemia, 2017, 31:1645-1647), D1140E (Jones et al., Leukemia, 2017, 31:1645-1647), D1140V (Jones et al., Leukemia, 2017, 31:1645-1647), M1141R (Burger et al., Nature Communications, 2016, 7: 11589), F1142L (Jones et al., Leukemia, 2017, 31: 1645-1647), M1141K (Burger et al., Nature Communications, 2016, 7: 11589), D1144N (Jones et al., Leukemia, 2017, 31: 1645-1647), D1144G (Jones et al., Leukemia, 2017, 31: 1645-1647) mutations. In addition, cancer-associated gain-of-function mutations caused by partial deletions of the PLCγ2 gene have also been reported, including a 6-nucleotide deletion (c.2120-2125del) in exon 20 of the PLCγ2 gene, which results in the deletion of S707 and A708 of SEQ ID NO: 1 (Ahn et al., Blood, 2017, 129(11): 1469-1479).

[0068] Similarly, inherited gain-of-function germline heterozygous mutations of PLCγ2 that lead to a variety of immune regulatory abnormalities are also known in the art and include, but are not limited to, P139S (Kutukculer et al., Clin. Case Rep., 2021, 9:2023-2031), T168A (Kutukculer et al., Clin. Case Rep., 2021, 9:2023-2031), I169V (Wu et al., Front. Immunol., 2021, 12:667430), Y482H (Kutukculer et al., Clin. Case Rep., 2021, 9:2023-2031), N571S (Kutukculer et al., Clin. Case Rep., 2021, 9:2023-2031), in human PLCγ2 (SEQ ID NO: 1). Rep., 2021, 9: 2023-2031), S707Y (Zhou et al., Am. J. Hum. Genet., 2012, 91: 713-720), S707P (Park et al., European Journal of Medical Genetics, 2022, 65(1): 104387), A708P (Martin-Nalda et al., Annual Meeting of European Society for Immunodeficiencies, 2017), S718R (Kutukculer et al., Clin. Case Rep., 2021, 9: 2023-2031), L848P (Neves et al., Front. Immunol., 2018, 9: 2863; Park et al., European Journal of Medical Genetics, 2022, 65(1): 104387), M1141L (Jackson et al., J. Biol. Chem., 2021, 297(2): 100905), and M1141K (Novice et al., Journal of Clinical Immunology, 2020, 40: 267-276) mutations.In addition, gain-of-function mutations associated with abnormal immune regulation caused by partial deletion of the PLCγ2 gene have also been reported, including exon 19 deletion of SEQ ID NO: 1 (Ombrello et al., N. Engl. J. Med., 2012, 366: 330-338), exon 20-22 deletion (Ombrello et al., N. Engl. J. Med., 2012, 366: 330-338) and deletion of L845 to L848 (Martin-Nalda et al., Annual Meeting of European Society for Immunodeficiencies, 2017).

[0069] Therefore, in certain embodiments, one or more gain-of-function mutations in the gene encoding PLCγ2 that result in constitutively activated PLCγ2 comprise a deletion of one or more nucleotides in the PLCγ2 gene and / or one or more mutations at P139, T168, I169, D334, Y482, N571, P664, R665, S707, A708, S718, R742, L845, L848, D993, D1140, M1141, F1142, or D1144 of SEQ ID NO:1. In certain embodiments, the one or more gain-of-function mutations in the gene encoding PLCγ2 that result in constitutively activated PLCγ2 comprise one or more of the following mutations: P139S, T168A, I169V, D334H, Y482H, N571S, P664S, R665W, S707Y, S707P, S707F, A708P, S718R, R742P, L845F, L845V, L848P, D993Y, D993H, D1140G, D1140Y, D1140N, D1140E, D1140V, M1141L, M1141R, M1141K, F1142L, D1144N, or D1144G of SEQ ID NO: 1, or PLCγ2 (SEQ ID NO: 2 In some embodiments, the deletion is a deletion of at least amino acids S707-A708 of PLCγ2 (SEQ ID NO: 1), or a deletion of at least amino acids L845-L848 of PLCγ2 (SEQ ID NO: 1), or a deletion of one or more nucleotides in exons 19-22 of a gene encoding PLCγ2. In certain embodiments, the deletion is a partial deletion of exons 19-22. In certain embodiments, the deletion is a deletion of the entire exon 19 or exons 20-22. In certain embodiments, the deletion is a complete deletion of the entire exon 19 of the PLCγ2 gene. In certain embodiments, the deletion is a complete deletion of the entire exons 20-22 of the PLCγ2 gene.

[0070] In certain embodiments, the one or more gain-of-function mutations in the gene encoding PLCγ2 that result in constitutively activated PLCγ2 comprise one or more of the following mutations: D334H, P664S, R665W, S707Y, S707P, S707F, A708P, R742P, L845F, L845V, D993Y, D993H, D1140G, D1140Y, D1140N, D1140E, D1140V, M1141R, M1141K, F1142L, D1144N or D1144G of SEQ ID NO:1, or a deletion of at least S707-A708 of PLCγ2 (SEQ ID NO:1), or a deletion of one or more nucleotides in exon 20 of the gene encoding PLCγ2, and the disease or disorder associated with constitutively activated PLCγ2 is cancer. In other embodiments, the one or more gain-of-function mutations in the gene encoding PLCγ2 that result in constitutively activated PLCγ2 comprise one or more of the following mutations: P139S, T168A, I169V, Y482H, N571S, S707Y, S707P, A708P, S718R, L848P, M1141L or M1141K of SEQ ID NO:1, or a deletion of at least amino acids L845-L848 of PLCγ2 (SEQ ID NO:1), or a deletion of one or more nucleotides of exons 19-22 of the gene encoding PLCγ2, such as a complete deletion of the entire exon 19 or a complete deletion of the entire exons 20-22 of the PLCγ2 gene, and the disease or disorder associated with constitutively activated PLCγ2 is an immune system disorder.

[0071] Human PLCγ2 is a multidomain protein characterized by an N-terminal pleckstrin homology (PH) domain (amino acid residues 15-134 of SEQ ID NO: 1), an EF-hand domain (amino acid residues 138-294 of SEQ ID NO: 1), a catalytic domain, and a calcium binding (C2) domain (amino acid residues 1061-1187 of SEQ ID NO: 1). In addition, and specifically for the PLCγ family, PLCγ2 has a specific domain array (γSA) inserted through a loop in the catalytic domain (amino acid residues 320-454 and 928-1027 of SEQ ID NO: 1), which includes a "split PH domain", two SH2 domains (amino acid residues 531-617 and 646-735 of SEQ ID NO: 1) and one SH3 domain (amino acid residues 772-827 of SEQ ID NO: 1). This multi-domain insert in the catalytic domain (amino acid residues 477-907 of SEQ ID NO: 1) constitutes the regulatory domain of PLCγ2. See, for example, Magno et al., Molecular Neurodegeneration, 2121, 16: 22. It has been reported that the genomic deletions (Δ19 and Δ20-22) and APLAID-related somatic mutations that cause PLAID are located in the regulatory domain of PLCγ2 (e.g., S707Y, L848P, A708P of SEQ ID NO: 1) or in the calcium binding domain (e.g., M1141L of SEQ ID NO: 1), and the mutations obtained are present in the regulatory domain of PLCγ2 as a result of BTK inhibition (e.g., S707Y, L845F of SEQ ID NO: 1). See, for example, Jackson et al., J.Biol.Chem., 2021, 297 (2): 100905. Thus, in certain embodiments, one or more functional gain mutations in the gene encoding PLCγ2 of constitutively activated PLCγ2 are located in the regulatory domain and / or calcium binding domain of PLCγ2. "Regulatory domain" and "calcium binding domain" used herein refer to the region located in or immediately adjacent to (e.g., + / -6 amino acid residues) of amino acid residues 477-907 and amino acid residues 1061-1187 of people PLCγ2 (SEQ ID NO:1), respectively. In certain embodiments, one or more functional gain mutations located in the regulatory domain and / or calcium binding domain of PLCγ2 are included in one or more mutations at Y482, N571, P664, R665, S707, A708, S718, R742, L845, L848, D1140, M1141, F1142 or D1144 of SEQ ID NO:1.In certain embodiments, the one or more gain-of-function mutations located within the regulatory domain and / or calcium binding domain of PLCγ2 comprise one or more of the following mutations: Y482H, N571S, P664S, R665W, S707Y, S707P, S707F, A708P, S718R, R742P, L845F, L845V, L848P, D993Y, D993H, D1140G, D1140Y, D1140N, D1140E, D1140V, M1141L, M1141R, M1141K, F1142L, D1144N, or D1144G of SEQ ID NO: 1.

[0072] Gain-of-function mutations in PLCγ2 typically result in constitutive phospholipase activity as measured by standard enzyme assays described elsewhere herein, such as those described in Everett et al. (J. Biol. Chem., 2009, 284(34): 23083-23093), Woyach et al. (N. Engl. J. Med., 2014, 370: 2286-2294), or Novice et al. (J. Clin. Immunology, 2020, 40: 267-276), which in turn may result in a gain-of-function phenotype due to constitutively activated PLCγ2. However, in some cases, such as in some non-malignant immune cells, constitutively activated PLCγ2 may lead to PLCγ2-dependent signaling and functional attenuation, i.e., loss of PLCγ2 downstream function, which may be a direct result of chronic signaling, similar to how chronic B cell receptor stimulation leads to reduced amplitude calcium flow, changes in signaling cascades, and ultimately leads to proliferation anergy (Ombrello et al., N.Engl.J.Med., 2012, 366: 330-338). There are several possible explanations for the fundamental mechanism of the reduction of PLCγ2-mediated signal transduction. For example, increased phospholipase activity may lead to the depletion of one or more substrates, such as substrate PIP2 near PLCγ2, resulting in impaired IP3 production and IP3-mediated calcium release. Alternatively, excessive concentrations of PLCγ2 products may induce feedback-mediated downregulation of distal signaling pathways, resulting in the induction of anergy. Nevertheless, the specific mechanism leading to the reduction of PLCγ2-mediated signal transduction remains to be elucidated. See, Ombrello et al., N. Engl. J. Med., 2012, 366:330-338.

[0073] Thus, in certain embodiments, one or more gain-of-function mutations in PLCγ2 may result in a gain-of-function phenotype in a subject treated by the methods disclosed herein. In other embodiments, one or more gain-of-function mutations in PLCγ2 may result in a loss-of-function phenotype in a subject treated by the methods disclosed herein.

[0074] BTK reduction molecules

[0075] Any molecule that can reduce or eliminate the amount of BTK in a cell can be used as a BTK reducing molecule in any method disclosed herein. Reducing or eliminating the amount of BTK can be achieved in a variety of ways. For example, using a small molecule that can induce proteolytic degradation of BTK (such as a chimera targeted for proteolysis), the amount of BTK can be reduced or eliminated (see, for example, Sakamoto et al., PNAS, 2001, 98: 8554-8559; Sakamoto et al., Methods Enzymol., 2005, 399: 833-847). Alternatively, using a nucleic acid molecule (such as an antisense oligonucleotide, microRNA, ribozyme, antagomir, aptamer or RNAi molecule) that can induce sequence-specific inhibition of BTK gene expression, the amount of BTK can be reduced or eliminated.

[0076] a. BTK degrader molecules

[0077] In one aspect, the BTK reduction molecule of the present disclosure is a BTK degradation agent molecule, such as a small molecule, which reduces or eliminates the amount of BTK by inducing proteolytic degradation of BTK. The chimera targeted for proteolysis is a new strategy for selectively knocking down target proteins with small molecules (Sakamoto et al., PNAS, 2001, 98: 8554-8559; Sakamoto et al., Methods Enzymol., 2005, 399: 833-847). The chimera targeted for proteolysis uses the ubiquitin-protease system to target specific proteins and induce their degradation in cells (Zhou et al., Mol. Cell, 2000, 6 (3): 751-756; Neklesa et al., Pharmacol. Ther., 2017, 174: 138-144; Lu et al., Eur. J. Med. Chem., 2018, 146: 251-259). Thus, in certain embodiments, the BTK degrader molecules of the present disclosure are chimeras targeted for proteolysis.

[0078] In certain embodiments, BTK degrader molecules useful for the methods of the present disclosure are compounds of Formula I described in PCT Application No. PCT / US22 / 14830 (which is hereby incorporated by reference in its entirety):

[0079]

[0080] or a pharmaceutically acceptable salt thereof,

[0081] wherein X is CH or N;

[0082] wherein Y is CH or N;

[0083] Where R 1 Selected from H, C 1 -C 3 Alkyl, C 1 -C 3 haloalkyl, dialkylamino, amino, -CN, hydroxy, C 1 -C 4 Alkoxy and halogen;

[0084] Each R 2 and R 3 are independently selected from H, halogen, -CN, hydroxyl, dialkylamino groups, C 1 -C 5 Alkyl, deuterated C 1 -C 5 Alkyl, C 1 -C 5 Alkoxy, deuterated C 1 -C 5 Alkoxy and C 1 -C 5 Haloalkyl;

[0085] Where Q is LW 1 or LW 2 ;

[0086] wherein L is a linker of 2 to 20 carbon atoms in length, wherein one or more carbon atoms are optionally and independently selected from C(═O), O, N(R 6 )、S、S(O)、SO 2 、C(O)NH、C(O)NCH 3 、C(O)NCH 2 CH 3 , C 2 -Alkenyl, C 2 -alkynyl, cycloalkyl, heterocycloalkyl, heterocycle, aryl or heteroaryl, each of which is independently replaced by 0, 1, 2 or 3 R 7 replace;

[0087] Where W 1 Selected from

[0088]

[0089] Where R4 Selected from H, halogen, -CN, C 1 -C 5 Alkyl, C 1 -C 5 Alkoxy and C 1 -C 5 haloalkyl; and

[0090] Where W 2 yes Where R 5 Selected from H, halogen, -CN, C 1 -C 5 Alkyl, deuterated C 1 -C 5 Alkyl, C 1 -C 5 Alkoxy, deuterated C 1 -C 5 Alkoxy and C 1 -C 5 Haloalkyl;

[0091] Each R 6 Independently selected from H, C 1 -C 3 Alkyl, -C(=O)-(C 1 -C 3 alkyl), -C(=O)-O-(C 1 -C 3 alkyl) and -C(=O)-NH-(C 1 -C 3 alkyl), each of which is replaced by 0, 1, 2 or 3 R 7 replace; and

[0092] Each R 7 are independently selected from halogen, hydroxyl, amino group, C 1 -C 3 Alkyl, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkyl, -N(R 6 ) 2 and -CN.

[0093] In certain embodiments, L in Formula I is 2 to 12 carbon atoms in length, wherein one or more carbon atoms are optionally and independently replaced by a group selected from the group consisting of: C(═O), O, S, S(O), SO 2 、C(O)NH、C(O)NCH 3 、C(O)NCH 2 CH 3 NH, NCH3 、NCH 2 CH3、C 2 -Alkynyl,

[0094]

[0095]

[0096] In certain embodiments, the BTK degrader molecule useful for the methods of the present disclosure is the following compound:

[0097]

[0098]

[0099]

[0100]

[0101]

[0102] or a pharmaceutically acceptable salt thereof. Methods for preparing compounds of Formula I (such as compounds of Formulae IA to IP) are described in PCT Application No. PCT / US22 / 14830, which is hereby incorporated by reference herein in its entirety.

[0103] In certain embodiments, the BTK degrader molecule useful for the methods of the present disclosure is a compound of Formula II described in WO 2021 / 113557 (incorporated herein by reference):

[0104]

[0105] or a pharmaceutically acceptable salt thereof,

[0106] Wherein W is CH or N;

[0107] D is a bond or -NH-;

[0108] Ring A is a phenyl group or a substituted phenyl group;

[0109] Ring B is a 4-6 membered heterocycloalkyl, wherein the heterocycloalkyl may be substituted by halogen, CN and heterocycle, wherein the heterocycle may contain N and / or O;

[0110] L is C 0-12 Linkers, in which each carbon can be -O-, -N(R)-C(O)-, -N(R)-, -C(O)-, -S-, -SO-, SO 2-, -C(O)-N(R)-, 4-6 membered monocyclic cycloalkyl or 4-6 membered monocyclic heterocyclic ring, wherein R can be lower alkyl and lower alkyl substituted by halogen, alkoxy, CN and hydroxyl groups;

[0111] Y is

[0112] In certain embodiments, the BTK degrader molecules useful for the methods of the present disclosure are compounds as described in WO2021 / 113557 (incorporated herein by reference) having the formula:

[0113]

[0114] or a pharmaceutically acceptable salt thereof.

[0115] In certain embodiments, the BTK degrader molecule useful for the methods of the present disclosure is a compound of Formula III described in WO 2020 / 239103 (incorporated herein by reference):

[0116]

[0117] or a pharmaceutically acceptable salt thereof,

[0118] Wherein A, B and C are independent cyclic or heterocyclic structures with a ring size of 4 to 7 atoms, and the heterocyclic structure can be the following:

[0119]

[0120] where Y is

[0121]

[0122] In certain embodiments, the BTK degrader molecule useful for the methods of the present disclosure is a compound having the following formula described in WO2020 / 239103 (incorporated herein by reference):

[0123]

[0124]

[0125] or a pharmaceutically acceptable salt thereof.

[0126] In certain embodiments, the BTK degrader molecule useful for the methods of the present disclosure is a compound of Formula IV described in WO 2021 / 219071 (incorporated herein by reference):

[0127]

[0128] wherein X and Y may independently be CH or N,

[0129] or a pharmaceutically acceptable salt thereof.

[0130] The BTK degrader molecules of Formula 1 can be synthesized according to Schemes 1, 2, 3 and 4 below.

[0131] Scheme 1: Synthesis of BTK degrader molecules having Formula IA to Formula IJ, Formula IL and Formula IM

[0132]

[0133] Scheme 2: Synthesis of BTK degrader molecules having Formula IK and Formula IN

[0134]

[0135] Scheme 3: Synthesis of BTK degrader molecules having Formula IO

[0136]

[0137] Scheme 4: Synthesis of BTK degrader molecules having formula IP.

[0138]

[0139] BTK degrader molecules of formula II-A, II-B and II-C can be prepared according to the methods described in WO 2021 / 113557 (which is hereby incorporated by reference). BTK degrader molecules of formula III-A, III-B, III-C and III-D can be prepared according to the methods described in WO 2020 / 239103 and WO 2022 / 052950 (which are hereby incorporated by reference). BTK degrader molecules of formula IV can be prepared according to the procedures described in WO 2021 / 219071 (which are hereby incorporated by reference).

[0140] b. BTK nucleic acid inhibitor molecules

[0141] In another aspect, the BTK reduction molecule of the present disclosure is a nucleic acid inhibitor molecule that reduces or eliminates BTK expression, thereby causing a reduction or elimination of the amount of BTK. The term "nucleic acid inhibitor molecule" used herein means an oligonucleotide molecule that reduces or eliminates the expression of a target gene, wherein the oligonucleotide molecule contains a region of a sequence specifically targeted to a target gene mRNA (i.e., BTK mRNA). Typically, the targeting region of a nucleic acid inhibitor molecule comprises a segment (e.g., SEQ ID NO:3) that is sufficiently complementary to a target nucleic acid sequence to direct the action of the nucleic acid inhibitor molecule to a specified target gene (i.e., BTK gene). The nucleic acid inhibitor molecule may include ribonucleotides, deoxyribonucleotides, and / or modified nucleotides. RNAi inhibitor molecules (including small interfering RNA ("siRNA")), antisense oligonucleotides, ribozymes, microRNAs, antagomirs, and aptamers are examples of nucleic acid inhibitor molecules that have been shown to be able to regulate the intracellular RNA level of a target gene. Antisense oligonucleotides and RNAi molecules for human BTK genes have previously been disclosed in, for example, U.S. Patent No. 9,982,265, which is incorporated herein by reference as a whole.

[0142] The sequence corresponding to the mRNA transcript of human BTK is shown below (SEQ ID NO: 3). This corresponds to the database sequence under GenBank accession number NM_000061.3, which is a 2575-nucleotide sequence defined as "Homo sapiens Bruton's tyrosine kinase (BTK), transcript variant 1, mRNA". The coding region is located at nucleotides 161-2140. As understood in the art, in RNA molecules, the thymine bases in SEQ ID NO: 3 are replaced by uracil bases. Thus, the DNA sequence used herein (such as SEQ ID NO: 3) and the RNA sequence corresponding to the DNA sequence (i.e., SEQ ID NO: 3 in which the thymine bases are replaced by uracil bases) are considered to contain the same "sequence".

[0143] agactgtccttcctctctggactgtaagaatatgtctccagggccagtgtctgctgcgatcga

[0144] gtcccaccttccaagtcctggcatctcaatgcatctgggaagctacctgcattaagtcagga

[0145] ctgagcacacaggtgaactccagaaagaagaagctatggccgcagtgattctggagagca

[0146] tctttctgaagcgatcccaacagaaaaaagaaaacatcacctctaaacttcaagaagcgcct

[0147] gtttctcttgaccgtgcacaaactctcctactatgagtatgactttgaacgtgggaagaagagg

[0148] your feet are so big

[0149] aaaatcctcctccagaaagacagattccgagaagaggtgaagagtccagtgaaatggag

[0150] caaatttcaatcattgaaaggttcccttatcccttccaggttgtatatgatgaagggcctctct

[0151] acgtcttctccccaactgaagaactaggaagcggtggattcaccagctcaaaaacgtaat

[0152] ccggtacaacagtgatctggttcagaaatatcacccttgcttctggatcgatgggcagtatct

[0153] ctgctgctctcagacagccaaaaatgctatgggctgccaaaatttggagaacaggaatgga

[0154] agcttaaaacctgggagttctcaccggaagaaaaaaagcctcttcccccaacgcctgagg

[0155] aggaccagatcttgaaaaaagccactaccgcctgagccagcagcagcaccagtctccacaa

[0156] gtgagctgaaaaaggttgtggccctttatgattacatgccaatgaatgcaaatgatctacag

[0157] ctgcggaagggtgatgaatattttatcttggaggaaagcaacttaccatggtggagagcac

[0158] gagataaaaatgggcaggaaggctacattcctagtaactatgtcactgaagcagaagact

[0159] ccatagaaatgtatgagtggtattccaaacacatgactcggagtcaggctgagcaactgct

[0160] aaagcaagaggggaaagaaggaggtttcattgtcagagactccagcaaagctggcaaat

[0161] atacagtgtctgtgtttgctaaatccacaggggaccctcaaggggtgatacgtcattatgttg

[0162] tgtgttccacacctcagagccagtattacctggctgagaagcaccttttcagcaccatccctg

[0163] agctcattaactaccatcagcacaactctgcaggactcatatccaggctcaaatatccagtg

[0164] tctcaacaaaacaagaatgcaccttccactgcaggcctgggatacggatcatgggaaattg

[0165] atccaaaggacctgaccttcttgaaggagctggggactggacaatttggggtagtgaagta

[0166] tgggaaatggagaggccagtacgacgtggccatcaagatgatcaaagaaggctccatgtc

[0167] tgaagatgaattcattgaagaagccaaagtcatgatgaatctttcccatgagaagctggtgc

[0168] agttgtatggcgtctgcaccaagcagcgccccatcttcatcatcactgagtacatggccaat

[0169] ggctgcctcctgaactacctgagggagatgcgccaccgcttccagactcagcagctgctag

[0170] agatgtgcaaggatgtctgtgaagccatggaatacctggagtcaaagcagttccttcaccg

[0171] agacctggcagctcgaaactgtttggtaaacgatcaaggagttgttaaagtatctgatttcg

[0172] gcctgtccaggtatgtcctggatgatgaatacacaagctcagtaggctccaaatttccagtc

[0173] cggtggtccccaccggaagtcctgatgtatagcaagttcagcagcaaatctgacatttgggc

[0174] ttttggggttttgatgtgggaaatttactccctggggaagatgccatatgagagatttactaa

[0175] cagtgagactgctgaacacattgcccaaggcctacgtctctacaggcctcatctggcttcag

[0176] agaaggtatataccatcatgtacagttgctggcatgagaaagcagatgagcgtcccactttc

[0177] aaaattcttctgagcaatattctagatgtcatggatgaagaatcctgagctcgccaataagc

[0178] ttcttggttctacttctcttctccacaagccccaatttcactttctcagaggaaatcccaagctt

[0179] aggagccctggagcctttgtgctcccactcaatacaaaaaggcccctctctacatctgggaa

[0180] tgcacctcttctttgattccctgggatagtggcttctgagcaaaggccaagaaattattgtgc

[0181] ctgaaatttcccgagagaattaagacagactgaatttgcgatgaaaatattttttaggaggg

[0182] aggatgtaaatagccgcacaaaggggtccaacagctctttgagtaggcatttggtagagct

[0183] tgggggtgtgtgtgtgggggtggaccgaatttggcaagaatgaaatggtgtcataaagatg

[0184] ggaggggagggtgttttgataaaataaaattactagaaagcttgaaa(SEQ ID NO:

[0185] 3).

[0186] In certain embodiments, the nucleic acid inhibitor molecule is a single-stranded nucleic acid inhibitor molecule. Single-stranded nucleic acid inhibitor molecules include, for example, antisense oligonucleotides, microRNAs, ribozymes, aptamers, antagomirs, and single-stranded RNAi inhibitor molecules, all of which are known in the art.

[0187] As used herein, the term "antisense oligonucleotide" refers to a single-stranded oligonucleotide that inhibits the expression of a target gene by one of the following mechanisms: (1) steric hindrance, for example, the antisense oligonucleotide interferes with certain steps in the sequence of events involved in gene expression and / or the production of the encoded protein by directly interfering with, for example, transcription of the gene, splicing of pre-mRNA, and translation of mRNA; (2) induction of RNase H enzymatic digestion of the RNA transcript of the target gene; (3) induction of RNase L enzymatic digestion of the RNA transcript of the target gene; (4) induction of RNase P enzymatic digestion of the RNA transcript of the target gene; (5) induction of double-stranded RNA enzyme enzymatic digestion of the RNA transcript of the target gene; and (6) induction of steric hindrance and enzymatic digestion activity combined in the same antisense oligo. Conventional antisense oligonucleotides do not have an RNAi mechanism of action like RNAi molecules. Antisense oligonucleotides have been used for decades to reduce the expression of specific target genes. See, for example, Pelechano and Steinmetz, Nature Review Genetics, 2013, 14: 880-93. RNAi molecules can be distinguished from antisense oligonucleotides in several aspects, including the need for Ago2, which binds to the RNAi antisense strand so that the antisense strand directs the Ago2 protein to the intended target, and where Ago2 is required to silence the target. The antisense oligonucleotides of the present disclosure can be any length that is effective in inhibiting the BTK gene / coding sequence.

[0188] Typically, antisense oligonucleotide is about 6 to about 50 nucleotides (for example, at least about 12, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides), and can be up to about 100 to about 200 nucleotides or more. In certain embodiments, the antisense oligonucleotide has 8-80, 14-50, 16-30, 12-25, 12-22, 14-20, 18-22 or 20-22 nucleotides. In certain embodiments, the antisense oligonucleotide has 18-22 such as 18-20 nucleotides. In certain embodiments, the antisense oligonucleotide or its portion and SEQ ID NO:3 target nucleic acid sequence is fully complementary. In certain embodiments, the antisense oligonucleotide or its portion and SEQ ID NO:3 target nucleic acid sequence at least 12,13,14,15,16,17,18,19,20 or more adjacent nucleotides are complementary. In certain embodiments, the antisense oligonucleotide contains no more than 5, 4, 3, 2 or 1 non-complementary nucleotides relative to the target nucleic acid sequence in SEQ ID NO: 3. The length of the antisense oligonucleotide can be reduced and / or mismatched bases can be introduced without eliminating activity.

[0189] In certain embodiments, the nucleic acid inhibitor molecule is an antisense oligonucleotide comprising a single-stranded polynucleotide comprising a sequence that is at least about 90%, or at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementary to a segment of human BTK mRNA or encoding DNA sequence (SEQ ID NO: 3).

[0190] In certain embodiments, the nucleic acid inhibitor molecule is an RNAi molecule. The term "RNAi molecule" used herein refers to (a) a double-stranded nucleic acid inhibitor molecule ("dsRNAi molecule", also referred to as siRNA molecule in the art) having a sense strand (passenger) and an antisense strand (guide), wherein the antisense strand or a portion of the antisense strand is used by Argonaute 2 (Ago2) endonuclease to cut target mRNA, or (b) a single-stranded nucleic acid inhibitor molecule ("ssRNAi molecule") with a single antisense strand, wherein the antisense strand (or a portion of the antisense strand) is used by Ago2 endonuclease to cut target mRNA. See, e.g., Matsui et al., Molecular Therapy, 2016, 24 (5): 946-55.

[0191] In certain embodiments, the nucleic acid inhibitor molecule is a ssRNAi molecule. In certain embodiments, the nucleic acid inhibitor molecule is a ssRNAi molecule having 14-50, 16-30 or 15-25 nucleotides. In other embodiments, the ssRNAi molecule has 18-22 or 20-22 nucleotides. In certain embodiments, the ssRNAi molecule has 20 nucleotides. In other embodiments, the ssRNAi molecule has 22 nucleotides. In certain embodiments, the ssRNAi molecule comprises a single-stranded polynucleotide comprising a sequence that is at least about 90% or at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementary to a segment of a human BTK mRNA or coding DNA sequence (SEQ ID NO: 3).

[0192] In certain embodiments, the nucleic acid inhibitor molecule is a dsRNAi molecule. A variety of double-stranded RNAi inhibitor molecular structures are known in the art. Early work on RNAi inhibitor molecules focused on double-stranded nucleic acid molecules, wherein each chain has a size of 19-25 nucleotides and has at least one 1 to 5 nucleotide 3'-overhang (see, e.g., U.S. Patent No. 8,372,968). Subsequently, longer double-stranded RNAi inhibitor molecules were developed, which were processed into active RNAi inhibitor molecules by Dicer enzymes in vivo (see, e.g., U.S. Patent No. 8,883,996). Later work developed extended double-stranded nucleic acid inhibitor molecules, wherein at least one end of at least one chain extends beyond the double-stranded targeting region of the molecule.

[0193] The dsRNAi molecules of the present disclosure can be any length that effectively inhibits the BTK gene / coding sequence. In certain embodiments of the dsRNAi molecules, the sense strand and antisense strand are within the range of 15-66, 25-40, or 19-25 nucleotides. In certain embodiments, the sense strand is 18 to 66 nucleotides in length. In certain embodiments, the sense strand is 18 to 25 nucleotides in length. In certain embodiments, the sense strand is 18, 19, 20, 21, 22, 23, or 24 nucleotides in length. In some of those embodiments, the sense strand is 25 to 45 nucleotides in length. In certain embodiments, the sense strand is 30 to 40 nucleotides in length. In certain embodiments, the sense strand is 36, 37, 38, 39, or 40 nucleotides in length. In certain embodiments, the sense strand is 25 to 30 nucleotides in length. In some of those embodiments, the sense strand is 25, 26, or 27 nucleotides in length.

[0194] In some embodiments of the dsRNAi molecule, the antisense strand is 18 to 66 nucleotides in length. Typically, the antisense strand comprises a sequence that is sufficiently complementary to a sequence in the BTK gene / coding sequence to direct the action of the nucleic acid inhibitor molecule to the target BTK gene. In certain embodiments, the antisense strand comprises a nucleic acid sequence that is complementary to a segment of a human BTK mRNA or coding DNA sequence (SEQ ID NO: 3) by at least about 90% or at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In certain embodiments, the antisense strand comprises a sequence that is completely complementary to a sequence contained in a human BTK mRNA or coding DNA sequence (SEQ ID NO: 3).

[0195] In certain embodiments, the antisense strand is 18 to 40 nucleotides long. In some of those embodiments, the antisense strand is 20 to 50 nucleotides long. In certain embodiments, the antisense strand is 20 to 30 nucleotides long. In certain embodiments, the antisense strand is 21, 22, 23, 24, 25, 26, 27 or 28 nucleotides long. In certain embodiments, the antisense strand is 35 to 40 nucleotides long. In some of those embodiments, the antisense strand is 36, 37, 38 or 39 nucleotides long.

[0196] In some embodiments of the dsRNAi inhibitor molecule, the sense strand and the antisense strand form a duplex structure of 15 to 50 base pairs. In certain embodiments, the duplex region is 15 to 30 base pairs in length, such as between 19 and 30, more generally between 18 and 26, such as between 19 and 23, and in some cases 19 to 21 base pairs in length. In certain embodiments, the double-stranded region is 19, 20, 21, 22, 23, 24, 25, or 26 base pairs in length.

[0197] In certain embodiments, the dsRNAi inhibitor molecule comprises a sense strand and an antisense strand and a duplex region of 19-21 nucleotides, wherein the sense strand is 19-21 nucleotides in length and the antisense strand is 21-23 nucleotides in length and comprises a single-stranded overhang of 1-2 nucleotides at its 3′-end.

[0198] In certain embodiments, the dsRNAi inhibitor molecule has an antisense strand of 21 nucleotides in length and a sense strand of 21 nucleotides in length, wherein there is a two-nucleotide 3′-passenger strand overhang on the right side of the molecule (3′ end of the sense strand / 5′ end of the antisense strand), and a two-nucleotide 3′-guide strand overhang on the left side of the molecule (5′ end of the sense strand / 3′ end of the antisense strand). In such a molecule, there is a 19 base pair duplex region.

[0199] In certain embodiments, the dsRNAi inhibitor molecule has an antisense strand of 23 nucleotides in length and a sense strand of 21 nucleotides in length, with blunt ends on the right side of the molecule (3' end of the sense strand / 5' end of the antisense strand) and a two-nucleotide 3'-guide strand overhang on the left side of the molecule (5' end of the sense strand / 3' end of the antisense strand). In such a molecule, there is a duplex region of 21 base pairs.

[0200] In certain embodiments, the nucleic acid inhibitor molecule is a microRNA. The terms "microRNA" and "miRNA" used herein are interchangeable and represent non-coding RNA molecules encoded in the genomes of plants and animals. Typically, mature microRNA is about 18-25 nucleotides in length. In some cases, highly conservative endogenously expressed microRNA regulates gene expression by binding to the 3'-untranslated region (3'-UTR) of specific mRNA. Some mature microRNAs appear to be derived from long endogenous primary microRNA transcripts (also referred to as pre-microRNA, pri-microRNA, pri-mir, pri-miR or pri-pre-microRNA), which often have hundreds of nucleotide lengths (Lee, et al., EMBO J., 2002, 21 (17): 4663-4670).

[0201] In certain embodiments, the nucleic acid inhibitor molecule is an aptamer. The term "aptamer" as used herein refers to an oligonucleotide with binding affinity to a specific target (including nucleic acids, proteins, specific whole cells or specific tissues). Aptamers can be obtained using methods known in the art, for example, by in vitro selection from a large random nucleic acid sequence pool. Lee et al., Nucleic Acid Res., 2004, 32: D95-D100.

[0202] In certain embodiments, the nucleic acid inhibitor molecule is an antagomir. The term "antagomir" as used herein refers to an oligonucleotide with binding affinity for a specific target, including an exogenous RNAi inhibitor molecule or the guide strand of a natural miRNA (Krutzfeldt et al. Nature 2005, 438(7068):685-689).

[0203] In certain embodiments, the nucleic acid inhibitor molecule is a ribozyme. The term "ribozyme" used herein means a catalytic nucleic acid molecule that specifically recognizes and cuts a unique target nucleic acid sequence, which can be a DNA or RNA. Every ribozyme has a catalytic component (also referred to as a "catalytic domain") and a target sequence binding component consisting of two binding domains, which are located on either side of the catalytic domain.

[0204] Methods for preparing nucleic acid inhibitor molecules (such as antisense oligonucleotides or RNAi molecules) are conventional. For example, in vitro methods for preparing RNAi molecules include treating polyribonucleotide sequences in a cell-free system (e.g., digesting long dsRNA with RNase III or Dicer), transcribing recombinant double-stranded DNA in vitro, and preferably, chemically synthesizing nucleotide sequences homologous to BTK sequences. See, for example, Tuschl et al., Genes & Dev., 1999, 13: 3191-3197. On the other hand, in vivo methods can include:

[0205] (1) Transfecting a DNA vector into cells so that the substrate is converted into an RNAi molecule in vivo (see, e.g., Kawasaki et al., Nucleic Acids Res., 2003, 31:700-707; Miyagishi et al., Nature Biotechnol., 2003, 20:497-500; Lee et al., Nature Biotechnol., 2003, 20:500-505; Brummelkamp et al., Science, 2003, 296:550-53; McManus et al., RNA, 2002, 8:842-850; Paddison et al., Gene. Dev., 2002, 16:948-958; Paddison et al., PNAS, 2002, 99:1443-1448; Paul et al., Nature Biotechnol., 2003, 99:151-152; McManus et al., RNA, 2002, 99:151-152; Paddison et al., Gene. Dev., 2002, 99:151-152; Paul et al., Nature Biotechnol., 2003, 99:151-152; McManus et al., RNA, 2002, 99:151-152; Paddison et al., PNAS, 2002, 99:151-152; Paul et al., Nature Biotechnol., 2003, 99:151-152; Biotechnol., 2002, 20: 505-508; Yu et al., PNAS, 2002, 99: 6047-6052);

[0206] (2) expressing shRNA from a plasmid system using an RNA polymerase III (pol III) promoter (see, e.g., Kawasaki et al., supra; Miyagishi et al., supra; Lee et al., supra; Brummelkamp et al., supra; McManus et al., supra; Paddison et al., supra (both); Paul et al., supra, and Yu et al., supra); and / or

[0207] (3) Expression of short RNAs from tandem promoters (see, e.g., Miyagishi et al., supra; Lee et al., supra).

[0208] When synthesized in vitro, typical micromolar scale RNA synthesis provides about 1 mg of RNAi molecules, which is sufficient for about 1000 transfection experiments using a 24-well tissue culture plate format. In general, to inhibit BTK expression in cultured cells, one or more RNAi molecules can be added to cells in culture medium, typically at about 1 ng / ml to about 10 μg RNAi molecules / ml.

[0209] For further guidance on methods of designing and making RNAi molecules, testing their efficacy, and using them in RNAi methods (in vitro and in vivo), see, e.g., Allshire, Science, 2002, 297:1818-1819; Volpe et al., Science, 2002, 297:1833-1837; Jenuwein, Science, 2002, 297:2215-2218; Hall et al., Science, 2002, 297:2232-2237; Hutvagner et al., Science, 2002, 297:2056-2060; McManus et al., supra; Rein et al., Science, 2002, 297:2060-2070; McManus et al., supra; hart et al., Genes. Dev., 2002. 16:1616-1626; Reinhart et al., Science, 2002, 297:1831; Moss, Curr. Biol., 2001, 11:R772-775; Brummelkamp et al., Science, 2002, 296:550-553; Bass, Nature, 2001, 411:428-429; Elbashir et al., supra; U.S. Patent No. 6,506,559; U.S. Patent Application No. 2003 / 0206887; WO99 / 07409; WO99 / 32619; WO00 / 01846; WO 00 / 44914; WO00 / 44895; WO2001 / 29058; WO2001 / 36646; WO2001 / 75164; WO2001 / 92513; WO2001 / 29058; WO2001 / 89304; WO2001 / 90401; WO2002 / 16620; and WO2002 / 29858, all of which are incorporated herein by reference.

[0210] The nucleic acid inhibitor molecules of the present disclosure, such as antisense oligonucleotides, RNAi molecules, microRNAs, aptamers, antagomirs or ribozymes, can take any of the forms described for antisense nucleic acid molecules (including modified versions); and they can be delivered to cells and introduced into cells as oligonucleotides (single-stranded or double-stranded) or in the form of expression vectors using any method known in the art.

[0211] Dosage forms and compositions

[0212] Method disclosed herein comprises administering an effective amount of BTK to a subject to reduce a molecule. This can occur after the subject has been determined to have a disease or disorder (such as cancer or immune system disorder) associated with constitutively activated PLCγ2, for example, by determining the subject to have constitutively activated PLCγ2 or one or more functional gain mutations in a gene encoding PLCγ2 in one or more cells.

[0213] Therefore, the present disclosure provides a pharmaceutical composition containing a BTK reduction molecule disclosed herein as an active ingredient and one or more pharmaceutically acceptable excipients, carriers (including inert solid diluents and fillers), diluents (including sterile aqueous solutions and various organic solvents), penetration enhancers, solubilizers and adjuvants. The pharmaceutical composition can be administered alone or in combination with other therapeutic agents. Such compositions are prepared in a manner well known in the pharmaceutical field (see, for example, Remington's Pharmaceutical Sciences, Mace Publishing Co., Philadelphia, Pa. 17th edition (1985); and Modern Pharmaceutics, Marcel Dekker, Inc. 3rd edition (GS Banker and CT Rhodes, ed.).

[0214] The pharmaceutical composition can be in the form of a liquid, solution, suspension, emulsion, elixir, syrup, tablet, lozenge, granules, powder, capsule, cachet, pill, ampoule, suppository, pessary, ointment, gel, paste, cream, spray, mist, foam, lotion, oil, bolus, electuary or aerosol.

[0215] The pharmaceutical composition can be administered in single or multiple doses by any acceptable mode of administration for agents of similar utility, e.g., as described in those patents and patent applications incorporated by reference, including, but not limited to, oral (e.g., by ingestion); topical (including, e.g., transdermal, intranasal, ocular, buccal, and sublingual); pulmonary (e.g., by inhalation or insufflation therapy, using, e.g., an aerosol, e.g., through the mouth or nose); rectal; vaginal; parenteral, e.g., by injection, including subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subcutaneous, intraarticular, subarachnoid, and intrasternal; by implanting a reservoir, e.g., subcutaneously or intramuscularly. In certain embodiments, the compounds or pharmaceutical compositions of the present disclosure are administered orally.

[0216] One mode of administration is parenteral, particularly by injection. For administration by injection, the form in which the compositions of the present disclosure may be incorporated includes aqueous or oily suspensions, or emulsions containing sesame oil, corn oil, cottonseed oil or peanut oil, as well as elixirs, mannitol, dextrose or sterile aqueous solutions and similar pharmaceutical vehicles. Aqueous solutions in saline are also routinely used for injection, but are less preferred in the context of the present disclosure. Ethanol, glycerol, propylene glycol, liquid polyethylene glycols, etc. (and suitable mixtures thereof), cyclodextrin derivatives and vegetable oils may also be used. Appropriate fluidity may be maintained, for example, by using a coating, such as lecithin, by maintaining the desired particle size (in the case of a dispersion) and by using a surfactant. The action of microorganisms may be prevented by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc.

[0217] Sterile injectable solutions are prepared as follows: the desired amount of the compound according to the present disclosure is mixed with various other ingredients listed above (as required) in an appropriate solvent, followed by filtration sterilization. Typically, dispersions are prepared as follows: various sterilized active ingredients are mixed into a sterile vehicle containing a basic dispersion medium and other ingredients required to be selected from those listed above. With regard to sterile powders for the preparation of sterile injectable solutions, preferred preparation methods are vacuum drying and freeze drying techniques, which produce a powder of the active ingredient plus any additional desired ingredients from its previously sterile filtered solution.

[0218] Oral administration is another approach for administering BTK reduction molecules according to the present disclosure. Administration can be by capsules or tablets, etc. When preparing a pharmaceutical composition comprising at least one BTK reduction molecule described herein, the active ingredient is typically diluted with an excipient and / or encapsulated in a carrier that can be in the form of a capsule, sachet, paper or other container. When an excipient is used as a diluent, it can be in the form of a solid, semisolid or liquid material (as described above), which acts as a vehicle, carrier or medium for the active ingredient. Therefore, the composition can be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (solid or in a liquid medium), ointments (containing, for example, up to 10% by weight of active compounds), soft and hard gelatin capsules, sterile injection solutions and sterile packaged powders.

[0219] Some examples of suitable excipients include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrups and methylcellulose. The formulations may additionally include lubricants such as talc, magnesium stearate and mineral oil; wetting agents; emulsifiers and suspending agents; preservatives such as methyl and propyl hydroxy-benzoates; sweeteners; and flavoring agents.

[0220] By adopting procedures known in the art, the compositions of the present disclosure can be formulated so as to provide a quick, continuous or delayed release of active ingredients after being applied to a subject. Controlled release drug delivery systems for oral administration include osmotic pump systems and dissolution systems containing polymer-coated reservoirs or drug-polymer matrix formulations. Examples of controlled release systems are given in U.S. Patents 3,845,770, 4,326,525, 4,902,514 and 5,616,345. Another preparation used in the method of the present invention adopts a transdermal delivery device ("patch"). Such a transdermal patch can be used to provide a compound of the present disclosure that is continuously or discontinuously infused with a controlled amount. The construction and use of a transdermal patch for delivering a pharmaceutical agent are well known in the art. See, for example, U.S. Patents 5,023,252, 4,992,445 and 5,001,139. ​​Such a patch can be constructed for continuous, pulsed or on-demand delivery of a pharmaceutical agent.

[0221] The composition is preferably formulated in a unit dosage form of about 1-1000 mg of active ingredient for a subject of about 50-70 kg, or about 1-500 mg or about 1-250 mg or about 1-150 mg or about 0.5-100 mg or about 1-50 mg of active ingredient. The term "unit dosage form" refers to a physically discrete unit suitable as a unit dose for human subjects and other mammals, each unit containing a predetermined amount of active substance calculated to produce a desired therapeutic effect, and a suitable pharmaceutical excipient (e.g., tablets, capsules, ampoules). The BTK reduction molecule is generally administered in a pharmaceutically effective amount. Preferably, for oral administration, each dosage unit contains about 1 mg to about 2 g of the BTK reduction molecule described herein, and for parenteral administration, preferably contains about 0.1 to about 700 mg of the BTK reduction molecule described herein. However, it should be understood that the amount of BTK-reducing molecule actually administered will generally be determined by the physician based on relevant circumstances, including the condition to be treated, the route of administration selected, the actual BTK-reducing molecule administered and its relative activity, the age, weight and response of the individual patient, the severity of the patient's symptoms, etc.

[0222] In certain embodiments, a BTK reducing molecule of the present disclosure (such as any of the BTK degrader molecules disclosed herein) is administered to a subject at a dose of about 0.1 mg / kg to about 500 mg / kg (e.g., about 0.5 mg / kg to about 400 mg / kg, about 0.7 mg / kg to about 300 mg / kg, about 1 mg / kg to about 250 mg / kg, about 1.5 mg / kg to about 200 mg / kg, about 2 mg / kg to about 150 mg / kg, about 1 mg / kg to about 100 mg / kg, about 0.1 mg / kg to about 100 mg / kg, about 0.1 mg / kg to about 50 mg / kg, or about 0.1 mg / kg to about 10 mg / kg).

[0223] To prepare solid compositions such as tablets, the principal active ingredient is mixed with a pharmaceutical excipient to form a solid preformulation composition containing a homogenous mixture of the BTK reducing molecules of the present disclosure. When these preformulation compositions are referred to as homogenous, it is meant that the active ingredient is dispersed evenly throughout the composition so that the composition can be easily subdivided into equally effective unit dosage forms such as tablets, pills and capsules.

[0224] The tablet or pill of the present disclosure can be coated or otherwise compounded to provide a dosage form with an advantage of prolonged action, or to protect against the acidic conditions of the stomach. For example, tablet or pill can comprise an inner dosage and an outer dosage component, the latter being the shell form of the former. The two components can be separated by an enteric layer, which is used to resist the disintegration in the stomach, and allows the inner component to enter the duodenum intact or delay release. Various materials can be used for this type of enteric layer or coating, and this type of material comprises a variety of polymeric acids, and a mixture of polymeric acids and materials such as shellac, spermol and cellulose acetate.

[0225] Compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable aqueous or organic solvents or mixtures thereof, and powders. Liquid or solid compositions may contain suitable pharmaceutically acceptable excipients as described above. Preferably, the composition is administered by oral or nasal respiratory route to obtain a local or systemic effect. Compositions in preferred pharmaceutically acceptable solvents may be atomized by the use of an inert gas. Atomized solutions may be inhaled directly from the atomizing device, or the atomizing device may be connected to a mask tent or intermittent positive pressure breathing machine. Solution, suspension or powder compositions may be administered from a device that delivers the formulation in an appropriate manner, preferably orally or nasally.

[0226] In one aspect, provided herein is a dosage form or a composition in a dosage form comprising: about 0.1 mg to about 1 g (e.g., about 0.1 mg to about 750 mg, about 0.2 mg to about 500 mg, about 0.5 mg to about 200 mg, about 1 mg to about 150 mg, about 2.5 mg to about 150 mg, about 10 mg to about 120 mg) of a BTK reducing molecule disclosed herein and a pharmaceutically acceptable excipient.

[0227] In certain embodiments, the dosage form or composition in a dosage form comprises about 1 g, about 750 mg, about 500 mg, about 200 mg, 190 mg, 180 mg, 170 mg, 160 mg, 150 mg, 140 mg, 130 mg, 120 mg, 110 mg, 100 mg, about 90 mg, about 85 mg, about 80 mg, about 75 mg, about 70 mg, about 65 mg, about 60 mg, about 55 mg, about 50 mg, about 45 mg, about 40 mg, about 35 mg, about 30 mg, about 25 mg, about 20 mg, about 15 mg, about 10 mg, about 7 mg, about 5 mg, about 2.5 mg, about 2 mg, about 1.5 mg, or about 1 mg of a BTK reducing molecule disclosed herein.

[0228] In another aspect, the present disclosure provides a dosage form or a composition in a dosage form comprising a plurality of particles of a BTK-reducing molecule disclosed herein and a pharmaceutically acceptable excipient, wherein the amount of the plurality of particles of a BTK-reducing molecule disclosed herein in the dosage form is about 0.1 mg to about 500 mg (e.g., about 0.5 mg to about 200 mg, about 1 mg to about 150 mg, about 10 mg to about 120 mg).

[0229] In certain embodiments, the plurality of particles of a BTK reducing molecule disclosed herein in the dosage form or composition is about 2.5 mg to about 150 mg (e.g., about 10 mg to about 150 mg, about 20 mg to about 150 mg, about 70 mg to about 120 mg, about 30 mg to about 60 mg, about 100 mg, about 50 mg).

[0230] In certain embodiments, the dosage form or the composition is configured for oral administration. In certain embodiments, the dosage form is a solid form. In certain embodiments, the dosage form is in the form of a capsule. In certain embodiments, the pharmaceutical excipient in the capsule is a filler (e.g., a cellulose derivative (e.g., microcrystalline cellulose), a starch (e.g., hydrolyzed starch and partially pregelatinized starch), anhydrous lactose, lactose monohydrate, a sugar alcohol (e.g., sorbitol, xylitol, and mannitol).

[0231] In certain embodiments, the dosage form is a liquid form. In certain embodiments, the dosage form is in the form of a solution. In certain embodiments, the pharmaceutical excipient in the solution is selected from: fillers (e.g., polymers (e.g., PEG400)), emulsifiers (e.g., castor oil derivatives (e.g., Kolliphor RH40), surfactants (e.g., glycerides (e.g., Labrafil M2125 CS), vitamin derivatives (e.g., vitamin E TPGS)), solvents (e.g., propylene glycol, ethanol, diethylene glycol monoethyl ether (or diethylene glycol monoethyl ether HP)).

[0232] In certain embodiments, the concentration of a BTK reducing molecule disclosed herein in the solution is from about 0.1 mg / mL to about 10 mg / mL (e.g., from about 0.5 mg / mL to about 10 mg / mL, from about 1 mg / mL to about 10 mg / mL, from about 2 mg / mL to about 10 mg / mL, from about 3 mg / mL to about 10 mg / mL, from about 4 mg / mL to about 10 mg / mL, from about 5 mg / mL to about 10 mg / mL, from about 6 mg / mL to about 10 mg / mL, from about 0.1 mg / mL to about 8 mg / mL, from about 0.5 mg / mL to about 8 mg / mL, from about 1 mg / mL to about In some embodiments, the present invention relates to an aqueous solution of at least about 1 mg / mL of sodium bicarbonate, at least about 2 mg / mL of sodium bicarbonate, at least about 3 mg / mL of sodium bicarbonate, at least about 4 mg / mL of sodium bicarbonate, at least about 5 mg / mL of sodium bicarbonate, at least about 6 mg / mL of sodium bicarbonate, at least about 0.5 mg / mL of sodium bicarbonate, at least about 1 mg / mL of sodium bicarbonate, at least about 2 mg / mL of sodium bicarbonate, at least about 3 mg / mL of sodium bicarbonate, at least about 4 mg / mL of sodium bicarbonate, at least about 0.5 mg / mL of sodium bicarbonate, at least about 1 mg / mL of sodium bicarbonate, at least about 2 mg / mL of sodium bicarbonate, at least about 3 mg / mL of sodium bicarbonate, at least about 4 mg / mL of sodium bicarbonate, at least about 0.5 mg / mL of sodium bicarbonate, at least about 1 mg / mL of sodium bicarbonate, or at least about 2 mg / mL of sodium bicarbonate).

[0233] In certain embodiments, the concentration of the BTK reducing molecules disclosed herein in the solution is about 0.1 mg / mL, about 0.5 mg / mL, about 1 mg / mL, about 2 mg / mL, about 3 mg / mL, about 4 mg / mL, about 5 mg / mL, about 6 mg / mL, about 7 mg / mL, about 8 mg / mL, about 9 mg / mL, or about 10 mg / mL.

[0234] In certain embodiments, the dosage form is in the form of a suspension. In certain embodiments, the concentration of the BTK reduction molecule disclosed herein in the suspension is about 0.1 mg / mL, about 0.5 mg / mL, about 1 mg / mL, about 1.5 mg / mL, about 2 mg / mL, about 2.5 mg / mL, about 3 mg / mL, about 3.5 mg / mL, about 4 mg / mL, about 4.5 mg / mL, about 5 mg / mL, about 6 mg / mL, about 7 mg / mL, about 8 mg / mL, about 9 mg / mL, about 10 mg / mL, about 11 mg / mL, about 12 mg / mL, about 13 mg / mL, about 14 mg / mL, about 15 mg / mL, about 20 mg / mL, about 25 mg / mL.

[0235] In certain embodiments, the concentration of a BTK-lowering molecule disclosed herein in the suspension is from about 0.1 mg / mL to about 10 mg / mL (e.g., from about 0.5 mg / mL to about 10 mg / mL, from about 1 mg / mL to about 10 mg / mL, from about 2 mg / mL to about 10 mg / mL, from about 3 mg / mL to about 10 mg / mL, from about 4 mg / mL to about 10 mg / mL, from about 5 mg / mL to about 10 mg / mL, from about 6 mg / mL to about 10 mg / mL, from about 0.1 mg / mL to about 8 mg / mL, from about 0.5 mg / mL to about 8 mg / mL, from about 1 mg / mL to about In some embodiments, the present invention relates to an aqueous solution of at least about 1 mg / mL of sodium bicarbonate, at least about 2 mg / mL of sodium bicarbonate, at least about 3 mg / mL of sodium bicarbonate, at least about 4 mg / mL of sodium bicarbonate, at least about 5 mg / mL of sodium bicarbonate, at least about 6 mg / mL of sodium bicarbonate, at least about 0.5 mg / mL of sodium bicarbonate, at least about 1 mg / mL of sodium bicarbonate, at least about 2 mg / mL of sodium bicarbonate, at least about 3 mg / mL of sodium bicarbonate, at least about 4 mg / mL of sodium bicarbonate, at least about 0.5 mg / mL of sodium bicarbonate, at least about 1 mg / mL of sodium bicarbonate, at least about 2 mg / mL of sodium bicarbonate, at least about 3 mg / mL of sodium bicarbonate, at least about 4 mg / mL of sodium bicarbonate, at least about 0.5 mg / mL of sodium bicarbonate, at least about 1 mg / mL of sodium bicarbonate, or at least about 2 mg / mL of sodium bicarbonate).

[0236] In vivo administration can be performed continuously or intermittently (e.g., in divided doses at appropriate intervals) in one dose throughout the course of treatment. Methods for determining the most effective mode of administration and dosage are well known to those skilled in the art and will vary depending on the formulation used for treatment, the purpose of treatment, the target cell being treated, and the subject being treated. Single or multiple administrations can be performed, with dosage levels and patterns selected by the treating physician. Example

[0237] In order that the embodiments described herein may be more fully understood, the following examples are set forth.The examples described in this application are provided to illustrate the compounds, pharmaceutical compositions and methods provided herein, and should not be construed in any way as limiting their scope.

[0238] Example 1. Effects of the BTK-reducing molecule of Formula ID and the BTK inhibitor ibrutinib on inhibiting cancer cell growth in vitro

[0239] Parental REC1 cells were obtained from the American Type Culture Collection (ATCC). The PLCγ2 gene in the REC-1 cell line was edited using CRISPR-Cas9 technology to generate a point mutation from S to Y at residue 707 of the PLCγ2 protein, or a point mutation from L to F at residue 845 of the PLCγ2 protein. For gene editing, gRNA complexes of PLCγ2S707Y or PLCγ2L845F were first prepared with Alt-R CRISPR-Cas9tracrRNA and crRNAPLCγ2S707Y (5'-CAGACTCTCAAAATAGGCGG-3') or PLCγ2L845F (5'-TTATTGAAGACAATCCCTTA-3') (IDT-Integrated DNA Technologies), and then ribonucleoprotein (RNP) complexes of PLCγ2S707Y or PLCγ2L845F were prepared with the corresponding gRNA complexes and Alt-R SpCas9 nuclease V3 (IDT-Integrated DNA Technologies). 5REC-1 cells were transfected with PLCγ2S707Y or PLCγ2L845F RNP complexes, Alt-R using the Neon transfection system (Thermo Fisher) at 1400 V, 10 ms, 3 pulses. Cas9 electroporation enhancer and PLCγ2S707Y (5'-TCCTGCTCCAGGGCTAGGGGCAAGGTAAAGCATTGTCGCATCAACCGGGACGGCCGGCACTTTGTGCTGGGGACCTACGCTTATTTTGAGAGTCTGGTGGAGCTCGTCAGTTACTACGAGAAGCATTCACTCTACCGAAAGATGAGACTGCGCT-3') or the corresponding Ultramer of PLCγ2L845F (5'-TTTTCTTTTTATTCCCGTTACAACTAACGTGAGTTATGTCTTGTTTCTTCACAGATTATTGAAGACAATCCCTTTGGCTCTCTTTGCAGAGGAATATTGGACCTCAATACCTATAACGTCGGTACGTGCACACATCATCTTAGCCTGGAT-3') DNA oligo (IDT-IntegratedDNATechnologies) electroporation. The cells were then cultured in 96-well plates for 10 days and selected with 100 nM ibrutinib for at least 6 passages. The S707Y and L845F mutations of PLCγ2 were further verified by Sanger sequencing using gDNA extracted from these cells.

[0240] The BTK reducing molecule used in this study is a BTK degrader having a chemical structure of Formula ID shown below and described in PCT Application No. PCT / US22 / 14830 (incorporated herein by reference), and is prepared according to the methods described therein. The BTK inhibitor used in this study is ibrutinib.

[0241]

[0242] Parental REC1 cells (ATCC), engineered REC1 PLCγ2 S707Y cells or engineered REC-1PLCγ2 L845FCells were plated at 8,000 cells / well in 90 μl of RPMI1640 growth medium containing 10% heat-inactivated FBS and 1x penicillin-streptomycin in a 96-well plate and then incubated overnight at 37°C. The next day, test compounds were administered to the cells using 10x compound stock solutions prepared in growth medium at different concentrations. After compound administration, the cells were then incubated at 37°C for 6 days. The plates were equilibrated at room temperature for approximately 10 minutes prior to performing the CellTiter-Glo assay. 100 μl of Reagent (Promega). The plates were then incubated at room temperature for 10 minutes and luminescence was recorded using an EnSpire plate reader (PerkinElmer).

[0243] The results are shown in Figures 1A-1C In. Figure 1B and Figure 1C As shown, in vitro treatment with a BTK degrader of Formula ID ("BTK degrader ID") significantly inhibited the expression of engineered REC1 PLCγ2 at 6 days after administration, compared with in vitro treatment with a conventional small molecule BTK inhibitor ibrutinib. S707Y Cells and engineered REC-1PLCγ2 L845F Cell growth in cells.

[0244] Example 2. In vivo efficacy of BTK reducing molecules of Formula ID and BTK inhibitor ibrutinib in a mouse xenograft tumor model

[0245] The parental REC1 cells (ATCC) described in Example 1, the engineered REC1 PLCγ2 S707Y Cells and engineered REC-1PLCγ2 L845F The cells were grown in RPMI1640 medium supplemented with 10% fetal bovine serum and 1x penicillin-streptomycin at 37°C in an atmosphere of 5% CO. 2 The cells were maintained as monolayer cultures in vitro under an atmosphere of 10% air. Tumor cells were routinely subcultured twice a week. Cells growing in the exponential growth phase were harvested and counted for tumor inoculation. 5 x 10 6 Tumor cells were subcutaneously inoculated in the right axilla of each mouse in 0.1 mL of PBS mixed with 0.1 mL of Matrigel for tumor development. Treatment with BTK degrader of Formula ID (1.5 mg / kg, 3 mg / kg, 6 mg / kg or 15 mg / kg, PO), ibrutinib (25 mg / kg, PO) or vehicle (PO) was performed when the average tumor size reached about 100 mm 3The mice were randomly divided into groups according to their tumor volume using Excel-based randomization software. Tumor size was measured in two dimensions using calipers three times a week and expressed in mm using the following formula: 3 Indicates volume: V = 0.5axb 2 , where a and b are the long diameter and short diameter of the tumor, respectively. The tumor growth inhibition (TGI) of each group was calculated using the following formula: TGI (%) = [1-(Ti-T0) / (Vi-V0)] × 100; Ti is the average tumor volume of the treatment group on a given day, T0 is the average tumor volume of the treatment group on the first day of treatment, Vi is the average tumor volume of the vehicle control group on the same day as Ti, and V0 is the average tumor volume of the vehicle group on the first day of treatment.

[0246] The results are shown in Figure 2A-2C middle. Figure 2A The results showed that ibrutinib and a BTK degrader of Formula ID ("BTK degrader ID") had similar effects in inhibiting tumor growth in control mice without PLCγ2 mutations. However, in vivo treatment with a BTK degrader of Formula ID significantly inhibited the expression of engineered REC1 PLCγ2 at 14 days after administration, compared with in vivo treatment with ibrutinib. S707Y Knock-in mice and Rec-1PLCγ2 L845F Tumor growth in knock-in mice, e.g. Figure 2B and Figure 2C As shown in Figure 2B As shown in FIG, PLCγ2 carrying an engineered REC1 was treated in vivo with a BTK degrader of Formula ID at a dose of 3 mg / kg, 6 mg / kg or 15 mg / kg (PO). S707Y Mice with knock-in tumors had a TGI of 61%, 74%, or 86% at 14 days post-administration, respectively, whereas in vivo treatment with ibrutinib resulted in only a 5% TGI. Figure 2C As shown, the BTK degrader of Formula ID was used to treat the engineered REC1PLCγ2 cells in vivo at a dose of 3 mg / kg, 6 mg / kg or 15 mg / kg (PO). L845F Mice with knock-in tumors developed a TGI of 63%, 81%, or 88%, respectively, 14 days after administration, whereas in vivo treatment with ibrutinib produced only a 12% TGI.

[0247] Example 3. Analysis of phosphoinositide formation in COS-7 cells transfected with wild-type and mutant PLCγ2

[0248] The activity of PLCγ2 can be determined by analyzing phosphoinositide formation in cells transfected with wild-type or mutant PLCγ2, such as COS-7 cells, as described in Everett et al., Characterization of Phospholipase CγEnzymes with Gain-of-Function Mutations, J. Biol. Chem., 2009, 284(34):23083-23093.

[0249] Briefly, COS-7 cells were cultured at 37°C in a 5% CO 2 The cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum and 1x penicillin-streptomycin in an atmosphere of air. Prior to transfection, COS-7 cells were seeded into 6-well plates at a density of 250,000 cells / well and grown overnight in 2 ml of growth medium before transfection. 1 μg of plasmid DNA of wild-type PLCγ2 or mutant PLCγ2 was transfected using Lipofectamine (Invitrogen) according to the manufacturer's protocol. 24 hours after transfection, COS-7 cells were washed twice with serum-free inositol-free DMEM and incubated in 1.5 ml supplemented with 0.25% fatty acid-free bovine serum albumin (Sigma) and 1.5 uCi / ml myo-[2- 3 After another 24 hours, the cells were incubated for 1 hour in 1.2 ml serum-free inositol-free DMEM containing 20 mM LiCl with or without stimulation with 100 ng / ml EGF (Calbiochem).

[0250] The cells were lysed by adding 1.2 ml of 4.5% perchloric acid and incubating on ice for 30 minutes. The lysed samples were then centrifuged at 3700 g for 20 minutes. The supernatant was removed and neutralized by adding 3 ml of 0.5 M potassium hydroxide / 9 mM sodium tetraborate and centrifuged at 3700 g for another 20 minutes.

[0251] Supernatant is loaded on AG1-X8 200-400 post (Bio-Rad), by adding 2M ammonium formate / 0.1M formic acid, it is converted into formate form, and uses water balance.Post is washed three times with 60mM ammonium formate / 5mM sodium tetraborate of 5ml, and with 1.2M ammonium formate / 0.1M formic acid elution phosphoinositide of 5ml.5ml Ultima-Flo scintillation fluid (PerkinElmer LifeSciences) is added in the eluent, and carries out quantitative radioactivity by liquid scintillation counting.Described value represents total phosphoinositide.

[0252] The precipitate from the first centrifugation is resuspended in 100 μl water and 375 μl of chloroform / methanol / HCl (200:100:15) is added. The sample is vortexed and 125 μl of additional chloroform and 125 μl of 0.1M HCl are added. After further vortexing, the sample is centrifuged at 700g for 10 minutes. The lower layer of 10 μl is put into a scintillation bottle of the Ultima-Flo scintillation fluid of 3ml, and radioactivity is quantified by liquid scintillation counting. The obtained value corresponds to the radioactivity in the inositol lipids.

[0253] PLCγ2 activity was expressed as the total [ 3 H]-phosphoinositide relative to the [ 3 PLCγ2 mutants that exhibited higher activity than wild-type PLCγ2 in the above assay were considered gain-of-function mutants.

[0254] Example 4. Assay for detecting PLCγ2 activity in DT40 cells stably expressing wild-type or mutant PLCγ2

[0255] The activity of PLCγ2 can also be determined by measuring the increased levels of calcium flux in DT40 cells stably expressing wild-type or mutant PLCγ2, as described in Woyach et al., Resistance Mechanisms for the Bruton's Tyrosine Kinase Inhibitor Ibrutinib, New England Journal of Medicine, 2014, 370:2286-2294.

[0256] In brief, the intracellular calcium level of DT40 cells stably expressing wild-type or mutant PLCγ2 was detected by calcium determination kit (BD Biosciences), and measured by Beckman Coulter DTX880 microplate reader according to the manufacturer's protocol. After collecting 195 seconds to determine the baseline, 3 μg / ml anti-chicken IgM (SouthernBiotech) was added to stimulate the cells, and the fluorescence signal was recorded for another 660 seconds.

[0257] PLCγ2 mutants that exhibited higher calcium influx signals than wild-type PLCγ2 in the above assay were considered gain-of-function mutants.

[0258] Example 5. Assay for detecting PLCγ2 activity in primary patient cells

[0259] It is also possible to measure increases in calcium flux levels stimulated by IP3 To determine the activity of PLCγ2 , as described in Novice et al., AGermline Mutation in the C2 Domain of PLCγ2Associated with Gain-of-Function Expands the Phenotype for PLCG2-Related Diseases, Journal of Clinical Immunology, 2020, 40: 267-276.

[0260] Briefly, PBMCs from subjects (e.g., patients or healthy controls) were cultured in HBSS (without Ca2+). 2+ , Mg-free 2+ , Life Technologies) +1% FBS Wash once with 1 × 10 6 PBMC / mL were resuspended in dye loading buffer consisting of 4 μM FLUO-4AM (Molecular Probes) and probenecid (Life Technologies) in HBSS + 1% FBS for 45 minutes. Cells were washed again with HBSS + 1% FBS and then incubated on ice with 5 μL of PACIFIC BLUE TM -CD19 (HIB19; BioLegend) was incubated for 20 minutes, followed by the addition of 1 mL HBSS + 1% FBS. The samples were warmed to 37°C again, and baseline fluorescence in the CD 19 + positive fraction was detected within 10 minutes using a FITC filter on an LSR II flow cytometer. Intracellular calcium flux was induced by stimulating B cell receptors with 10 μg / mL anti-IgM antibody (Jackson Immunoresearch), and then extracellular Ca was added. 2+ To measure external flux, intracellular and plasma calcium fluxes were measured by flow cytometry following B cell receptor stimulation in primary B cells from the subjects.

[0261] An increase in external calcium entry induced by B cell receptor stimulation in primary B cells of the subject compared to a control group indicates that the subject has a gain-of-function mutation in PLCγ2.

[0262] Although the foregoing disclosure has been described in detail by way of illustration and example for the purpose of clarity and understanding, it will be apparent to those skilled in the art upon reading this disclosure that various changes in form and detail may be made without departing from the true scope of the disclosure, and may be practiced within the scope of the appended claims. For example, all constructs, methods and / or component features, steps, elements or other aspects thereof may be used in various combinations.

[0263] A claim or description including "or" between one or more members of a group is considered satisfied if one, more than one, or all of the members of the group are present in, used in, or otherwise associated with a specified product or process, unless otherwise indicated or otherwise obvious from the context. The present disclosure includes embodiments in which exactly one member of the group is present in, used in, or otherwise associated with a given product or method. The present disclosure also includes embodiments in which more than one or the entire group of members is present in, used in, or otherwise associated with a given product or method. In addition, it should be understood that the present disclosure encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc. from one or more of the listed claims are introduced into another claim subordinate to the same basic claim (or as any other claim as a correlation), unless otherwise indicated or unless it is obvious to one of ordinary skill in the art that a conflict or contradiction would arise. In the case where elements are presented as a list (e.g., in Markush groups or similar formats), it is understood that each subgroup of the elements is also disclosed, and any element can be removed from the group. In general, when an embodiment or aspect of the present disclosure is referred to as comprising a particular element, feature, etc., some embodiments or aspects consist of such elements, features, etc., or consist essentially of such elements, features, etc. For simplicity, those embodiments are not specifically described in so many words in each case herein. It is also understood that any embodiment or aspect of the present disclosure can be explicitly excluded from the claims, regardless of whether a specific exclusion is described in the specification.

[0264] All patents, patent applications, websites, other publications or documents, accession numbers, etc. cited herein are incorporated by reference in their entirety for all purposes to the same extent as if each individual item was specifically and individually indicated to be so incorporated by reference.

Claims

1. A method of treating a disease or disorder associated with constitutively activated phosphatidylinositol-specific phospholipase Cγ2 (PLCγ2) in a subject in need thereof, the method comprising administering to the subject an effective amount of a Bruton's tyrosine kinase (BTK) reducing molecule.

2. A method of treating a disease or disorder associated with constitutively activated phosphatidylinositol-specific phospholipase Cγ2 (PLCγ2) in a subject in need thereof, the method comprising administering to the subject an effective amount of a Bruton's tyrosine kinase (BTK) reducing molecule, in, Prior to administering the BTK-reducing molecule to the subject, the subject has been determined to have constitutively activated PLCγ2 in one or more cells.

3. The method of claim 1 or 2, wherein the constitutively activated PLCγ2 is caused by one or more gain-of-function mutations in a gene encoding PLCγ2.

4. The method of any one of claims 1-3, wherein the disease or disorder associated with constitutively activated PLCγ2 is cancer.

5. The method of claim 4, wherein the cancer is a hematological cancer or a solid tumor.

6. The method of claim 5, wherein the hematological cancer is a B-cell malignancy.

7. The method of claim 6, wherein the B-cell malignancy is non-Hodgkin lymphoma (NHL).

8. The method of claim 7, wherein the non-Hodgkin lymphoma (NHL) is chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), mantle cell lymphoma (MCL), marginal zone lymphoma (MZL), or Waldenstrom's macroglobulinemia (WM).

9. The method of any one of claims 4-8, wherein the cancer is resistant to a BTK inhibitor.

10. The method of claim 9, wherein the BTK inhibitor is ibrutinib, acalabrutinib, zanubrutinib, or tilarutinib.

11. The method of any one of claims 4-10, wherein the method further comprises determining a cancer cell obtained from the subject as having constitutively activated PLCy2 relative to a non-cancerous cell obtained from the subject.

12. The method of any one of claims 4-11, wherein the method further comprises identifying cancer cells obtained from the subject as having one or more gain-of-function mutations in a gene encoding PLCy2.

13. The method of any one of claims 1-3, wherein the disease or disorder associated with constitutively activated PLCy2 is an immune system disorder.

14. The method of claim 13, wherein the immune system disorder is PLCγ2-associated antibody deficiency and immunodysregulation syndrome (PLAID), familial cold autoinflammatory syndrome (FCAS3), autoinflammatory, antibody deficiency and immunodysregulation syndrome (APLAID), common variable immunodeficiency (CVID).

15. The method of claim 13 or 14, wherein the method further comprises determining immune cells obtained from the subject as having constitutively activated PLCy2 relative to cells obtained from a healthy subject.

16. The method of any one of claims 13-15, wherein the method further comprises identifying immune cells obtained from the subject as having one or more gain-of-function mutations in a gene encoding PLCy2.

17. The method of any one of claims 3-16, wherein the one or more gain-of-function mutations comprise one or more mutations at amino acids P139, T168, I169, D334, Y482, N571, P664, R665, S707, A708, S718, R742, L845, L848, D993, D1140, M1141, F1142, or D1144 of SEQ ID NO: 1, or a deletion of one or more amino acids of SEQ ID NO:

1.

18. The method of claim 17, wherein the one or more gain-of-function mutations comprise one or more of the following mutations: P139S, T168A, I169V, D334H, Y482H, N571S, P664S, R665W, S707Y, S707P, S707F, A708P, S718R, R742P, L845F, L845V, L848P, D993Y, D993H, D1140G, D1140Y, D1140N, D1140E, D1140V, M1141L, M1141R, M1141K, F1142L, D1144N, or D1144G of SEQ ID NO: 1, or a deletion of at least amino acids L845-L848 of SEQ ID NO: 1, or a deletion of at least amino acids L845-L848 of SEQ ID NO: 1 Deletion of one or more nucleotides in exons 19-22 of the gene NO:

1.

19. The method of any one of claims 4-12, wherein the one or more gain-of-function mutations comprise one or more mutations in SEQ ID NO: 1, wherein the one or more mutations are selected from: D334H, P664S, R665W, S707Y, S707P, S707F, A708P, R742P, L845F, L845V, D993Y, D993H, D1140G, D1140Y, D1140N, D1140E, D1140V, M1141R, M1141K, F1142L, D1144N and D1144G, or a deletion of at least S707-A708 of SEQ ID NO: 1, or a deletion of one or more nucleotides in exon 20 of the gene encoding SEQ ID NO:

1.

20. The method of any one of claims 13-16, wherein the one or more gain-of-function mutations comprise one or more mutations in SEQ ID NO: 1, wherein the one or more mutations are selected from: P139S, T168A, I169V, Y482H, N571S, S707Y, S707P, A708P, S718R, L848P, M1141L and M1141K, or a deletion of at least amino acids L845-L848 of SEQ ID NO: 1, or a deletion of one or more nucleotides in exons 19-22 of the gene encoding SEQ ID NO:

1.

21. The method of any one of claims 3-16, wherein the one or more gain-of-function mutations are located within the regulatory domain and / or the calcium binding domain of PLCy2.

22. The method of claim 21, wherein the one or more gain-of-function mutations located within the regulatory domain and / or calcium binding domain of PLCγ2 comprise one or more mutations at amino acids Y482, N571, P664, R665, S707, A708, S718, R742, L845, L848, D1140, M1141, F1142, or D1144 of SEQ ID NO:

1.

23. The method of claim 22, wherein the one or more gain-of-function mutations located within the regulatory domain and / or calcium binding domain of PLCγ2 comprise one or more of the following mutations: Y482H, N571S, P664S, R665W, S707Y, S707P, S707F, A708P, S718R, R742P, L845F, L845V, L848P, D993Y, D993H, D1140G, D1140Y, D1140N, D1140E, D1140V, M1141L, M1141R, M1141K, F1142L, D1144N or D1144G of SEQ ID NO:

1.

24. The method of any one of claims 1-23, wherein the BTK reducing molecule is a BTK degrader molecule.

25. The method of claim 24, wherein the BTK degrader molecule is a compound of formula I or a pharmaceutically acceptable salt thereof: wherein X is CH or N; wherein Y is CH or N; Where R 1 Selected from H, C 1 -C 3 Alkyl, C 1 -C 3 haloalkyl, dialkylamino, amino, -CN, hydroxy, C 1 -C 4 Alkoxy and halogen; Each R 2 and R 3 are independently selected from H, halogen, -CN, hydroxyl, dialkylamino groups, C 1 -C 5 Alkyl, deuterated C 1 -C 5 Alkyl, C 1 -C 5 Alkoxy, deuterated C 1 -C 5 Alkoxy and C 1 -C 5 Haloalkyl; Where Q is LW 1 or LW 2 ; wherein L is a linker of 2 to 20 carbon atoms in length, wherein one or more carbon atoms are optionally and independently selected from C(═O), O, N(R 6 )、S、S(O)、SO 2 、C(O)NH、C(O)NCH 3 、C(O)NCH 2 CH 3 , C 2 -Alkenyl, C 2 -alkynyl, cycloalkyl, heterocycloalkyl, heterocycle, aryl or heteroaryl, each of which is independently replaced by 0, 1, 2 or 3 R 7 replace; Where W 1 Selected from Where R 4 Selected from H, halogen, -CN, C 1 -C 5 Alkyl, C 1 -C 5 Alkoxy and C 1 -C 5 haloalkyl; and Where W 2 yes Where R 5 Selected from H, halogen, -CN, C 1 -C 5 Alkyl, deuterated C 1 -C 5 Alkyl, C 1 -C 5 Alkoxy, deuterated C 1 -C 5 Alkoxy and C 1 -C 5 Haloalkyl; Each R 6 Independently selected from H, C 1 -C 3 Alkyl, -C(=O)-(C 1 -C 3 alkyl), -C(=O)-O-(C 1 -C 3 alkyl) and -C(=O)-NH-(C 1 -C 3 alkyl), each of which is replaced by 0, 1, 2 or 3 R 7 replace; and Each R 7 are independently selected from halogen, hydroxyl, amino group, C 1 -C 3 Alkyl, C 1 -C 3 Alkoxy, C 1 -C 3 Haloalkyl, -N(R 6 ) 2 and -CN.

26. The method of claim 25, wherein L is 2 to 12 carbon atoms in length, wherein one or more carbon atoms are optionally and independently replaced by a group selected from the group consisting of C(=O), O, S, S(O), SO 2 、C(O)NH、C(O)NCH 3 、C(O)NCH 2 CH 3 NH, NCH 3 、NCH 2 CH 3 , C 2 -Alkynyl, 27. The method of claim 25 or 26, wherein the BTK degrader molecule is: or a pharmaceutically acceptable salt thereof.

28. The method of any one of claims 24-27, wherein the BTK degrader molecule is administered to the subject at a dose of about 0.1 mg / kg to about 500 mg / kg.

29. The method of any one of claims 1-23, wherein the BTK reducing molecule is a nucleic acid inhibitor molecule.

30. The method of claim 29, wherein the nucleic acid inhibitor molecule is an antisense oligonucleotide, a microRNA, an RNAi molecule, an aptamer, an antagomir, or a ribozyme.

31. The method of any one of claims 1-30, wherein the subject is a human.

Images