Nucleic acids, vectors, compositions and methods for enhancing expression of proteins of interest

Abstract

The present invention relates to nucleic acids, vectors, compositions, kits and cell lines comprising a US11 5 'preamble sequence (SEQ ID NO: 1 or SEQ ID NO: 4), a UL27 5' preamble sequence (SEQ ID NO: 7 or SEQ ID NO: 10) or a UL19 5 'preamble sequence (SEQ ID NO: 13 or SEQ ID NO: 16) wherein the preamble sequence is capable of enhancing translation of a downstream gene encoding a protein of interest, thereby increasing protein production, expression or synthesis in HSV1 infected cells. The 5 '-leader sequence increases protein expression several times as compared to protein expression in the absence of the leader sequence Methods of increasing protein production, methods of increasing the efficiency of existing gene therapies, and methods of treating medical conditions, cell defects, diseases or conditions are also provided.

Description

Technical Field

[0001] The present invention relates to a nucleic acid sequence; a vector, a composition, a cell and a kit comprising the nucleic acid sequence, wherein the nucleic acid sequence is capable of increasing the translation of a gene encoding a target protein. More specifically, the present invention relates to a nucleic acid sequence that increases protein production or expression when located upstream or 5' of a gene encoding a target protein, and also to a method for increasing protein production. Background Art

[0002] The use of viruses as vectors to deliver therapeutic payloads has become increasingly important in various biomedical applications, such as viral vector-based vaccines, gene therapy, and oncolytic viruses (OVs). In the case of OVs, high intratumoral transgene expression is critical for eliciting optimal antitumor immune responses and therapeutic effects. Therefore, OV platforms in clinical and preclinical development are engineered to encode one or more of the following: 1) immunomodulatory host proteins or tumor-associated antigens that can amplify antitumor immune responses, 2) suicide proteins designed to induce cancer cell death, and 3) reporter proteins (e.g., green fluorescent protein or luciferase) that facilitate tracking and drug delivery.

[0003] The components comprising the transgene expression cassette within the viral vector typically encode the transgene as an intron-free open reading frame (ORF), flanked by an upstream promoter and terminated by a poly(A) signal in the HSV1 genome. The remaining sequences of the multiple cloning site (MCS) between the transcription start site (TSS) and the start codon after the promoter, or between the stop codon and the poly(A) signal, serve as short 5'UTR and 3'UTR, respectively. A great deal of effort has been spent on ensuring high transgene transcription in pre-infected cells, by incorporating strong host promoters, such as promoters from human phosphoglycerate kinase (PGK) or elongation factor 1α (EF1α), or promoters from viruses, such as the cytomegalovirus (CMV) immediate early promoter. However, any bottlenecks in the subsequent translation of the transgenic mRNA into protein have not been thoroughly investigated, as it is assumed that differences in translation rates will be negligible if transcripts are highly expressed. The innate antiviral response to the presence of replicating viruses challenges this assumption; infected cells have dramatic changes in the subset of mRNAs that are translated, and replicating viruses actively reshape the host protein synthesis machinery to favor the production of viral proteins while hindering the production of proteins from their host. As a result, in infected cells, the translation rate of transgene mRNAs may be altered. Ultimately, this could lead to suboptimal transgene protein production and, therefore, compromise the therapeutic potential of replicating viral vectors by delivering viral units with insufficient specific activity to cancer patients.

[0004] Surprisingly, transgenes have not been optimized for their viral platforms, and underexpression can compromise therapeutic efficacy. One example is T-Vec; in a Phase I trial, GM-CSF mRNA levels detected in fine needle aspirates from multiple different tumor types remained stable or below detection at moderate doses, suggesting that expression in humans is suboptimal. In another Phase I trial, Jennerex-594 (JX594), a clinical oncolytic vaccinia virus (VV) candidate also engineered to express GM-CSF, showed no significant difference in mRNA expression at low intravenous doses of the virus (10 5 -10 6 In contrast, a viral dose increase of one order of magnitude did produce positive detection of this therapeutic protein. However, the requirement for increased doses is unwarranted, as it is desirable to minimize viral doses to improve the safety profile of these promising virotherapies. In other words, it is desirable to improve the specific activity of OVs; non-OV-based virotherapies, or any viral or non-viral gene delivery mechanism, to enhance the targeting and expression of their transgenes while reducing the accompanying toxic effects of their vectors or delivery vehicles. BRIEF DESCRIPTION OF THE DRAWINGS

[0005] Figure 1a , 1b and 1c show representative nucleic acid sequences of the present invention.

[0006] Figure 2 Characterization of HSV1 individual transcripts from RNA-seq coverage is generally shown.

[0007] Figure 2 A shows total RNA-seq coverage of the HSV1 genome from 4T1 infected cells. Strand-specific RNA reads were mapped to the HSV1 genome and separated by strand direction to avoid ambiguous mapping of overlapping genes.

[0008] Figure 2 B shows RNA-seq coverage of the US1 gene, where intron-spanning reads are also detected and depicted using a Sashimi plot.

[0009] Figure 2 C shows RNA-seq coverage in the 5' region of the US1 gene. The lower panel shows the region of the predicted TSS at nucleotide resolution.

[0010] Figure 2 D shows RNA-seq coverage of the 3' region of the US1 gene.

[0011] Figure 2E provides a schematic workflow for identifying the HSV1 5' leader sequence from RNA-seq reads, screening for genes that specifically enhance translation of the 5' leader sequence in HSV1-infected cells, and integrating the 5' leader sequence into the oncolytic HSV1 genome for transgene expression for testing in in vivo tumor models.

[0012] Figure 3 It is generally shown that the HSV1 US11 5' leader sequence enhances the expression of a protein reporter gene in HSV1 infected mammalian cells.

[0013] Figure 3 A is a schematic diagram of the mRNA expressed by the CAT reporter construct with / without the HSV1 5'UTR.

[0014] Figure 3 B shows a translation reporter gene assay for screening HSV15' leader sequences that enhance translation during HSV1 infection. 4T1 cells were infected with HSV-1716-GFP at an MOI of 5 and then transfected with CAT plasmid and β-GAL expression plasmid used as a transfection control. Cells were lysed 24 hours after infection and CAT expression was quantified by ELISA, while β-GAL activity was quantified by colorimetric assay using ONPG substrate. A two-way ANOVA with Tukey post hoc test was performed. Only significance tests are shown. n = at least 3 biological replicates. Error bars indicate standard deviation (sd). *p<0.05, **p<0.01.

[0015] Figure 3 C shows relative CAT mRNA expression from CAT translation reporter gene assay. 4T1 cells were treated as in (C) and then lysed using Trizol. RT-qPCR was then used to quantify mRNA expression of CAT mRNA, normalized to the expression of Rps20. Two-way ANOVA with Sidak post hoc test was performed. n=3 biological replicates. Only significance tests are shown. Error bars indicate standard deviation (sd). *p<0.05, **p<0.01, ****p<0.0001.

[0016] Figure 3 D shows a schematic diagram of the pTK-Green plasmid containing the HSV1 5' leader-reporter construct for insertion into the HSV1 TK gene and the transcripts produced thereby. The ribosomal skipping sequence P2A is inserted between the luciferase CDS and the GFP CDS, allowing synthesis of two proteins from one cistron.

[0017] Figure 3E shows quantification of GFP fluorescence. Cells were transfected with LUC-GFP reporter plasmid and then infected with HSV1 (JQ780693 for KOS strain) at an MOI of 2.5 4 hours after transfection. Images were taken 24 hours after infection.

[0018] Figure 3 F shows a Western blot of lysates of 293T cells treated with antibodies against GFP, anti-HSV1 or anti-β-actin antibodies as indicated in (B). (*): non-specific bands.

[0019] Figure 3 G shows quantification of GFP expression in the Western blot in (F).

[0020] Figure 3 H shows RT-qPCR quantification of LUC-GFP mRNA from the same experiment. Two-way ANOVA with Sidak post hoc test was performed. n=3 biological replicates. Error bars indicate standard deviation (sd). *p<0.05, **p<0.01, ****p<0.0001, ns, not significant.

[0021] Figure 4 It was shown that the recombinant HSV1 virus exhibited US11 5' leader sequence-dependent enhancement of GM-CSF expression.

[0022] Figure 4 A shows a schematic diagram of the insertion scheme of the expression cassette from the pTK-CSF2-GFP plasmid into the HSV1 genome (note that the TK gene is on the minus strand), and the resulting transcripts expressed from the inserted cassette.

[0023] Figure 4 B shows viral genotyping for confirmation of expression cassette insertion. PCR was performed using HSV1 gDNA extracted from purified virus to confirm the insertion of the CSF2-GFP cassette without leader sequence (~400 bp) and US11 5' leader sequence-CSF2-GFP cassette (~600 bp) in the TK region of the HSV1 genome.

[0024] Figure 4 C shows fluorescence imaging of single plaques of wild-type HSV1, HSV1 Csf2, and HSV1 US11-Csf2.

[0025] Figure 4D shows quantification of GM-CSF production in culture supernatants of Vero cells infected with HSV1 (expressing CSF2-GFP without leader sequence or US11 5' leader sequence-CSF2-GFP). Monolayers of Vero cells were infected with the indicated viruses at an MOI of 5, and culture supernatants were collected 24 hours after infection. GM-CSF concentrations were quantified by ELISA. One-way ANOVA with Dunnett's post hoc test was performed. n=3 biological replicates. Error bars: ±sd. ****p<0.0001.

[0026] Figure 4 E shows the single-step growth curves of HSV1 Csf2 and HSV1 US11-Csf2. Vero cell monolayers were infected at an MOI of 5, and intracellular and extracellular viruses were collected and titrated at the indicated time points.

[0027] Figure 4 F shows the transcription levels of HSV1 endogenous genes (US6) and transgenes. Vero cell monolayers were infected with an MOI of 5 and then cells were lysed using Trizol at the indicated time points. mRNA abundance was quantified by RT-qPCR and normalized to Rps20. Figure 5 It was generally shown that the HSV1 US11 leader sequence increased the translation efficiency of downstream transgenes.

[0028] Figure 5 A shows fluorescence and phase contrast images of HSV1-infected Vero cells used for polysome grouping experiments in (B) and (C). Scale bar: 400 μm.

[0029] Figure 5 B shows polysome traces of Vero cells infected with HSV1 Csf2 or HSV1 US11-Csf2 at an MOI of 5. Cells were lysed 24 hours after infection for polysome fractionation.

[0030] Figure 5 C shows the mRNA distribution in the polysomal fraction of Csf2 (upper panel) and endogenous HSV1 transcripts US6 (middle panel) and US11 (lower panel), quantified by RT-qPCR. Two-sided t-tests were performed, n=3 biological replicates. Error bars indicate standard deviation. **: p<0.01, *: p<0.05.

[0031] Figure 5D shows the mRNA distribution in the untranslated fraction (sub-polysomes), poorly translated fraction (2-4 ribosomes) and highly translated fraction (>4 ribosomes) of Csf2 (upper panel), US6 (middle panel) and US11 (lower panel) transcripts. Multiple unpaired t-tests were performed, n=3 biological replicates. Error bars indicate standard deviation (sd). ***: p<0.001.

[0032] Figure 5 E shows quantification of GFP fluorescence in Vero cells transfected with pTK-CSF2-GFP plasmid with or without US11 leader sequence, co-transfected with poly(I:C), or transfected immediately after infection with VSV or wild-type HSV1 at an MOI of 5.

[0033] Figure 6 It was generally shown that the US11 5' leader sequence enhanced the anti-tumor effect of GM-CSF expressing HSV1.

[0034] Figure 6 A shows a schematic overview of the in vivo studies to characterize the effects of HSV1 US11-Csf2 on tumor inflammation and systemic anti-tumor T cells. 5 CT26 cells were injected into the bilateral flanks of BALB / c mice. When the tumors reached approximately 5x5 mm, 5x10 5 PFU of the indicated viruses. Tumor size was measured every 2 days.

[0035] Figure 6 B shows the intratumoral GM-CSF levels of tumors treated with no leader or HSV1 US11-Csf2. Tumors generated in (A) were excised 1 day after the second injection and homogenized in PBS. GM-CSF levels were then quantified by ELISA. Two-tailed unpaired t-tests were performed, n=3 biological replicates. Error bars: ± sd.

[0036] Figure 6 C shows viral transcripts and inflammatory gene expression levels in oHSV1-treated tumors. RNA from tumors in (B) was extracted with Trizol, and mRNA abundance of the indicated transcripts was quantified by RT-qPCR and normalized to Actb. Two-tailed unpaired t-tests were performed, n=3 biological replicates. Error bars: ±sd.

[0037] Figure 6D shows systemic tumor-specific T cell responses after oHSV1 injection assessed by IFNγ ELISPOT. Eight days after the first injection, splenocytes were isolated from mice and co-cultured with / without UV-irradiated CT26 at a 2:1 responder to stimulator ratio for 24 hours. Representative ELISPOT wells are shown as well as quantification of CT26-specific points in the bar graph. A two-tailed unpaired t-test was performed. Error bars: ± sd.

[0038] Figure 6 E shows the effect of no leader sequence treatment or HSV1 US11-Csf2 treatment on tumor growth. The number of mice is shown in parentheses. Two-way ANOVA with Tukey post hoc test was performed. Error bars: ± sd.

[0039] Figure 6 F shows Kaplan-Meier survival curves for mice treated with leaderless or US11-Csf2 HSV1. The number of mice is shown in parentheses.

[0040] Figure 7 Individual transcripts (RL2, UL15, US1, US12) identified by RNA-seq coverage on both the positive strand (blue) and the negative strand (red) are shown.

[0041] Figures 8A-8D Total RNA-seq coverage of the HSV1 genome is shown. RNA-seq data for 4T1 infected with HSV1 were previously published (Hoang et al., 2019). Strand-specific RNA reads were mapped to HSV1 (JQ780693.1) and separated by orientation to avoid ambiguous mapping of overlapping genes. The figure shows an illustration of each identified TSS for all HSV1 genes.

[0042] Fig. 9 Relative mRNA expression levels of 10 late genes (left heat map) and 4 immediate early genes (right heat map) selected as candidates are shown. mRNA expression was obtained from a previously reported study by Rutkowski et al., 2015. Expression levels were normalized to a percentage of the highest expression level at all time points.

[0043] Fig.10 Generally shown are translation reporter screens for 5'UTRs that enhance translation during HSV1 infection.

[0044] Fig.10 A shows other HSV1 5' leader sequences (including Figure 3Agarose gel visualization of the remaining 5' leader sequence amplified from total RNA of HSV1 infected cells in . A negative control (RNA from uninfected cells) confirmed that the PCR product was specific for HSV1 transcripts only.

[0045] (*): nonspecific band.

[0046] Fig.10 B shows a translation reporter assay to screen for HSV-1 leader sequences that enhance translation during HSV-1 infection. 4T1 cells were transfected with CAT plasmid and β-GAL expression plasmid as a transfection control. 8 hours after transfection, cells were infected with HSV-1716-GFP at an MOI of 5. 18 hours after infection, cells were lysed and CAT expression was quantified by ELISA, while β-GAL activity was quantified by colorimetric assay using ONPG substrate.

[0047] Fig.10 C shows the secondary structures and folding free energies of US11 (left) and UL27 (right) leader sequences predicted using Vienna RNAfold33. The color scale indicates the base pairing probability.

[0048] Fig.10 D shows a heat map representing the folding free energies of candidate HSV1 leader sequences calculated using Vienna RNAfold.

[0049] Fig.11 It was shown that US11 leader enhancement is robust in different cell types and species. Monolayers of African green monkey kidney cell line Vero, mouse breast cancer cell line 4T1, human pancreatic cancer cell line DU145, and human renal cancer cell line 786-O were infected with HSV1 KOS leaderless sequence or HSV1 US11 5' leader sequence at an MOI of 0.1, and then GFP fluorescence intensity was observed for 48 hours using the Incucyte live cell imaging system.

[0050] Fig.12 It was shown that the translation of transgenic mRNA without leader sequence was poor compared with viral mRNA. Figure 4 In the same polysome profiling experiments described in , the mRNA distribution of US6 and US11 was compared with that of Csf2 without a leader sequence ( Fig.12 A) or US11-Csf2( Fig.12 B) The distribution of mRNA was compared.

[0051] Fig.13 Shows Figure 6 The sizes of individual tumors are shown in E.

[0052] Fig.14Raw data from a single well in the IFNγ ELISPOT experiment in 6D are shown.

[0053] Fig.15 Enhanced expression of the US11 5' leader sequence in oncolytic HSV1 was characterized.

[0054] Fig.15 A shows Vero cell monolayers infected with the indicated viruses at an MOI of 5, and culture supernatants were collected 24 hours after infection. GM-CSF concentrations were quantified by ELISA. One-way ANOVA with Dunnett's post hoc test was performed. n=3 biological replicates. Error bars: +sd. ****«p<0.0001.

[0055] Fig.15 B shows representative GFP fluorescence of HSV1 expressing CSF2-GFP without leader sequence or US11 5' leader sequence-CSF2-GFP. CT26 monolayers were infected with the indicated viruses at an MOI of 5, and fluorescence microscopy images were taken 24 hours after infection.

[0056] Fig.15 C shows the time course of GFP fluorescence of HSV1 expressing CSF2-GFP without leader sequence or US11 5' leader sequence-CSF2-GFP. CT26 monolayers were infected with the indicated viruses at an MOI of 0.2, 1, or 5, and GFP fluorescence was monitored over 2 days post-infection using the Incucyte Live Cell Imaging System.

[0057] Fig.15 D shows the dose-dependency analysis of secreted GM-CSF. CT26 cells were infected with the indicated viruses at an MOI of 0.2, 1, or 5, and the culture supernatants were collected 24 hours after infection. GM-CSF concentrations were quantified using ELISA. Two-way ANOVA with Sidak post hoc test was performed. n=3 biological replicates. Error bars: +sd. ****p<0.0001. Summary of the invention

[0058] The present invention relates to a nucleic acid comprising SEQ ID NO:1 or a fragment thereof containing at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:1, wherein the nucleic acid does not comprise SEQ ID NO:2, SEQ ID NO:3 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:2, 3 or both, wherein the fragment of SEQ ID NO:2, 3 or both is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases thereof immediately consecutive to the 5' or 3' end of SEQ ID NO:1.

[0059] In some embodiments, the present invention relates to a nucleic acid comprising SEQ ID NO:4 or a fragment thereof containing at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:4, wherein the nucleic acid does not comprise SEQ ID NO:5, SEQ ID NO:6 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:5, 6 or both, and the fragment of SEQ ID NO:5, 6 or both is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases thereof immediately consecutive to the 5' or 3' end of SEQ ID NO:4.

[0060] In some embodiments, the present invention relates to a nucleic acid comprising SEQ ID NO:7 or a fragment thereof containing at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:7, wherein the nucleic acid does not comprise SEQ ID NO:8, SEQ ID NO:9 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:8, 9 or both, and the fragment of SEQ ID NO:8, 9 or both is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases thereof immediately consecutive to the 5' or 3' end of SEQ ID NO:7.

[0061] In some embodiments, the present invention relates to a nucleic acid comprising SEQ ID NO:10 or a fragment thereof containing at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:16, wherein the nucleic acid does not comprise SEQ ID NO:11, SEQ ID NO:12 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:11, 12 or both, and the fragment of SEQ ID NO:11, 12 or both is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases thereof immediately consecutive to the 5' or 3' end of SEQ ID NO:10.

[0062] In some embodiments, the present invention relates to a nucleic acid comprising SEQ ID NO: 13 or a fragment thereof containing at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 13, wherein the nucleic acid does not comprise SEQ ID NO: 14, SEQ ID NO: 15 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO: 14, 15 or both, and the fragment of SEQ ID NO: 14, 15 or both is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases thereof immediately consecutive to the 5' or 3' end of SEQ ID NO: 13.

[0063] In some embodiments, the present invention relates to a nucleic acid comprising SEQ ID NO: 16 or a fragment thereof containing at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 16, wherein the nucleic acid does not comprise SEQ ID NO: 17, SEQ ID NO: 18 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO: 17, 18 or both, and the fragment of SEQ ID NO: 17, 18 or both is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases thereof immediately consecutive to the 5' or 3' end of SEQ ID NO: 16.

[0064] In one embodiment, a nucleic acid is provided, comprising SEQ ID NO: 1 or a fragment containing at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 1, wherein the nucleic acid does not contain SEQ ID NO: 2, SEQ ID NO: 3, or both. In an alternative embodiment, a sequence at least 90% identical to SEQ ID NO: 1 or a fragment containing at least 180 nucleotides is provided, wherein the nucleic acid does not contain SEQ ID NO: 2, SEQ ID NO: 3, or both. The above nucleic acid does not contain a fragment of SEQ ID NO: 2, 3, or both, and the fragment is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately consecutive to the 5' or 3' end of SEQ ID NO: 1.

[0065] In an alternative embodiment, a nucleic acid is provided, which comprises SEQ ID NO:4 (i.e., the RNA counterpart of SEQ ID NO:1), or a fragment containing at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:4, wherein the nucleic acid does not comprise SEQ ID NO:5 (i.e., the RNA counterpart of SEQ ID NO:2), SEQ ID NO:6 (i.e., the RNA counterpart of SEQ ID NO:3), or both. In an alternative embodiment, a sequence at least 90% identical to SEQ ID NO:4 or a fragment containing at least 180 nucleotides is provided, wherein the nucleic acid does not comprise SEQ ID NO:5, SEQ ID NO:6, or both. The above nucleic acid does not comprise a fragment of SEQ ID NO:5, 6, or both, which is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately consecutive to the 5' or 3' end of SEQ ID NO:4.

[0066] In an alternative embodiment, a nucleic acid is provided, comprising SEQ ID NO: 10 (i.e., the RNA counterpart of SEQ ID NO: 7), or a fragment comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 10, wherein the nucleic acid does not comprise SEQ ID NO: 11 (i.e., the RNA counterpart of SEQ ID NO: 8), SEQ ID NO: 12 (i.e., the RNA counterpart of SEQ ID NO: 9), or both. In an alternative embodiment, a sequence at least 90% identical to SEQ ID NO: 10 or a fragment comprising at least 180 nucleotides is provided, wherein the nucleic acid does not comprise SEQ ID NO: 11, SEQ ID NO: 12, or both. The above nucleic acid does not comprise a fragment of SEQ ID NO: 11, 12, or both, and the fragment is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately consecutive to the 5' or 3' end of SEQ ID NO: 10.

[0067] The nucleotide sequence or nucleic acid described in the present invention does not contain at least 250, 500, 1000 or more consecutive nucleotides of human herpesvirus 1 strain KOS (complete genome defined by NCBI accession number: JQ673480.1GI:380776962 or accession number JQ780693.1GI:384597744) or a sequence that is 95% identical thereto.

[0068] In one embodiment of the present invention, a vector is provided, comprising SEQ ID NO: 1, SEQ ID NO: 7, or SEQ ID NO: 13 or a fragment comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 1, SEQ ID NO: 7, or SEQ ID NO: 13, or a fragment comprising at least 180 nucleotides, and a promoter, a nucleotide sequence encoding a protein of interest, one or more regulatory sequences, one or more restriction endonucleases or cloning sites, and one or more polyadenylation sites or any combination thereof. An alternative embodiment is also provided, comprising RNA counterparts of SEQ ID NO: 1, 7, and 13 (i.e., SEQ ID NO: 4, 10, and 16).

[0069] In some alternative embodiments, the nucleic acid can be inserted into a gene delivery vehicle, some non-limiting examples of which are plasmids, expression cassettes, live viruses, DNA or RNA constructs or recombinant nucleotide constructs, intron-free open reading frames, nanoparticles, or lipid nanoparticles. In some embodiments, the above-mentioned gene delivery vehicle can be based on HSV or HSV1.

[0070] In one embodiment of the present invention, a cell, composition or kit comprising the above nucleic acid or vector is also provided. Specifically, the nucleic acid comprises SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or their RNA counterparts, i.e., SEQ ID NO: 4, SEQ ID NO: 10 or SEQ ID NO: 16. In some embodiments, the nucleic acid and the vector may be present in combination.

[0071] In the above embodiments, when the nucleic acid comprises SEQ ID NO:1, the nucleic acid does not comprise SEQ ID NO:2, SEQ ID NO:3 or both; when the nucleic acid comprises SEQ ID NO:4, the nucleic acid does not comprise SEQ ID NO:5, SEQ ID NO:6 or both; when the nucleic acid comprises SEQ ID NO:7, the nucleic acid does not comprise SEQ ID NO:8, SEQ ID NO:9 or both; when the nucleic acid comprises SEQ ID NO:10, the nucleic acid does not comprise SEQ ID NO:11, SEQ ID NO:12 or both; when the nucleic acid comprises SEQ ID NO:13, the nucleic acid does not comprise SEQ ID NO:14, SEQ ID NO:15 or both; when the nucleic acid comprises SEQ ID NO:16, the nucleic acid does not comprise SEQ ID NO:17, SEQ ID NO:18 or both.

[0072] If it is SEQ ID NO:1, the above-mentioned nucleic acid may not contain a fragment of SEQ ID NO:2, 3 or both, which fragment is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases immediately consecutive to the 5' or 3' end of SEQ ID NO:1.

[0073] If it is SEQ ID NO:4, the above-mentioned nucleic acid may not contain a fragment of SEQ ID NO:5, 6 or both, which fragment is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases immediately consecutive to the 5' or 3' end of SEQ ID NO:4.

[0074] If it is SEQ ID NO:7, the above-mentioned nucleic acid may not contain a fragment of SEQ ID NO:8, 9 or both, which fragment is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases immediately consecutive to the 5' or 3' end of SEQ ID NO:7.

[0075] If it is SEQ ID NO:10, the above-mentioned nucleic acid may not contain a fragment of SEQ ID NO:11, 12 or both, which fragment is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases immediately consecutive to the 5' or 3' end of SEQ ID NO:10.

[0076] If it is SEQ ID NO:13, the above-mentioned nucleic acid may not contain a fragment of SEQ ID NO:14, 15 or both, which fragment is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases immediately consecutive to the 5' or 3' end of SEQ ID NO:13.

[0077] If it is SEQ ID NO:16, the above-mentioned nucleic acid may not contain a fragment of SEQ ID NO:17, 18 or both, which fragment is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases immediately consecutive to the 5' or 3' end of SEQ ID NO:16.

[0078] In one embodiment of the invention, a method for producing a protein of interest in a cell is provided, wherein the method comprises administering a nucleic acid to the cell. The administered nucleic acid comprises a) a promoter, b) SEQ ID NO: 1, SEQ ID NO: 7 or SEQ ID NO: 13; and c) a sequence encoding the protein of interest expressed by the nucleic acid in the cell. An alternative embodiment is also provided, wherein the method employs an RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4), an RNA counterpart of SEQ ID NO: 7 (i.e., SEQ ID NO: 10), or an RNA counterpart of SEQ ID NO: 13 (i.e., SEQ ID NO: 16).

[0079] In an alternative embodiment, a method of increasing the expression, synthesis or production of a protein of interest in a cell is provided, comprising the steps of administering to the cell a nucleic acid, wherein the nucleic acid comprises a) a promoter; b) SEQ ID NO: 1, SEQ ID NO: 7 or SEQ ID NO: 13; and c) a sequence encoding a protein of interest expressed by the nucleic acid in the cell, wherein the increase in expression, synthesis or production of the protein of interest is relative to a similar step of administering the nucleic acid in the absence of SEQ ID NO: 1, SEQ ID NO: 7 or SEQ ID NO: 13. An alternative embodiment is also provided, wherein the method employs an RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4), an RNA counterpart of SEQ ID NO: 7 (i.e., SEQ ID NO: 10) or an RNA counterpart of SEQ ID NO: 13 (i.e., SEQ ID NO: 16).

[0080] In one embodiment of the present invention, a method for improving or treating a medical condition, cell defect or disease in a subject is provided. The method comprises administering a nucleic acid to a cell of a subject exhibiting the medical condition, cell defect or disease, wherein the nucleic acid comprises a) a promoter, b) SEQ ID NO: 1, SEQ ID NO: 7 or SEQ ID NO: 13; and c) a sequence encoding a protein of interest expressed by the nucleic acid in the cell. The selected protein of interest is capable of improving or treating the medical condition, cell defect or disease of the subject, and thus, the expression, synthesis or production of the protein of interest in the subject's cells can improve or treat the medical condition, cell defect or disease in the subject. An alternative method is also provided, wherein the nucleic acid comprises SEQ ID NO: 4, SEQ ID NO: 7 (i.e., SEQ ID NO: 10) or SEQ ID NO: 13 (i.e., SEQ ID NO: 16). DETAILED DESCRIPTION

[0081] The following description is of preferred embodiments only as examples and is not limited to the combination of features required to implement the present invention.

[0082] All terms should be understood as understood by those skilled in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this disclosure belongs. The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

[0083] Although various features of the present disclosure may be described in the context of a single embodiment, these features may also be provided separately or in any suitable combination. Conversely, although the present disclosure may be described herein in the context of separate multiple embodiments for clarity, the present disclosure may also be implemented in a single embodiment.

[0084] The following definitions are in addition to those in the art and are directed to this application.Thus, the terminology used herein is for describing particular embodiments only and is not intended to be limiting.

[0085] definition

[0086] In this application, the use of the singular includes the plural unless expressly stated otherwise. It must be noted that, as used in the specification, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.

[0087] In this application, the use of "or" means "and / or" unless otherwise stated. As used herein, the terms "and / or" and "any combination thereof" and their grammatical equivalents are used interchangeably. These terms convey that any and all combinations are specifically contemplated. The term "or" may be used conjunctive or disjunctive, unless the context clearly indicates disjunctive usage.

[0088] Furthermore, use of the term "including" as well as other forms such as "include," "includes," and "included" is not limiting.

[0089] References in the specification to “some embodiments,” “an embodiment,” “one embodiment,” “alternative embodiments,” or “other embodiments” mean that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least some embodiments of the present disclosure, but not necessarily in all embodiments.

[0090] As used in this specification and claims, the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include"), or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended, and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method or composition of the present disclosure, and vice versa. In addition, the compositions of the present disclosure can be used to implement the methods of the present disclosure.

[0091] The term "about" used herein in connection with a reference value and its grammatical equivalents may include the value itself and a numerical range of the value plus or minus 10%. The term "about" or "approximately" refers to an acceptable error range of a particular value determined by a person skilled in the art, which will depend in part on how to measure or determine the value, i.e., the limitations of the measurement system. For example, according to the practice of the art, "about" may be expressed within 1 or more than 1 standard deviation. Alternatively, "about" may represent a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. In another example, the amount "about 10" includes 10 and any amount from 9 to 11. In yet another example, the term "about" associated with a reference value may also include a numerical range of 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the value plus or minus the value. Alternatively, particularly for biological systems or processes, the term "about" may be expressed within the order of magnitude of a value, preferably within 5 times, and more preferably within 2 times. When particular values ​​are described in the application and claims, unless otherwise stated, the term "about" should be assumed to mean within an acceptable error range for the particular value.

[0092] The term "isolated" and its grammatical equivalents used herein refer to the removal of nucleic acids from their natural environment. Whether the nucleic acid is taken from nature (including genomic DNA and mRNA) or synthesized (including cDNA) and / or amplified under laboratory conditions, it should be understood that nucleic acids and proteins can be formulated with diluents or adjuvants and still be isolated for practical purposes. For example, when nucleic acids are used to be introduced into cells, they are usually mixed with acceptable carriers or diluents.

[0093] The term "gene" used herein refers to a nucleic acid molecule that can be used to produce mRNA, antisense RNA, siRNA, shRNA, miRNA, etc. A gene may or may not be used to produce a functional protein. A gene may include a coding region and a non-coding region (e.g., introns, regulatory elements, including promoters, enhancers, terminator sequences, and 5' and 3' untranslated regions). A gene may be "isolated," which means that a nucleic acid molecule is substantially or essentially free of components that are usually associated with the nucleic acid molecule under a natural state. Such components include other cell materials, culture media from recombinant production, and / or various chemicals for chemical synthesis of nucleic acid molecules. Reference to "gene" also includes reference to genes with continuous sequences within its scope, thereby defining continuous nucleic acid entities as defined herein, or reference to genes with non-continuous sequences, thereby defining non-continuous nucleic acid entities as defined herein. In some embodiments, the term "gene" includes within its scope an open reading frame, introns, and adjacent 5' and 3' non-coding nucleotide sequences that are involved in expression regulation and that encode a specific polypeptide. In this regard, the gene may further comprise a control sequence (such as a promoter, enhancer, termination and / or polyadenylation signal) or a heterologous control sequence that is naturally associated with a given gene. The gene sequence may be a cDNA or genomic DNA or a fragment thereof. The gene may be introduced into an appropriate vector to be maintained outside the chromosome or introduced into a host.

[0094] As used herein, "genome" refers to the entirety of an organism's genetic information, represented by genes and DNA non-coding sequences, whether chromosomal or non-chromosomal genetic elements, such as linear polynucleotides, e.g., including genes to be assembled and / or recombined. Thus, the term "genome" is intended to include the entire DNA of an organism, including nuclear DNA components, chromosomal or extrachromosomal DNA, and cytoplasmic domains (e.g., mitochondrial DNA).

[0095] As used herein, the terms "nucleic acid," "polynucleotide," "oligonucleotide," or "nucleotide," or any grammatical equivalent, refer to a polymeric form of nucleotides or nucleic acids of any length, whether ribonucleotides or deoxyribonucleotides. The term refers only to the primary structure of the molecule. Thus, the term includes double-stranded and single-stranded DNA, triple-stranded DNA, and double-stranded and single-stranded RNA. It also includes modified (e.g., by methylation and / or capping) and unmodified forms of polynucleotides. The term is also intended to include molecules containing non-naturally occurring or synthetic nucleotides and nucleotide analogs. The nucleic acid sequences and vectors disclosed or contemplated herein can be introduced into cells, for example, by transfection, transformation, or transduction.

[0096] When nucleic acids and / or nucleic acid sequences are naturally or artificially derived from common ancestral nucleic acids or nucleic acid sequences, they are "homologous". When the coding DNA of a protein and / or protein sequence is naturally or artificially derived from a common ancestral nucleic acid or nucleic acid sequence, the protein and / or protein sequence is "homologous". Homologous molecules may be referred to as homologs. Homology is usually inferred from the sequence identity between two or more nucleic acids (or their sequences). The exact percentage of identity between sequences that can be used to establish homology varies with the nucleic acid and protein in question, but sequence identity as low as 25% is usually used to establish homology. Homology can also be established using higher levels of sequence identity (e.g., 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more). Methods for determining sequence identity percentages (e.g., BLASTP and BLASTN using default parameters) are described herein and are generally available.

[0097] As used herein, the term "identical" and its grammatical equivalents or "sequence identity" in the context of two nucleic acid sequences or polypeptide amino acid sequences refers to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window.

[0098] Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be performed by the local homology algorithm of Smith and Waterman, Adv. Appl. Math., 2:482 (1981); the alignment algorithm of Needleman and Wunsch, J. Mol. Biol., 48:443 (1970); the search for similarity method of Pearson and Lipman, Proc. Nat. Acad. Sci USA, 85:2444 (1988); computerized implementations of these algorithms (including, but not limited to, CLUSTAL in the PC / Gene program of Intelligence, Mountain View Calif, GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics software package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis., USA); the CLUSTAL program in Higgins and Sharp, Gene, 73:237-244 (1988) and Higgins and Sharp, CABIOS, 5: 151-153 (1989); Corpet et al., Nucleic Acids Res., 16: 10881-10890 (1988); Huang et al., Computer Applications in the Biosciences, 8: 155-165 (1992); and Pearson et al., Methods in Molecular Biology, 24: 307-331 (1994) are described in detail. Alignment is also often performed by inspection and manual alignment. Nucleic acids can also be described with reference to starting nucleic acids, for example, they can be 50%, 60%, 70%, 75%, 80%, 85%, 90%, 98%, 99% or 100%> identical to a reference nucleic acid or a fragment thereof, for example, as measured by BLASTN (or CLUSTAL, or any other available alignment software) using default parameters. When a molecule is said to have a certain percentage of sequence identity with a larger molecule, this means that when the two molecules are optimally aligned, the stated percentage of residues in the smaller molecule will find a matching residue in the larger molecule, in the order in which the two molecules are optimally aligned.

[0099] The term "substantially identical" and its grammatical equivalents as applied to nucleic acid sequences means that the nucleic acid or amino acid sequence comprises a sequence having at least 90% sequence identity or higher (at least 95%, at least 98% and at least 99%) when compared to a reference sequence using the above-mentioned programs (e.g., BLAST) using standard parameters. For example, the BLASTN program (for nucleotide sequences) uses a word length (W) of 11, an expectation (E) of 10, M=5, N=-4 and a comparison of both chains by default. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may contain additions or deletions (i.e., gaps) compared to the reference sequence (which does not contain additions or deletions) in order to achieve optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where the same nucleic acid base appears in the two sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and then multiplying the result by 100 to obtain the percentage of sequence identity. In various embodiments, the substantial identity exists over a sequence region of at least about 25 bases in length, 50 bases in length, 100 bases in length, 125 bases in length, 150 bases in length, and in various embodiments, the sequences are substantially identical over at least about 180 bases. In various embodiments, the sequences are substantially identical over the entire length of the coding region.

[0100] "Expression vector" or "vector" is any genetic element, such as a plasmid, chromosome, virus, transposon, which is either an autonomous unit of intracellular polynucleotide replication (i.e., capable of replication under its own control) or is capable of replication by insertion into a host cell chromosome, to which another polynucleotide fragment is attached, thereby causing replication and / or expression of the attached fragment. Suitable vectors include, but are not limited to, plasmids, transposons, bacteriophages, and cosmids. The vector may contain polynucleotide sequences necessary for connecting or inserting the vector into the desired host cell and for achieving expression of the attached fragment. Such sequences vary from host organism to host organism; they include promoter sequences that achieve transcription, enhancer sequences that increase transcription, ribosome binding site sequences, and transcription and translation termination sequences. Alternatively, the expression vector may be capable of directly expressing the nucleic acid sequence product encoded therein without connecting or integrating the vector into a host cell DNA sequence. In some embodiments, the vector is an episomal expression vector that is capable of replication in a host cell and is present in the host cell as an extrachromosomal fragment of DNA under appropriate selective pressure. The vector may also contain a selectable marker gene. As used herein, the term "selectable marker gene" refers to a nucleic acid sequence that, in the presence of a corresponding selection agent, allows cells expressing the nucleic acid sequence to be specifically selected or targeted.

[0101] As used herein, the term "coding sequence" or "sequence encoding ..." refers to a polynucleotide fragment encoding a protein. This region or sequence is bounded by a start codon near the 5' end and by a stop codon near the 3' end. A coding sequence may also be referred to as an open reading frame. The present invention further relates to a nucleotide construct comprising the above-mentioned nucleic acid operably linked to one or more regulatory elements or regulatory regions. "Regulatory element" or "regulatory region" refers to a portion of a nucleic acid, usually (but not always) located upstream of a gene, and may be composed of DNA or RNA, or composed of DNA and RNA. Regulatory elements may include elements capable of mediating organ specificity or controlling developmental or temporal gene activation. In addition, "regulatory elements" include promoter elements, core promoter elements, elements induced in response to external stimuli, constitutively activated elements, or elements that reduce or increase promoter activity, such as negative regulatory elements or transcription enhancers, respectively. A nucleotide sequence that exhibits regulatory element activity refers to a nucleotide sequence that, when operably linked to a target coding sequence, can act as a promoter, a core promoter, a constitutive regulatory element, a negative element or a silencer (i.e., an element that reduces promoter activity) or a transcription or translation enhancer.

[0102] The present invention further includes vectors containing the above-mentioned nucleic acid. Expression vectors suitable for use with the nucleic acid sequence of the present invention include, but are not limited to, plasmids, phagemids, viral particles and vectors, bacteriophages, etc. For insect cells, baculovirus expression vectors are suitable. The entire expression vector or a portion thereof can be integrated into the host cell genome.

[0103] Those skilled in the art will appreciate that a variety of expression systems can be used to produce proteins or fragments thereof as defined herein. Different host cells have characteristic and specific mechanisms for post-translational processing and modification of proteins and gene products. Those skilled in the art can select appropriate cell lines or host systems to ensure correct modification and processing of the expressed cardiac stem cell proliferation protein.

[0104] The term "operably connected" as used herein refers to the physical and / or functional connection of a DNA fragment to another DNA fragment in a manner that allows the fragment to function in its intended manner. When the DNA sequence encoding a gene product is connected to a regulatory sequence (such as, for example, a promoter, an enhancer and / or a silencer) in a manner that allows the transcription of the DNA sequence to be regulated directly or indirectly, the DNA sequence is operably connected to a regulatory sequence. For example, when a DNA sequence is connected to a promoter downstream relative to the transcription start site of a promoter, in the correct reading frame relative to the transcription start site and when transcription is allowed to be extended by the DNA sequence, the DNA sequence is operably connected to the promoter. When an enhancer or silencer is connected to a DNA sequence in a manner that increases or decreases transcription of a DNA sequence respectively, the enhancer or silencer is operably connected to the DNA sequence encoding a gene product. Enhancers and silencers can be located upstream, downstream or embedded in the coding region of a DNA sequence coding region. If a signal sequence is expressed as a preprotein that participates in the secretion of a polypeptide, the DNA of the signal sequence is operably connected to the DNA encoding a polypeptide. Joining of the DNA sequence to the regulatory sequences is generally accomplished by ligation at appropriate restriction sites using restriction endonucleases known to those skilled in the art or via adapters or linkers inserted into the sequence.

[0105] The terms "induce", "induction" and grammatical equivalents thereof used herein refer to an increase in nucleic acid sequence transcription, promoter activity and / or expression caused by a transcriptional regulator relative to some basal level of the transcription or control system used. The increase in nucleic acid sequence transcription, promoter activity and / or expression can also be achieved by a translational regulator (such as a translation enhancing UTR sequence).

[0106] Regulatory elements used herein also include elements that are active at the start of transcription or after transcription, such as regulatory elements that regulate gene expression, such as translation and transcription enhancers, translation and transcription repressors, and mRNA stability or instability determinants. In the context of the present disclosure, the term "regulatory element" also refers to a DNA sequence that is usually (but not always) located upstream (5') of a structural gene coding sequence, which includes a sequence that controls the expression of a coding region by providing recognition of other factors required for RNA polymerase and / or for starting transcription at a specific site. An example of a regulatory element that provides recognition of RNA polymerase or other transcription factors to ensure that the start of a specific site is a promoter element. The promoter element includes a core promoter element responsible for transcription initiation, and other regulatory elements that modify gene expression. It should be understood that the nucleotide sequence located in an intron or at the 3' place of a coding region sequence may also contribute to regulating the expression of a target coding region. Regulatory elements may also include an element located downstream (3') of a transcription start site, or an element located in a transcription region, or both. In the context of the present invention, post-transcriptional regulatory elements may include elements that are active after transcription has been initiated, such as translational and transcriptional enhancers, translational and transcriptional repressors, and mRNA stability determinants.

[0107] A regulatory element or a fragment thereof can be operably associated (operably linked) with a heterologous regulatory element or promoter to modulate the activity of the heterologous regulatory element. Such modulation includes enhancing or inhibiting the transcriptional activity of a heterologous regulatory element, modulating a post-transcriptional event, or enhancing / inhibiting the transcriptional activity of a heterologous regulatory element and modulating a post-transcriptional event. For example, one or more regulatory elements or fragments thereof can be operably associated with a constitutive, inducible, tissue-specific promoter or fragment thereof, or a fragment of a regulatory element (such as, but not limited to, a TATA or GC sequence) can be operably associated with a regulatory element of the present invention to modulate the activity of such a promoter in a plant, insect, fungus, bacteria, yeast, or animal cell.

[0108] There are many types of regulatory elements, including developmentally regulated, inducible, and constitutive regulatory elements. Developmentally regulated regulatory elements, or those that control the differential expression of genes they control, are activated in certain organs or tissues at specific times during the development of that organ or tissue. However, some developmentally regulated regulatory elements may be preferentially active in certain organs or tissues at specific developmental stages, they may also be active in a developmentally regulated manner, or at basal levels in other organs or tissues within the plant.

[0109] The term "promoter" refers to a polynucleotide region that initiates transcription of a coding sequence. The promoter is located near the gene transcription start site, on the same chain and upstream of the DNA (towards the 5' region of the sense strand). Some promoters are constitutive because they are active in all cases in the cell, while other promoters are regulated and become active in response to specific stimuli, such as inducible promoters. The term "promoter activity" used herein and its grammatical equivalents refer to the expression level of the nucleotide sequence operably connected to the promoter being measured for activity. Promoter activity can be measured directly by determining the amount of the RNA transcript produced, such as by Northern blot analysis, or indirectly by determining the amount of the product encoded by the nucleic acid sequence connected (such as a reporter nucleic acid sequence connected to the promoter). Some non-limiting examples are CMV, EF1a, CAG, PGK, TRE, U6 and UAS.

[0110] "Promoter" refers to a nucleotide sequence at the 5' end of a coding region or a fragment thereof that contains all the signals necessary to initiate transcription and regulate the transcription rate. Promoters are generally of two types: inducible promoters and constitutive promoters.

[0111] Constitutive promoters direct gene expression in various parts of an organism and / or continue to be expressed throughout the development of an organism.Any suitable constitutive promoter can be used to drive expression of a protein or fragment thereof described herein.

[0112] As used herein, the term "constitutive" does not necessarily indicate that a gene is expressed at the same level in all cell types, but rather indicates that the gene is expressed in a wide range of cell types, although some variation in abundance is typically observed.

[0113] "Inducible promoter" used herein refers to a promoter that is induced to produce activity by the presence or absence of a transcriptional regulator (e.g., biological or abiotic factor). Inducible promoters are useful because the expression of a gene operably connected thereto can be opened or closed using an inducer at certain stages of organism development or in a specific tissue. Inducible promoters are promoters that can directly or indirectly activate one or more DNA sequences or gene transcription in response to an inducer. In the absence of an inducer, a DNA sequence or gene will not be transcribed. Typically, a protein factor that specifically binds to an inducible promoter to activate transcription exists in an inactive form and is then directly or indirectly converted into an active form by an inducer. An inducer can be a chemical agent, such as a protein, a metabolite, a growth regulator, or a physiological stress directly applied by heat, cold or toxic elements, or a physiological stress indirectly applied by the effect of a pathogen or disease factor (such as a virus). Non-limiting examples of inducible promoters include alcohol-regulated promoters, tetracycline-regulated promoters, steroid-regulated promoters, metal-regulated promoters, pathogenesis-regulated promoters, temperature-regulated promoters, and light-regulated promoters, isopropyl-β-thiogalactoside (IPTG)-inducible promoters.

[0114] The nucleic acids and other constructs of the present invention may further comprise a 3' untranslated region. The 3' untranslated region refers to the portion of the gene that contains a DNA segment containing a polyadenylation signal and any other regulatory signals that can affect mRNA processing or gene expression. The polyadenylation signal is usually characterized by the addition of a polyadenylic acid track at the 3 major end of the mRNA precursor. For example, the SV-40 polyadenylation site.

[0115] As required, gene construct of the present invention can also include further enhancers, whether translation enhancers or transcription enhancers. These enhancer regions are well known to those skilled in the art, and can include ATG start codons and adjacent sequences. The start codon must be consistent with the reading frame of the coding sequence to ensure the translation of the entire sequence. Translation control signals and start codons can come from a variety of sources, including natural origin and synthetic origin. The translation initiation region can be provided by the source of the transcription initiation region, or can be provided by a structural gene. The sequence can also be derived from the regulatory elements selected to express genes, and the sequence can be specifically modified to increase the translation of mRNA.

[0116] The term "transcriptional regulator" or "cis-acting regulatory element" refers to a biochemical element (such as a repressor or nuclear inhibitory protein) that acts to prevent or inhibit transcription of a promoter-driven DNA sequence under certain environmental conditions, or a biochemical element (such as an inducer or enhancer) that acts to allow or stimulate transcription of a promoter-driven DNA sequence under certain environmental conditions.

[0117] As used herein, the term "enhancer" or "translation enhancer" refers to a DNA sequence that increases, for example, the transcription of a nucleic acid sequence that is operably linked thereto. The enhancer can be located several thousand bases from the coding region of the nucleic acid sequence and can mediate the binding of regulatory factors, changes in DNA methylation patterns, or DNA structure. A large number of enhancers from various sources are known in the art, and they can be obtained as cloned polynucleotides or in cloned polynucleotides (e.g., from depositories such as ATCC and other commercial or personal sources). Many polynucleotides comprising promoters (such as the commonly used CMV promoter) also contain enhancer sequences. The enhancer can be located upstream, internal, or downstream of the coding sequence.

[0118] As used herein, "patient" or "subject" refers to a mammalian subject diagnosed with or suspected of having or developing a medical condition, cellular defect, or disease or disorder (e.g., a proliferative disorder, such as cancer). In some embodiments, the term "patient" refers to a mammalian subject who has a higher than average likelihood of developing a proliferative disorder (such as cancer).

[0119] A "patient in need" or "subject in need" herein refers to a patient diagnosed with or suspected of having a cellular defect, medical condition, disease, or disorder, such as, but not limited to, a proliferative disorder such as cancer. In some cases, the cancer is a solid tumor or a hematological malignancy. In some cases, the cancer is a solid tumor. In other cases, the cancer is a hematological malignancy. In some cases, the cancer is a metastatic cancer. In some cases, the cancer is a recurrent cancer or a refractory cancer. In some cases, the cancer is a solid tumor. Exemplary solid tumors include, but are not limited to, anal cancer; appendix cancer; bile duct cancer (i.e., cholangiocarcinoma); bladder cancer; brain tumor; breast cancer; cervical cancer; colon cancer; cancer of unknown primary (CUP); esophageal cancer; eye cancer; fallopian tube cancer; gastrointestinal cancer; kidney cancer; liver cancer; lung cancer; medulloblastoma; melanoma; oral cancer; ovarian cancer; pancreatic cancer; parathyroid disease; penile cancer; pituitary tumor; prostate cancer; rectal cancer; skin cancer; stomach cancer; testicular cancer; laryngeal cancer; thyroid cancer; uterine cancer; vaginal cancer or vulvar cancer. In some embodiments, the leukemia can be, for example, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL) and chronic myeloid leukemia (CML).

[0120] "Administration" herein refers to providing one or more compositions described herein to a patient or subject. By way of example and not limitation, administration of the composition (e.g., injection) can be performed by intravenous (iv) injection, subcutaneous (sc) injection, intradermal (id) injection, intraperitoneal (ip) injection, or intramuscular (im) injection. One or more such routes can be used. Parenteral administration can be, for example, by push injection or by gradual infusion over time. Alternatively or simultaneously, administration can be performed by oral route. In addition, administration can also be performed by surgical deposition of cell clusters or cell particles, or positioning of medical devices. In one embodiment, the composition of the present disclosure can include engineered cells or host cells expressing nucleic acid sequences described herein, or a vector comprising at least one nucleic acid sequence described herein, in an amount that can effectively treat or prevent proliferative disorders. The pharmaceutical composition can include a target cell population as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include a buffer, such as neutral buffered saline, phosphate buffered saline, etc.; a sugar, such as glucose, mannose, sucrose or dextran, mannitol; a protein; a polypeptide or an amino acid, such as glycine; an antioxidant; a chelating agent, such as EDTA or glutathione; an adjuvant (e.g., aluminum hydroxide); and a preservative.

[0121] The terms "treatment", "treating", "improvement" or their grammatical equivalents as used herein refer to obtaining a desired pharmacological and / or physiological effect. In various embodiments, the effect is therapeutic, i.e., the effect partially or completely cures the disease and / or the adverse symptoms caused by the disease.

[0122] Implementation

[0123] Do not wish to be constrained by theory or experimental results, the following paragraphs only describe the nature of the present invention by example. The specific examples of described experiments or materials, promoters, enhancers, regulatory elements, carriers, cell lines and constructs should not be construed as limiting the scope of the present invention. Those skilled in the art will easily understand and recognize that other materials, promoters, enhancers, regulatory elements, carriers, cell lines and constructs that are not specifically described also constitute a part of the present invention.

[0124] The present invention relates to nucleic acid sequences; vectors, compositions, kits and cells comprising the nucleic acid sequences, and methods for increasing the translation of target proteins.

[0125] Transgenes have been used to deliver therapeutic payloads to improve the efficacy of gene therapy, oncolytic viral immunotherapy, and viral vector vaccine platforms. Transgenes encoded in replication-competent viral therapies are intended to be highly transcribed, but protein synthesis is often negatively affected by viral infection, compromising the amount of therapeutic protein delivered and the efficacy of the corresponding therapy. Translation of standard transgenic mRNA in infected cells is suboptimal. The present invention provides a method for identifying viral translation enhancing 5' leader sequences that promote mRNA translation.

[0126] Recent studies have shown that various translation enhancer motifs found in the leader sequences of viral mRNAs, including the non-templated poly(A) leader in poxviruses or the ICP27 interaction motif in the HSV1 mRNA leader sequence, can promote nuclear export. Viral internal ribosome entry sites (IRES), such as those based on encephalomyocarditis virus (EMCV), have also been used in recombinant gene expression to enhance translation of downstream genes or open reading frames (ORFs). However, the addition of translation enhancers has not been reported for clinically relevant oncolytic viruses (OVs), including oncolytic poxviruses and HSV1. For example, the T-VEC GM-CSF expression cassette does not contain a functionally authentic viral 5' leader sequence, but a residual cloned sequence of approximately 100 bp from the MCS of plasmid pcDNA3 was used during the cloning process.

[0127] Using RNA-seq reads, the transcription start site and 5' leader sequence of the herpes simplex virus-1 (HSV1) gene from pre-infected cells were determined. An HSV1 5' leader sequence was discovered that mediated high translation efficiency of downstream cistron mRNA and exhibited excellent activity during viral replication. The 5' leader sequence was inserted into the GM-CSF expression cassette in oncolytic HSV1, and the translationally adapted oncolytic virus was compared with a conventional leader-less virus in vitro and in a mouse model. The oncolytic virus was equipped with a transgene encoding a critical therapeutic payload, however, the inventors determined that the addition of the viral 5' leader sequence to the transgenic mRNA enhanced translation and increased payload expression in infected cells, ultimately resulting in improved virus-mediated anti-tumor efficacy.

[0128] Using heterologous reporter genes to screen for identified translation activity leader sequences, the 5' leader sequence of the late viral gene US11 was identified. Therefore, it is assumed that the synthesis of therapeutic payloads from the replication oncolytic platform can be enhanced by incorporating viral nucleic acid sequences (possibly 5' leader sequences or UTR sequences). Therefore, RNA-seq data of the HSV1 viral genome was performed to identify sequences that can enhance protein expression. Cancer cells infected with HSV were isolated and RNA-seq data were obtained to identify HSV1 sequences or 5' leader sequences that mediate high translation efficiency of downstream cistrons during viral replication. It was observed that the US11 5' leader sequence (i.e., SEQ ID NO: 1) from the HSV1 viral genome was located upstream or 5' to downstream of the cistron or gene encoding the target protein in HSV1 infected cells, which can enhance protein expression in the cell by several times. The RNA counterpart of the US115' leader sequence (i.e., the sequence of SEQ ID NO: 4) can also show similar results. It was observed that inclusion of a 5' leader sequence in the expression cassette incorporated into the HSV1 genome enhanced translation of the protein of interest (e.g., GM-CSF) in vitro and in vivo. Importantly, treatment with this translationally enhanced oncolytic HSV1 demonstrated superior antitumor immune activity and improved survival in a syngeneic mouse model of colorectal cancer compared to leaderless-GM-CSF HSV1. This demonstrates the therapeutic value of identifying and binding vector-specific cis-acting sequences that increase protein synthesis expressed by the transgene.

[0129] Therefore, the present invention relates to nucleic acids, vectors, compositions, kits and cell lines comprising SEQ ID NO: 1 or SEQ ID NO: 4, wherein the nucleic acid additionally comprises a gene encoding a protein of interest, and optionally comprises a promoter, a translation enhancer or other regulatory elements. More specifically, transcription of SEQ ID NO: 1 or 4 results in increased translation of the gene encoding the protein of interest, thereby resulting in enhanced protein expression in HSV or HSV1 infected cells.

[0130] US11 5' leader sequence

[0131] Using RNA sequence mapping, the US11 5' leader nucleotide sequence was identified and is as follows: 5'GGCCAGAACCGCCGTGCACGACCCGGAGCGTCCCCTGCTGCGCTC TCCCGGGCTGCTGCCCGAAATCGCCCCCAACGCATCCTTGGGTGTGGCACATCGAAGAACCGGCGGGACCGTGACCGACAGTCCCCGTAATCCGGTAACCCGTTGAGTCCCGGGTACGACCATCACCCGAGTCTCTGGGCGGAGGGTGGTTCCCCCCCGTGTCTCTCGAG 3' (hereinafter referred to as SEQ ID NO: 1)

[0132] The sequence of SEQ ID NO: 1 was cross-referenced with the HSV1 KOS strain using the BLAST database of NCBI and was found to be 100% identical to SEQ ID NO: 1.

[0133] US11 5' leader sequence:

[0134] >gi|384597744|gb|JQ780693.1|:c144480-144266 Human herpesvirus 1 strain KOS, complete genome

[0135] 5'GGCCAGAACCGCCGTGCACGACCCGGAGCGTCCCCTGCTGCGCTC TCCCGGGCTGCTGCCCGAAATCGCCCCCAACGCATCCTTGGGTGTGGCACATCGAAGAACCGGCGGGACCGTGACCGACAGTCCCCGTAATCCGGTAACCCGTTGAGTCCCGGGTACGACCATCACCCGAGTCTCTGGGCGGAGGGTGGTTCCCCCCCGTGTCTCTCGAG3'

[0136] It was also observed that the US11 5' leader sequence is one of the highly conserved sequences across the HSV1 genome of various identified strains. The NCBI BLASTN database also showed that the upstream and downstream sequences of the US11 5' leader sequence are also highly conserved.

[0137] 5'GCCGACGTACGCGATGAGATCAATAAAAGGGGGCGTGAGGACCG GGAGGC3' (the upstream sequence of SEQ ID NO: 1 in the HSV1 viral genome, hereinafter referred to as SEQ ID NO: 2)

[0138] 5'ATGAGCCAGACCCAACCCCCGGCCCCAGTTGGGCCGGGCGACCCA GATGT3' (the downstream sequence of SEQ ID NO: 1 in the HSV1 viral genome, hereinafter referred to as SEQ ID NO: 3)

[0139] As mentioned above, the use of the RNA counterpart of SEQ ID NO: 1 above can achieve the desired effect of increasing protein expression. The RNA counterparts of the US11 5' leader sequence, upstream and downstream sequences are provided below.

[0140] 5'GGCCAGAACCGCCGUGCACGACCCGGAGCGUCCCCUGCUGCGCU CUCCCGGGCUGCCGCCCGAAAUCGCCCCCAACGCAUCCUUGGGUGUGGCACAUCGAAGAACCGGCGGGACCGUGACCGACAGUCCCCGUAAUCCGGUAACCCGUUGAGUCCCGGGUACGACCAUCACCCGAGUCUCUGGGCGGAGGGUGGUUCCCCCCCGUGUCUCUCGAG3'(SEQ ID The RNA counterpart of NO:1, hereafter referred to as SEQ ID NO:4)

[0141] 5'GCCGACGUACGCGAUGAGAUCAAUAAAAGGGGGCGUGAGGACCG GGAGGC3' (the RNA counterpart of SEQ ID NO: 2, i.e., the upstream sequence of SEQ ID NO: 4, hereinafter referred to as SEQ ID NO: 5)

[0142] 5'AUGAGCCAGACCCAACCCCCGGCCCCAGUUGGGCCGGGCGACCCAGAUGU3' (the RNA counterpart of SEQ ID NO: 3, i.e., the downstream sequence of SEQ ID NO: 4, hereinafter referred to as SEQ ID NO: 6)

[0143] UL27 5' leader sequence

[0144] Using RNA sequence mapping, the UL27 5' leader nucleotide sequence was identified and is as follows:

[0145] 5'ACACTCTTTGCCTCGGTCTACCGGTGCGGGGAGCTCGAGTTGCGCCGCCCGGACTGCAGCCGCCCGACCTCCGAAGGTCGTTACCGTTACCCGCCCGGCGTATATCTCACGTACGACTCCGACTGTCCGCTGGTGGCCATCGTCGAG AGCGCCCCCGACGGCTGTATCGGCCCCCGGTCGGTCGTGGTCTACGACCGAGACGTTTTTCTCGATCCTCTACTCGGTCCTCCAGCACCTCGCCCCCAGGCTACCTGACGGGGGGCACGACGGGCCCCCGTAGTCCCGCC3' (hereinafter referred to as SEQ ID NO:7)

[0146] The sequence of SEQ ID NO:7 was cross-referenced with the HSV1 KOS strain using the BLAST database of NCBI and was found to be 100% identical to SEQ ID NO:7.

[0147] UL27 5' leader sequence:

[0148] >gi|384597744|gb|JQ780693.1|:c55744-55459 Human herpesvirus 1 strain KOS, complete genome

[0149] 5'ACACTCTTTGCCTCGGTCTACCGGTGCGGGGAGCTCGAGTTGCGCCGCCCGGACTGCAGCCGCCCGACCTCCGAAGGTCGTTACCGTTACCCGCCCGGCGTATATCTCACGTACGACTCCGACTGTCCGCTGGTGGCCATCGT CGAGAGCCGCCCCCGACGGCTGTATCGGCCCCCGGTCGGTCGTGGTCTACGACCGAGACGTTTTTCTCGATCCTCTACTCGGTCCTCCAGCACCTCGCCCCCAGGCTACCTGACGGGGGGCACGACGGGCCCCCGTAGTCCCGCC3'

[0150] It was also observed that the UL27 5' leader sequence is one of the highly conserved sequences across the HSV1 genome of various identified strains. The NCBI BLASTN database also showed that the upstream and downstream sequences of the UL27 5' leader sequence are also highly conserved.

[0151] 5'CCACTCAGCGCGCCGCCTGGCGATATATTCGCGAGCTGATTATCGCCACC3' (the upstream sequence of SEQ ID NO: 7 in the HSV1 viral genome, hereinafter referred to as SEQ ID NO: 8)

[0152] 5'ATGCACCAGGGCGCCCCCTCGTGGGGGCGCCGGTGGTTCGTCGTA TGGGC3' (the downstream sequence of SEQ ID NO: 7 in the HSV1 viral genome, hereinafter referred to as SEQ ID NO: 9)

[0153] As described above, the desired effect of increasing protein expression can be achieved using the RNA counterpart of the above SEQ ID NO: 7. The RNA counterparts of the UL27 5' leader sequence, upstream sequence, and downstream sequence are provided below.

[0154] 5'ACACUCUUUGCCUCGGUCUACCGGUGCGGGGAGCUCGAGUUGCG CCGCCCGGACUGCAGCCGCCCGACCUCCGAAGGUCGUUACCGUUACCCGCCCGGCGUAUAUCACGUACGACUCCGACUGUCCGCUGGUGGCCAUCGUCGAGAGCGCCCCCGACGGCUGUAUCG GCCCCCGGUCGGUCGUGGUCUACGACCGCGACGUUUUCUCGAUCCUCUACUCGGUCCUCCAGCACCUCGCCCCCAGGCUACCUGACGGGGGGCACGACGGCCCCGUAGUCCCGCC3'(SEQID The RNA counterpart of NO:7, hereafter referred to as SEQ ID NO:10)

[0155] 5'CCACUCAGCGCGCCGCCUGGCGAUAUAUUCGCGAGCUGAUUAUC GCCACC3' (the RNA counterpart of SEQ ID NO: 8, i.e., the upstream sequence of SEQ ID NO: 10, hereinafter referred to as SEQ ID NO: 11)

[0156] 5'AUGCACCAGGGCGCCCCCUCGUGGGGGCGCCGGUGGUUCGUCGU AUGGGC 3' (the RNA counterpart of SEQ ID NO: 9, i.e., the downstream sequence of SEQ ID NO: 10, hereinafter referred to as SEQ ID NO: 12).

[0157] UL19 5' leader sequence

[0158] Using RNA sequence mapping, the UL19 5' leader nucleotide sequence was identified and is as follows: 5'GGTCTGTTGGGGACACTGGGTTCTCCTGGAACGAGGCCGCAGCCTT CTCCCGGTGCCTTTCCCCCCCGACCGACACCCGGCCTCTCACACAGCATCCCCCGCCTTTTTGGGTCCGGGCCCGTCGTGTCTTTCGGTGGACCTTGGGCCGTCGGGCACGTACACGGGTGGCCGGGCGTTGGGGTGGATCTTAGCCTCCCCGGGCCAATATCGCTAGAGACAGCCGATCTCCACGCGACCCC 3' (hereinafter referred to as SEQ ID NO: 13)

[0159] The sequence of SEQ ID NO: 13 was cross-referenced with the HSV1 KOS strain using the BLAST database of NCBI and was found to be 100% identical to SEQ ID NO: 13.

[0160] UL19 5' leader sequence

[0161] >gi|384597744|gb|JQ780693.1|:c40421-40183 Human herpesvirus 1 strain KOS, complete genome

[0162] 5'GGTCTGTTGGGGACACTGGGTTCCTGGAACGAGGCCGCAGCCTTCTCCCGGTGCCTTTCCCCCCCGACCGACACCCGGCCTCTCACACAGCATCCCCCGCTTTTTGGGGTCCGGGCC CGTCGTGTCTTTCGGTGGACCTTGGGCCGTCGGGCACGTACACGGGTGGCCGGGCGTTGGGGTGGATCTTAGCCTCCCCGGGCCAATATCGCTAGAGACAGCCGATCTCCACGCGACCCC3'

[0163] It was also observed that the UL19 5' leader sequence is one of the highly conserved sequences across the HSV1 genome of various identified strains. The NCBI BLASTN database also showed that the upstream and downstream sequences of the UL19 5' leader sequence are also highly conserved.

[0164] 5'ACGGGGGTGGGGCGGGGGGGGTATATAAGGCCTGGGATCCCACGTCCCCG3' (the upstream sequence of SEQ ID NO: 13 in the HSV1 viral genome, hereinafter referred to as SEQ ID NO: 14)

[0165] 5'ATGGCCGCTCCCAACCGCGACCCTCCGGGATACCGGTATGCCGCGGCCAT3' (the downstream sequence of SEQ ID NO: 13 in the HSV1 viral genome, hereinafter referred to as SEQ ID NO: 15)

[0166] As described above, the desired effect of increasing protein expression can be achieved using the RNA counterpart of SEQ ID NO: 13 above. The RNA counterparts of the UL19 5' leader sequence, upstream sequence, and downstream sequence are provided below.

[0167] 5'GGUCUGUUGGGGACACUGGGUUCUCCUGGAACGAGGCCGCAGCCUUCUCCCGGUGCCUUUCCCCCCCGACCGACACCCGGCCUCUCACACAGCAUCCCCGCCUUUUUGGGUCCGGGCCCG UCGUGUCUUUCGGUGGACCUUGGGCCGUCGGGCACGUACACGGGGUGGCCGGGCGUUGGGGUGGAUCUUAGCCCUCCCCGGGCCAAUAUCGCUAGAGACAGCCGAUCUCCACGCGACCCC3'(SEQ The RNA counterpart of ID NO:13, hereafter referred to as SEQ ID NO:16)

[0168] 5'ACGGGGGUGGGGCGGGGGGGGUAUAUAAGGCCUGGGAUCCCACG UCCCCG3' (the RNA counterpart of SEQ ID NO: 14, i.e., the upstream sequence of SEQ ID NO: 13, hereinafter referred to as SEQ ID NO: 17)

[0169] 5'AUGGCCGCUCCCAACCGCGACCCUCCGGGAUACCGGUAUGCCGC GGCCAU3' (the RNA counterpart of SEQ ID NO: 15, i.e., the downstream sequence of SEQ ID NO: 13, hereinafter referred to as SEQ ID NO: 18).

[0170] Representative nucleic acid sequences of the present invention are as follows Figure 1a , Figure 1b and Figure 1cThose skilled in the art will appreciate that the sequences listed above are only representative and should not be construed as limiting the scope of the present invention.

[0171] The following description and examples describe the embodiments of the present disclosure in detail. It should be understood that the present disclosure is not limited to the specific embodiments described herein and may therefore vary. Those skilled in the art will recognize that there are many variations and modifications to the present disclosure, which are all within the scope thereof.

[0172] The experimental results and data provided in this application indicate that the HSV1 US11 5' leader sequence fused upstream of a therapeutic payload encoded within HSV1 can be used to greatly enhance transgenic protein expression and improve the therapeutic efficacy of the virus. Similar results are expected from the US11 5' leader sequence of HSV or other HSV variants.

[0173] In view of the result proposed in the present application, US11 5' leader sequence (i.e. SEQ ID NO: 1 or 4) can be used and inserted in nucleic acid, vector, gene delivery medium, recombinant DNA or RNA construct, cell line or a composition or kit comprising any of these to enhance the expression of any target protein. For example, a vector or plasmid can be constructed, wherein the sequence of SEQ ID NO: 1 or 4 can be located upstream of the gene / cistron encoding the target protein (such as being able to improve or treat any medical condition, cell defect, disease or illness, or being able to provide any therapeutic effect protein). In addition, the construct comprising SEQ ID NO: 1 or 4 can be used in vivo or in vitro with a variety of cell lines as needed. Therefore, the inventors have proposed the following embodiments.

[0174] Nucleic Acids

[0175] The present invention relates to a nucleic acid comprising SEQ ID NO:1 or a fragment thereof containing at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:1, wherein the nucleic acid does not comprise SEQ ID NO:2, SEQ ID NO:3 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:2, 3 or both, and the fragment of SEQ ID NO:2, 3 or both is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases thereof immediately consecutive to the 5' or 3' end of SEQ ID NO:1.

[0176] In some embodiments, the present invention relates to a nucleic acid comprising SEQ ID NO:4 or a fragment thereof containing at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:4, wherein the nucleic acid does not comprise SEQ ID NO:5, SEQ ID NO:6 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:5, 6 or both, and the fragment of SEQ ID NO:5, 6 or both is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases thereof immediately consecutive to the 5' or 3' end of SEQ ID NO:4.

[0177] In some embodiments, the present invention relates to a nucleic acid comprising SEQ ID NO:7 or a fragment thereof containing at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:7, wherein the nucleic acid does not comprise SEQ ID NO:8, SEQ ID NO:9 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:8, 9 or both, and the fragment of SEQ ID NO:8, 9 or both is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases thereof immediately consecutive to the 5' or 3' end of SEQ ID NO:7.

[0178] In some embodiments, the present invention relates to a nucleic acid comprising SEQ ID NO:10 or a fragment thereof containing at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:16, wherein the nucleic acid does not comprise SEQ ID NO:11, SEQ ID NO:12 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:11, 12 or both, and the fragment of SEQ ID NO:11, 12 or both is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases thereof immediately consecutive to the 5' or 3' end of SEQ ID NO:10.

[0179] In some embodiments, the present invention relates to a nucleic acid comprising SEQ ID NO: 13 or a fragment thereof containing at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 13, wherein the nucleic acid does not comprise SEQ ID NO: 14, SEQ ID NO: 15 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO: 14, 15 or both, and the fragment of SEQ ID NO: 14, 15 or both is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases thereof immediately consecutive to the 5' or 3' end of SEQ ID NO: 13.

[0180] In some embodiments, the present invention relates to a nucleic acid comprising SEQ ID NO: 16 or a fragment thereof containing at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 16, wherein the nucleic acid does not comprise SEQ ID NO: 17, SEQ ID NO: 18 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO: 17, 18 or both, and the fragment of SEQ ID NO: 17, 18 or both is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases thereof immediately consecutive to the 5' or 3' end of SEQ ID NO: 16.

[0181] In an alternative embodiment, a nucleic acid is provided, which comprises SEQ ID NO: 1 or a sequence that is at least 90% identical to the entire length of SEQ ID NO: 1, wherein the nucleotide sequence does not comprise SEQ ID NO: 2, SEQ ID NO: 3, or both. In addition, the nucleic acid does not comprise a fragment of SEQ ID NO: 2, 3, or both, which is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases that are immediately consecutive to 5' or 3' of SEQ ID NO: 1.

[0182] In an alternative embodiment, a nucleic acid is provided, which comprises SEQ ID NO: 4 or a sequence that is at least 90% identical to the entire length of SEQ ID NO: 4, wherein the nucleotide sequence does not comprise SEQ ID NO: 5, SEQ ID NO: 6, or both. In addition, the nucleic acid does not comprise a fragment of SEQ ID NO: 5, 6, or both, which is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases that are immediately consecutive to 5' or 3' of SEQ ID NO: 4.

[0183] In an alternative embodiment, a nucleic acid is provided, which comprises SEQ ID NO: 7 or a sequence that is at least 90% identical to the entire length of SEQ ID NO: 7, wherein the nucleotide sequence does not comprise SEQ ID NO: 8, SEQ ID NO: 9, or both. In addition, the nucleic acid does not comprise a fragment of SEQ ID NO: 8, 9, or both, which is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases that are immediately consecutive to 5' or 3' of SEQ ID NO: 7.

[0184] In an alternative embodiment, a nucleic acid is provided, which comprises SEQ ID NO: 10 or a sequence that is at least 90% identical to the entire length of SEQ ID NO: 10, wherein the nucleotide sequence does not comprise SEQ ID NO: 11, SEQ ID NO: 12, or both. In addition, the nucleic acid does not comprise a fragment of SEQ ID NO: 11, 12, or both, which is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases that are immediately consecutive to 5' or 3' of SEQ ID NO: 10.

[0185] In an alternative embodiment, a nucleic acid is provided, which comprises SEQ ID NO: 13 or a sequence that is at least 90% identical to the entire length of SEQ ID NO: 13, wherein the nucleotide sequence does not comprise SEQ ID NO: 14, SEQ ID NO: 15, or both. In addition, the nucleic acid does not comprise a fragment of SEQ ID NO: 14, 15, or both, which is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases that are immediately consecutive to 5' or 3' of SEQ ID NO: 13.

[0186] In an alternative embodiment, a nucleic acid is provided, which comprises SEQ ID NO: 16 or a sequence that is at least 90% identical to the entire length of SEQ ID NO: 16, wherein the nucleotide sequence does not comprise SEQ ID NO: 17, SEQ ID NO: 18, or both. In addition, the nucleic acid does not comprise a fragment of SEQ ID NO: 17, 18, or both, which is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases that are immediately consecutive to 5' or 3' of SEQ ID NO: 16.

[0187] As discussed above, the US11 gene sequence is highly conserved, and therefore, when isolated from the HSV1 viral genome, the nucleic acid identified by the inventors is able to exhibit the desired effect, namely, a several-fold increase in protein expression compared to protein expression in the absence of the US11 5' leader sequence. The nucleotide sequence flanking SEQ ID NO:1 is also highly conserved, and therefore, the above embodiment explicitly denies sequences existing in nature, namely 5'SEQ ID NO:2-SEQ ID NO:1-SEQID NO:3 3', and only uses SEQ ID NO:1 or a fragment or sequence with 90% identity to SEQ ID NO:1. The nucleic acid does not contain the sequence of SEQ ID NO:2 or 3 or any fragment of SEQ ID NO:2 or 3. Therefore, the nucleic acid comprising SEQID NO:1 can be engineered to insert a gene encoding a target protein and other regulatory elements for increasing protein expression. Notably, protein production is increased during HSV1 infection.

[0188] As discussed above, the UL27 gene sequence is highly conserved, and therefore, when isolated from the HSV1 viral genome, the nucleic acid identified by the inventors is able to exhibit the desired effect, namely, a several-fold increase in protein expression compared to protein expression in the absence of the UL27 5' leader sequence. The nucleotide sequence flanking SEQ ID NO:7 is also highly conserved, and therefore, the above embodiment explicitly denies sequences existing in nature, namely 5'SEQ ID NO:8-SEQ ID NO:7-SEQID NO:9 3', and only uses SEQ ID NO:7 or a fragment or sequence with 90% identity to SEQ ID NO:7. The nucleic acid does not contain the sequence of SEQ ID NO:8 or 9 or any fragment of SEQ ID NO:8 or 9. Therefore, the nucleic acid comprising SEQID NO:7 can be engineered to insert a gene encoding a protein of interest and other regulatory elements for increasing protein expression. Notably, protein production is increased during HSV1 infection.

[0189] As discussed above, the UL19 gene sequence is highly conserved, and therefore, when isolated from the HSV1 viral genome, the nucleic acid identified by the inventors is able to exhibit the desired effect, namely, a several-fold increase in protein expression compared to protein expression in the absence of the UL19 5' leader sequence. The nucleotide sequence flanking SEQ ID NO:13 is also highly conserved, and therefore, the above embodiment explicitly denies sequences existing in nature, namely 5'SEQ ID NO:14-SEQ ID NO:13-SEQID NO:15 3', and only uses SEQ ID NO:13 or a fragment or sequence with 90% identity to SEQ ID NO:13. The nucleic acid does not contain the sequence of SEQ ID NO:14 or 15 or any fragment of SEQ ID NO:14 or 15. Therefore, the nucleic acid comprising SEQ ID NO:13 can be engineered to insert a gene encoding a protein of interest and other regulatory elements for increasing protein expression. Notably, protein production is increased during HSV1 infection.

[0190] Although the HSV1 virus is a dsDNA, the increase in protein expression occurs due to increased ribosome recruitment during translation, resulting in enhanced translation of mRNA transcripts, and therefore, the RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4), the RNS counterpart of SEQ ID NO: 7 (i.e., SEQ ID NO: 10), or the RNA counterpart of SEQ ID NO: 13 (i.e., SEQ ID NO: 16) can also provide this desired effect. Therefore, in an alternative embodiment, a nucleic acid is provided, which comprises SEQ ID NO: 4 (i.e., the RNA counterpart of SEQ ID NO: 1) or a fragment containing at least 180 nucleotides or a sequence that is at least 90% identical to SEQ ID NO: 4, wherein the nucleic acid does not comprise SEQ ID NO: 5 (i.e., the RNA counterpart of SEQ ID NO: 2), SEQ ID NO: 6 (i.e., the RNA counterpart of SEQ ID NO: 3), or both. Similarly, in an alternative embodiment, a nucleic acid is provided, comprising SEQ ID NO: 10 (i.e., the RNA counterpart of SEQ ID NO: 7), or a fragment containing at least 180 nucleotides or a sequence at least 90% identical to SEQ ID NO: 10, wherein the nucleic acid does not comprise SEQ ID NO: 11 (i.e., the RNA counterpart of SEQ ID NO: 8), SEQ ID NO: 12 (i.e., the RNA counterpart of SEQ ID NO: 9), or both. Similarly, in an alternative embodiment, a nucleic acid is provided, comprising SEQ ID NO: 16 (i.e., the RNA counterpart of SEQ ID NO: 13), or a fragment containing at least 180 nucleotides or a sequence at least 90% identical to SEQ ID NO: 13, wherein the nucleic acid does not comprise SEQ ID NO: 17 (i.e., the RNA counterpart of SEQ ID NO: 14), SEQ ID NO: 18 (i.e., the RNA counterpart of SEQ ID NO: 15), or both.

[0191] In an alternative embodiment, a sequence at least 90% identical to SEQ ID NO: 4 or a fragment comprising at least 180 nucleotides is provided, wherein the nucleic acid does not comprise SEQ ID NO: 5, SEQ ID NO: 6 or both. The nucleic acid does not comprise a fragment of SEQ ID NO: 5, 6 or both, which is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases immediately contiguous to the 5' or 3' end of SEQ ID NO: 4. Therefore, RNA nucleic acids or RNA counterparts of the nucleic acids defined above are also contemplated.

[0192] In one embodiment of the invention, the nucleic acid does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases of SEQ ID NO: 2 that is immediately consecutive to 5' of SEQ ID NO: 1; or wherein the nucleotide sequence does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases of SEQ ID NO: 3 that is immediately consecutive to 3' of SEQ ID NO: 1. An alternative embodiment is also contemplated, comprising RNA counterparts of SEQ ID NO: 1, 2 and 3 (i.e., SEQ ID NO: 4, 5 and 6).

[0193] In an alternative embodiment, the nucleic acid does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO: 2 that is immediately 5' to SEQ ID NO: 1; and wherein the nucleotide sequence does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO: 3 that is immediately 3' to SEQ ID NO: 1. An alternative embodiment is also contemplated, comprising RNA counterparts of SEQ ID NO: 1, 2, and 3 (i.e., SEQ ID NO: 4, 5, and 6).

[0194] In an alternative embodiment, the nucleic acid does not comprise the entire length of SEQ ID NO: 2 or the entire length of SEQ ID NO: 3 immediately 5' or 3' to SEQ ID NO: 1. An alternative embodiment comprising RNA counterparts of SEQ ID NOs: 1, 2 and 3 (i.e., SEQ ID NOs: 4, 5 and 6) is also contemplated.

[0195] Alternative embodiments having SEQ ID NO:7, 13 or their RNA counterparts (i.e., SEQ ID NO:10 or 16) are also contemplated. In each embodiment having SEQ ID NO:7, the nucleic acid does not comprise SEQ ID NO:8, 9, or both. In each embodiment having SEQ ID NO:10, the nucleic acid does not comprise SEQ ID NO:11, 12, or both. In each embodiment having SEQ ID NO:13, the nucleic acid does not comprise SEQ ID NO:14, 15, or both. In each embodiment having SEQ ID NO:16, the nucleic acid does not comprise SEQ ID NO:17, 18, or both.

[0196] In one embodiment of the invention, the nucleotide sequence or nucleic acid does not comprise at least 250, 500, 1000 or more consecutive nucleotides of human herpesvirus 1 strain KOS or a sequence that is 95% identical thereto, the complete genome of the strain being defined by NCBI Accession No.: JQ673480.1GI:380776962 or Accession No. JQ780693.1GI:384597744.

[0197] In one embodiment of the invention, a second nucleic acid consisting of the nucleic acid of claim 1 is also contemplated. In an alternative embodiment, the nucleic acid may be a synthetic or recombinant nucleic acid comprising the sequence of SEQ ID NO: 1. The nucleic acid may also be in the form of an expression vector or plasmid, wherein the expression vector or plasmid is heterologous to HSV1 and drives the production of the protein of interest.

[0198] In some embodiments, the nucleic acid additionally comprises a promoter, a nucleotide sequence encoding a target protein, one or more regulatory sequences, one or more restriction endonucleases or cloning sites, one or more polyadenylation sites, or a combination thereof, wherein at least one or more of the promoter, the nucleotide sequence encoding the target protein, one or more restriction endonucleases or cloning sites, one or more polyadenylation sites, or a combination thereof is heterologous to HSV1.

[0199] Some non-limiting examples of promoters that can be fused to SEQ ID NO: 1, 4, 7, 10, 13 or 16 include: CMV, EF1a, CAG, PGK, TRE, U6 and UAS. Some non-limiting examples of target proteins include that the nucleotide sequence encoding the target protein can be selected from GM-CSF, TNF-a, p53, GFP, chloramphenicol acetyltransferase (CAT), SMN protein, lipoprotein lipase, Tat protein, Ebola glycoprotein, SARS-CoV-2 spike (S) protein, cytokine, ovalbumin, retinoic acid isomerase RPE65, insulin, SIV Env and Nef antigens or Gag, Env and Tat-Rev-Nef fusion proteins, viral antigens, cyclin G1, immunogenic proteins, immunomodulatory proteins or cell regulatory proteins. The target protein can be a reporter protein, a cell regulatory protein or a cytotoxic protein.

[0200] The one or more regulatory sequences may be selected from any known promoter, enhancer, silencer, transcription factor, coactivator or operator. The one or more restriction enzymes or cloning sites are palindromic sequences that can be recognized by restriction enzymes. The one or more polyadenylation sites may be a stretch of adenine bases or an SV40 site or any other site known in the art.

[0201] In the above embodiments, the promoter is located upstream or 5' of the sequence SEQ ID NO: 1, and the nucleotide sequence encoding the target protein is located downstream or 3' of the sequence SEQ ID NO: 1. In some embodiments, the promoter is located immediately upstream of the sequence SEQ ID NO: 1 or its RNA counterpart, and the nucleotide sequence encoding the target protein is located immediately downstream of the sequence SEQ ID NO: 1 or its RNA counterpart.

[0202] In some embodiments, the nucleic acid may be linear, while in alternative embodiments, the nucleic acid may be circular. The nucleic acid of any of the above embodiments is capable of increasing translation of a nucleotide sequence encoding a protein of interest compared to translation in the absence of SEQ ID NO: 1 or 4.

[0203] In one embodiment of the present invention, a nucleic acid is provided, which consists of the nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:4. In an alternative embodiment, the nucleic acid may comprise the sequence of SEQ ID NO:1, wherein the sequence of SEQ ID NO:1 is isolated from the genome of HSV1. The nucleic acid described hereinabove, wherein the nucleic acid does not comprise the sequence of the UL9 gene downstream or 3' of SEQ ID NO:1 as found in the natural HSV1 genome, or does not comprise the sequence of the UL12 gene upstream or 5' of SEQ ID NO:1. Additionally, the sequence SEQ ID NO:1 claimed in the present invention does not comprise a sequence complementary to the US10 gene sequence immediately downstream or 3' of SEQ ID NO:1. Alternative embodiments are also contemplated, which cover the mRNA counterpart of SEQ ID NO:1 (i.e., SEQ ID NO:4).

[0204] In other embodiments, the nucleic acid sequence does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO: 2 that is immediately 5' to SEQ ID NO: 1; or wherein the nucleotide sequence does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO: 3 that is immediately 3' to SEQ ID NO: 1. An alternative embodiment is also contemplated, which encompasses the counterpart sequences, i.e., SEQ ID NOs: 4, 5, and 6.

[0205] In an alternative embodiment, the nucleic acid nucleotide sequence does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO: 2 that is immediately continuous with the 5' end of SEQ ID NO: 1; and the nucleotide sequence does not further include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO: 3 that is immediately continuous with the 3' end of SEQ ID NO: 1. An alternative embodiment is also contemplated, which encompasses the corresponding sequences, i.e., SEQ ID NOs: 4, 5, and 6.

[0206] In some embodiments, the nucleic acid does not comprise SEQ ID NO: 2 immediately 5' or 3' to SEQ ID NO: 1, or wherein the nucleic acid does not comprise SEQ ID NO: 2 immediately 5' to SEQ ID NO: 1. In alternative embodiments, the nucleic acid does not comprise SEQ ID NO: 3 immediately 5' or 3' to SEQ ID NO: 1, or wherein the nucleic acid does not comprise SEQ ID NO: 3 immediately 3' to SEQ ID NO: 1. An alternative embodiment is also contemplated, which encompasses the counterpart sequences, i.e., SEQ ID NOs: 4, 5, and 6.

[0207] In one embodiment of the present invention, a synthetic / recombinant nucleic acid is provided, comprising the nucleic acid of SEQ ID NO: 1 or SEQ ID NO: 4 (for mRNA embodiments). The nucleic acid does not comprise a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO:2 that is immediately consecutive to the 5' of SEQ ID NO:1; or does not comprise a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO:5 that is immediately consecutive to the 5' of SEQ ID NO:4; or wherein the nucleotide sequence does not comprise a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO:3 that is immediately consecutive to the 3' of SEQ ID NO:1, or wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:4 that is immediately consecutive to the 3' of SEQ ID A fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases of NO:6.

[0208] In one embodiment of the present invention, a synthetic / recombinant nucleic acid is provided, comprising the nucleic acid of SEQ ID NO: 1 or SEQ ID NO: 4 (for mRNA embodiments). The nucleic acid does not comprise a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO: 2 that is immediately consecutive to the 5' of SEQ ID NO: 1; and wherein the nucleotide sequence does not comprise a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO: 3 that is immediately consecutive to the 3' of SEQ ID NO: 1; or wherein the nucleotide sequence does not comprise a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO: 5 that is immediately consecutive to the 5' of SEQ ID NO: 4; and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO: 5 that is immediately consecutive to the 3' of SEQ ID NO: 4. A fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases of NO:6.

[0209] In any of the above embodiments, the nucleic acid may further comprise a promoter or a gene encoding a target protein or both. The promoter may be located upstream or 5' of the sequence SEQ ID NO: 1 or SEQ ID NO: 4. The gene encoding the target protein is located downstream or 3' of the sequence SEQ ID NO: 1 or SEQ ID NO: 4. In alternative embodiments, the promoter may be located 5' of the sequence SEQ ID NO: 1 or SEQ ID NO: 4, and the gene encoding the target protein is located 3' of the sequence SEQ ID NO: 1 or SEQ ID NO: 4. In some embodiments, the promoter is located immediately upstream of the sequence SEQ ID NO: 1 or its RNA counterpart, and the nucleotide sequence encoding the target protein is located immediately downstream of the sequence SEQ ID NO: 1 or its RNA counterpart.

[0210] In some embodiments, the nucleic acid can be single-stranded RNA, single-stranded DNA, double-stranded RNA or double-stranded DNA. The nucleic acid comprising the sequence SEQ ID NO: 1 is transcribed into mRNA having an RNA sequence corresponding to SEQ ID NO: 1 (ie, the sequence of SEQ ID NO: 4).

[0211] In some embodiments, the nucleic acid described in the present application may be in the form of a concatemer, that is, the nucleic acid may contain multiple repeating units of SEQ ID NO: 1, or wherein SEQ ID NO: 1 is repeated at least twice or more.

[0212] The nucleic acids described above are capable of enhancing translation and thus can act as translation enhancers. More specifically, when located downstream or 3' of SEQ ID NO: 1, the transcription of SEQ ID NO: 1 contained in the nucleic acid increases the translation of the gene encoding the protein of interest, compared to the translation in the absence of SEQ ID NO: 1. Similar embodiments containing the RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4) are also feasible.

[0213] In some embodiments, the nucleic acid is a transgenic or wherein the nucleic acid is inserted into a gene delivery vehicle. Some non-limiting examples of gene delivery vehicles include plasmids, vectors, recombinant DNA or RNA constructs, or expression cassettes or nanoparticles (which may be lipid nanoparticles).

[0214] In one embodiment of the invention, the nucleic acid comprises additional components. For example, the nucleic acid may comprise the sequence of SEQ ID NO: 1; and a restriction endonuclease site for a gene encoding a target protein. In an alternative embodiment, the nucleic acid comprises the sequence of SEQ ID NO: 1; a restriction endonuclease site for a gene encoding a target protein; and a restriction endonuclease site for a promoter, a regulatory element, or both. The restriction endonuclease site for the gene encoding the target protein may be located downstream or 3' of SEQ ID NO: 1. The restriction endonuclease site for a promoter or a regulatory element is located upstream or 5' of SEQ ID NO: 1. In an alternative embodiment, the restriction endonuclease site for the gene encoding the target protein is located at a position immediately continuous with the 3' of SEQ ID NO: 1, and the restriction endonuclease site for a promoter or a regulatory element is located at a position immediately continuous with the 5' of SEQ ID NO: 1. Transcription of the SEQ ID NO: 1 sequence increases the translation of the gene encoding the target protein compared to the translation in the absence of SEQ ID NO: 1. More specifically, translation of the sequence encoding the protein of interest in the presence of SEQ ID NO: 1 increases the expression, synthesis or production of the protein of interest by several folds compared to the expression, synthesis or production of the protein of interest in the absence of SEQ ID NO: 1. Similar embodiments containing the RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4) can also provide similar results.

[0215] In some embodiments, the above-mentioned nucleic acid may additionally comprise a polyadenylation sequence, wherein the polyadenylation sequence is located downstream or 3' of the sequence encoding the target protein. In alternative embodiments, the polyadenylation sequence is immediately 3' continuous with the sequence encoding the target protein. Without wishing to be limited, the polyadenylation sequence may be selected from any polyadenylation sequence known in the art. In some embodiments, the polyadenylation sequence is the SV40 polyadenylation sequence.

[0216] The gene encoding the protein of interest may be a cistron that may encode any of the following proteins: GM-CSF, TNF-a, p53, GFP, chloramphenicol acetyltransferase (CAT), GM-CSF, SMN protein, lipoprotein lipase, Tat protein, Ebola glycoprotein, SARS-CoV-2 spike (S) protein, cytokine, ovalbumin, retinoic acid isomerase RPE65, insulin, SIV Env and Nef antigens or Gag, Env and Tat-Rev-Nef fusion proteins, viral antigens, cyclin G1, immunogenic proteins, immunomodulatory proteins, or cell regulatory proteins. The protein of interest may be a reporter protein, a cell regulatory protein, or a cytotoxic protein.

[0217] In some embodiments, the cistron encodes a GM-CSF protein or a TNF-α protein. In some embodiments, the cistron encodes a protein that targets a specific cell line / a cistron selected to target a specific cell line. Some non-limiting examples can be a cancer cell line, a melanoma cell line, a neuronal cell line, an epithelial cell line, or a lymphocyte cell line.

[0218] In the above embodiments, the regulatory element promoter or translation enhancer used may be cis-acting, non-limiting examples of which are provided above.

[0219] In one embodiment of the present invention, a nucleic acid is provided, comprising: a promoter; a sequence of SEQ ID NO: 1 or 4; and a gene encoding a target protein. Therefore, in some embodiments, the nucleic acid may comprise SEQ ID NO: 1 or 4, a CMV promoter and a gene encoding GM-CSF. In some alternative embodiments, the nucleic acid may comprise SEQ ID NO: 1 or 4, a CMV promoter and a gene encoding TNF-α. The promoter (i.e., CMV) is located upstream or 5' of the sequence SEQ ID NO: 1 or 4. The gene encoding the target protein, i.e., GM-CSF, is located downstream or 3' of the sequence SEQ ID NO: 1 or 4. In alternative embodiments, the promoter may be located 5' of the sequence SEQ ID NO: 1 or 4, and the gene encoding the target protein may be located 3' of the sequence SEQ ID NO: 1 or 4. The promoter may be selected from any of the promoters listed above. The gene encoding the target protein may be a cistron, which may be selected from any of the examples listed above. The selected cistron may encode a target protein targeting a specific cell line, and the present application provides some non-limiting examples. As previously described, translation of the gene sequence of the protein of interest in the presence of SEQ ID NO: 1 or 4 increases the expression, synthesis or production of the protein of interest by several folds compared to the expression, synthesis or production of the protein of interest in the absence of SEQ ID NO: 1 or 4. In some embodiments, the increase in protein expression, synthesis or production is 0.5-fold, 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold or 8-fold. Increased expression, synthesis or production of proteins typically occurs during HSV1 infection.

[0220] In one embodiment of the invention, the nucleic acid may comprise a CMV promoter; a sequence of SEQ ID NO: 1 or 4; and a gene encoding a GM-CSF protein. In an alternative embodiment, the nucleic acid may comprise a CMV promoter; a sequence of SEQ ID NO: 1 or 4; and a gene encoding a TNF-α protein. The CMV promoter is located upstream or 5' of the sequence of SEQ ID NO: 1 or 4. The gene encoding the GM-CSF protein is located 3' to the sequence of SEQ ID NO: 1 or 4. Transcription of the sequence of SEQ ID NO: 1 increases the translation of the gene encoding the GM-CSF protein by several folds, i.e., 0.5-fold, 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, or 8-fold, compared to translation in the absence of SEQ ID NO: 1 or 4.

[0221] In some embodiments, the nucleic acid can be inserted into a gene delivery medium, such as a plasmid, a vector, a recombinant DNA or RNA construct, or an expression cassette. Some non-limiting examples of carriers that can be used include viral vectors, live viral vectors, oncolytic viral vectors, attenuated viral vectors, recombinant vectors, or amplicon vectors. In some alternative embodiments, the nucleic acid can be inserted into a nanoparticle, or a lipid nanoparticle, or a gene delivery medium or construct based on HSV1 or HSV1. When the nucleic acid is inserted into any position of HSV1 or a construct based on HSV1, the nucleic acid can be inserted into any site or restriction endonuclease site of the HSV1 genome. In an alternative embodiment, the nucleic acid can be inserted into the tk locus of HSV1.

[0222] Nucleic acids inserted into HSV1-based gene delivery vehicles or constructs can be used for administration to patients in need, where the patient has been previously infected with the HSV1 virus prior to administration of the HSV1 virus-based delivery vehicle. Alternatively, the nucleic acid is inserted into a HSV1 live viral vector or an oncolytic HSV1 vector and administered to patients in need using a live viral vector, which eliminates the need for prior infection. Administration of nucleic acids increases protein expression, synthesis or production, however, this increased production is only apparent in cells of patients previously infected with the HSV1 virus.

[0223] In one embodiment of the present invention, the nucleic acid can be inserted into the HSV1 virus, wherein the virus is modified to include an endonuclease site for a promoter or regulatory element; and an endonuclease site for a sequence encoding a protein of interest. The promoter, regulatory element, and downstream cistron can be selected from the examples provided above. The HSV1 virus delivers a nucleic acid containing SEQ ID NO: 1 or 4 to cells and causes a several-fold increase in protein production from the downstream cistron. This is very helpful for targeting specific cell lines or treating medical conditions, cell defects, or diseases because large amounts of the protein of interest can be delivered to patients in need. As previously described, the increase in protein production requires prior infection with the HSV1 virus and increases protein production several-fold compared to protein production in the absence of SEQ ID NO: 1. g

[0224] The nucleic acid described above can be used as a 5'UTR sequence or leader sequence or cis-acting regulatory element, wherein the nucleic acid may have a lower folding free energy compared to other 5'UTR sequences of the HSV1 genome.

[0225] For all of the above embodiments citing SEQ ID NO: 1 or 4, the present invention also contemplates alternative embodiments comprising any UL27 sequence (ie, SEQ ID NO: 7 or 10), as well as alternative embodiments comprising any UL19 sequence (ie, SEQ ID NO: 13 or 16).

[0226] Vectors and other constructs

[0227] In one embodiment of the present invention, a vector is provided, comprising SEQ ID NO: 1 or a fragment containing at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 1, or a sequence at least 90% identical to SEQ ID NO: 1, or a fragment containing at least 180 nucleotides and a promoter, a nucleotide sequence encoding a protein of interest, one or more regulatory sequences, one or more restriction endonucleases or cloning sites, and one or more polyadenylation sites or any combination thereof. An alternative embodiment is also contemplated, comprising RNA counterparts of SEQ ID NO: 1, 2 and 3 (i.e., SEQ ID NO: 4, 5 and 6).

[0228] As described above, both viral and non-viral constructs can be used to insert the US11 5' leader sequence. In some embodiments, commercially available vectors can be modified to insert the US11 5' leader sequence to improve the efficacy of existing gene therapies. Some examples include T-vec (Amgen), HSV-1716 (Virttu Therapeutics-acquired by Sorrento), Immvira, Virogin, Replimune, Treovir, J&J, BeneVir, and Oncorus.

[0229] In one embodiment, the vector is a viral vector recombinantly transformed with a heterologous nucleic acid, the heterologous nucleic acid comprising: SEQ ID NO: 1 or a fragment comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 1, or; a sequence at least 90% identical to SEQ ID NO: 1, or a fragment comprising at least 180 nucleotides, and a promoter, a nucleotide sequence encoding a protein of interest, one or more regulatory sequences, one or more restriction endonucleases or cloning sites, and one or more polyadenylation sites or any combination thereof. An alternative embodiment is also contemplated, comprising RNA counterparts of SEQ ID NO: 1, 2, and 3 (i.e., SEQ ID NO: 4, 5, and 6).

[0230] The viral vector comprises: at least one of the following: SEQ ID NO: 1, or a fragment of SEQ ID NO: 1, or a sequence at least 90% identical to SEQ ID NO: 1, the fragment comprising at least 180 nucleotides, a promoter, a nucleotide sequence encoding a protein of interest, one or more regulatory sequences, one or more restriction endonucleases or cloning sites, one or more polyadenylation sites, or any combination that is heterologous to the viral vector. The viral vector may be live, attenuated, oncolytic, or any combination of these. In one embodiment, the viral vector may be an HSV1 viral vector, and more specifically, the HSV1 viral vector is HSV1. An alternative embodiment is also contemplated, comprising RNA counterparts of SEQ ID NOs: 1, 2, and 3 (i.e., SEQ ID NOs: 4, 5, and 6).

[0231] In one embodiment of the present invention, a vector comprising any of the above nucleic acids is provided. In some embodiments, the vector comprises an endonuclease site for a promoter or regulatory element, a nucleic acid comprising SEQ ID NO: 1 or 4, and an endonuclease site for a gene encoding a target protein. The nucleic acid described herein comprises SEQ ID NO: 1 or a sequence at least 90% identical to SEQ ID NO: 1 over its entire length, wherein the nucleotide sequence does not comprise SEQ ID NO: 2, SEQ ID NO: 3, or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO: 2, 3, or both, which is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately consecutive to 5' or 3' of SEQ ID NO: 1. In alternative embodiments, the nucleic acid described herein comprises SEQ ID NO:4 or a sequence that is at least 90% identical to the entire length of SEQ ID NO:4, wherein the nucleotide sequence does not comprise SEQ ID NO:5, SEQ ID NO:6, or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:5, 6, or both, which is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous to 5' or 3' of SEQ ID NO:4. The nucleic acid additionally comprises a gene encoding a protein of interest, and optionally a promoter, regulatory element, or translation enhancer. Transcription of SEQ ID NO:1 or 4 increases translation of the gene encoding the protein of interest, thereby inducing an increase in protein expression, synthesis, or production in the cell, compared to translation in the absence of SEQ ID NO:1 or 4.

[0232] In embodiments of the invention, the vector may comprise any of the other nucleic acid embodiments listed above. In addition, the nucleic acid may comprise any regulatory element, translation enhancer or promoter, non-limiting examples of which are provided above.

[0233] The vector described above can be selected from the following non-limiting examples: a viral vector, a live viral vector, an oncolytic viral vector, an attenuated viral vector, a recombinant vector or an amplicon vector. In some embodiments, the vector is constructed using the HSV1 virus, wherein the nucleic acid is inserted at any position on the HSV1 genome, or at any restriction site or tk locus or any other endonuclease site on the HSV1 genome.

[0234] In some alternative embodiments, the nucleic acid can be inserted into a gene delivery vehicle, some non-limiting examples of which are plasmids, expression cassettes, live viruses, DNA or RNA constructs or recombinant nucleotide constructs, intron-free open reading frames, nanoparticles, or lipid nanoparticles. In some embodiments, the gene delivery vehicle described above can be based on HSV1.

[0235] For all of the above vector-based embodiments referencing SEQ ID NO: 1 or 4, the present invention also contemplates alternative embodiments comprising any UL27 sequence (ie, SEQ ID NO: 7 or 10), as well as alternative embodiments comprising any UL19 sequence (ie, SEQ ID NO: 13 or 16).

[0236] Cell lines

[0237] In one embodiment of the present invention, a cell comprising a nucleic acid (comprising SEQ ID NO: 1 or 4) or a vector (comprising SEQ ID NO: 1 or 4) is provided. The cell may comprise a nucleic acid or a vector (alone or in combination), the nucleic acid or vector comprising SEQ ID NO: 1 or a fragment comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 1, wherein the nucleic acid does not comprise SEQ ID NO: 2, SEQ ID NO: 3, or both. In an alternative embodiment, a composition is provided, comprising a sequence at least 90% identical to SEQ ID NO: 1 or a fragment comprising at least 180 nucleotides, wherein the nucleic acid does not comprise SEQ ID NO: 2, SEQ ID NO: 3, or both. As described above, the above-mentioned nucleic acid does not comprise a fragment of SEQ ID NO: 2, 3, or both, and the fragment is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately consecutive to the 5' or 3' end of SEQ ID NO: 1. An alternative embodiment comprising RNA counterparts of SEQ ID NOs: 1, 2, and 3 (ie, SEQ ID NOs: 4, 5, and 6) is also contemplated.

[0238] The cell can be a mammalian cell, or specifically a cancer cell. In the presence of a 5' leader sequence, the cell exhibits an increase in protein expression, synthesis or production of more than about 0.5 times, about 1 times, about 2 times, about 3 times, about 4 times, about 5 times, about 6 times, about 7 times, about 8 times or more compared to the same control cells lacking SEQ ID NO: 1. This is consistent with the experimental results shown above. An alternative embodiment is also contemplated, comprising RNA counterparts of SEQ ID NO: 1, 2 and 3 (i.e., SEQ ID NO: 4, 5 and 6).

[0239] In the above embodiment, the sequence SEQ ID NO:1 can be inserted at any position on the HSV1 genome, or at any restriction site or tk locus of HSV1. In an alternative embodiment, the sequence SEQ ID NO:1 can be inserted at any other site of HSV1. Therefore, a nucleic acid, vector or cell comprising the sequence SEQ ID NO:1 can have a sequence specifically inserted at the tk locus of HSV1 or optionally inserted at any other restriction endonuclease site. However, the expected effect of enhanced protein expression was only observed in cells previously infected with the HSV1 virus.

[0240] In alternative embodiments, the cell may comprise any of the nucleic acid embodiments described above and a pharmaceutically acceptable carrier or excipient. For example, the cell may comprise a nucleic acid comprising SEQ ID NO: 1 or 4, and a pharmaceutically acceptable carrier or excipient. The nucleic acid may comprise SEQ ID NO: 1 or a sequence at least 90% identical to SEQ ID NO: 1 over its entire length, wherein the nucleotide sequence does not comprise SEQ ID NO: 2, SEQ ID NO: 3 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO: 2, 3 or both, wherein the fragment of SEQ ID NO: 2, 3 or both is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases immediately consecutive to 5' or 3' of SEQ ID NO: 1. In alternative embodiments, the nucleic acid described herein comprises SEQ ID NO: 4 or a sequence that is at least 90% identical to the entire length of SEQ ID NO: 4, wherein the nucleotide sequence does not comprise SEQ ID NO: 5, SEQ ID NO: 6, or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO: 5, 6, or both, which is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly consecutive to 5' or 3' of SEQ ID NO: 4. The nucleic acid additionally comprises a gene encoding a protein of interest, and optionally a promoter, a regulatory element, or a translation enhancer. Transcription of SEQ ID NO: 1 or 4 increases the translation of the gene encoding the protein of interest, thereby inducing increased protein expression, synthesis, or production in the cell, compared to the translation in the absence of SEQ ID NO: 1 or 4.

[0241] For all of the above cell line embodiments referencing SEQ ID NO: 1 or 4, the present invention also contemplates alternative embodiments comprising any UL27 sequence (ie, SEQ ID NO: 7 or 10), as well as alternative embodiments comprising any UL19 sequence (ie, SEQ ID NO: 13 or 16).

[0242] Composition

[0243] In one embodiment of the present invention, a composition is provided, comprising a nucleic acid, a vector or a cell (alone or in combination), wherein the nucleic acid, the vector or the cell comprises SEQ ID NO: 1 or a fragment comprising at least 180 nucleotides or a sequence at least 90% identical to SEQ ID NO: 1, wherein the nucleic acid does not comprise SEQ ID NO: 2, SEQ ID NO: 3 or both. In an alternative embodiment, a composition is provided, comprising a sequence at least 90% identical to SEQ ID NO: 1 or a fragment comprising at least 180 nucleotides, wherein the nucleic acid does not comprise SEQ ID NO: 2, SEQ ID NO: 3 or both. As described above, the above nucleic acid does not comprise a fragment of SEQ ID NO: 2, 3 or both, and the fragment is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases immediately consecutive to the 5' or 3' end of SEQ ID NO: 1. An alternative embodiment comprising RNA counterparts of SEQ ID NOs: 1, 2, and 3 (ie, SEQ ID NOs: 4, 5, and 6) is also contemplated.

[0244] In alternative embodiments, the composition may include any of the nucleotide embodiments described above and a pharmaceutically acceptable carrier or excipient. For example, the composition may include a nucleic acid containing SEQ ID NO: 1 or 4, and a pharmaceutically acceptable carrier or excipient. The nucleic acid may include SEQ ID NO: 1 or a sequence that is at least 90% identical to the full length of SEQ ID NO: 1, wherein the nucleotide sequence does not include SEQ ID NO: 2, SEQ ID NO: 3, or both, and wherein the nucleotide sequence does not include a fragment of SEQ ID NO: 2, 3, or both, wherein the fragment of SEQ ID NO: 2, 3, or both is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases that are immediately continuous with 5' or 3' of SEQ ID NO: 1. In alternative embodiments, the nucleic acid described herein comprises SEQ ID NO:4 or a sequence that is at least 90% identical to the entire length of SEQ ID NO:4, wherein the nucleotide sequence does not comprise SEQ ID NO:5, SEQ ID NO:6, or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:5, 6, or both, which is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases that are immediately consecutive to 5' or 3' of SEQ ID NO:4. The nucleic acid additionally comprises a gene encoding a protein of interest, and optionally a promoter, a regulatory element, or a translation enhancer. Transcription of SEQ ID NO:1 or 4 increases the translation of the gene encoding the protein of interest, thereby inducing increased protein expression, synthesis, or production in the cell, compared to the translation in the absence of SEQ ID NO:1 or 4.

[0245] In addition, the composition may comprise a nucleic acid provided in the form of a plasmid, a vector, a recombinant DNA or RNA construct, a gene delivery vehicle, a nanoparticle, and one or more pharmaceutically acceptable excipients.

[0246] The composition may be in the form of a capsule, an injection, an external cream or a powder. In some embodiments, the composition may be in the form of an injection.

[0247] In other embodiments, the composition may comprise the above other nucleic acid-, vector- and cell-based embodiments alone or in combination, optionally comprising one or more pharmaceutically acceptable carriers, excipients or diluents.

[0248] The pharmaceutically acceptable carrier, excipient or diluent may be selected from the non-limiting examples provided above.

[0249] For all of the above composition embodiments referencing SEQ ID NO: 1 or 4, the present invention also contemplates alternative embodiments comprising any UL27 sequence (ie, SEQ ID NO: 7 or 10), as well as alternative embodiments comprising any UL19 sequence (ie, SEQ ID NO: 13 or 16).

[0250] Reagent test kit

[0251] In one embodiment of the present invention, a kit is provided, comprising the nucleic acid embodiment described above (comprising SEQ ID NO: 1 or 4), the vector embodiment described above (i.e., a vector comprising SEQ ID NO: 1 or 4), or any of the cell embodiments described above (i.e., a cell comprising SEQ ID NO: 1 or 4), and one or more pharmaceutically acceptable carriers, excipients or diluents, or one or more buffers, detergents or cell culture media, or one or more containers for containing any of the above items, or instructions for expressing or enhancing the expression of a target protein, or instructions for using any component of the kit, or any combination of the above components.

[0252] In alternative embodiments, the kit may include any of the nucleotide embodiments described above and a pharmaceutically acceptable carrier or excipient. For example, the composition may include a nucleic acid comprising SEQ ID NO: 1 or 4, and one or more pharmaceutically acceptable carriers, excipients or diluents, or one or more buffers, detergents or cell culture media, or one or more containers for containing any of the above, or instructions for expressing or enhancing expression of the target protein, or instructions for using any component in the kit, or any combination of the above components. The nucleic acid additionally includes a gene encoding the target protein, and optionally a promoter, a regulatory element or a translation enhancer. The nucleic acid may comprise SEQ ID NO:1 or a sequence that is at least 90% identical to SEQ ID NO:1 over its entire length, wherein the nucleotide sequence does not comprise SEQ ID NO:2, SEQ ID NO:3 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:2, 3 or both, wherein the fragment of SEQ ID NO:2, 3 or both is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases thereof immediately consecutive to the 5' or 3' of SEQ ID NO:1. In alternative embodiments, the nucleic acid described herein comprises SEQ ID NO:4 or a sequence that is at least 90% identical to the full length of SEQ ID NO:4, wherein the nucleotide sequence does not comprise SEQ ID NO:5, SEQ ID NO:6, or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:5, 6, or both, which is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases that are immediately consecutive to 5' or 3' of SEQ ID NO:4. The nucleic acid may additionally comprise a gene encoding a protein of interest, and an optional promoter or regulatory element. Transcription of SEQ ID NO:1 or 4 increases translation of the gene encoding the protein of interest, thereby inducing increased protein expression, synthesis, or production in the cell, compared to translation in the absence of SEQ ID NO:1 or 4.

[0253] In addition, the kit may include a nucleic acid provided in the form of a plasmid, a vector, a recombinant DNA or RNA construct, a gene delivery vehicle, a nanoparticle, and one or more pharmaceutically acceptable carriers, excipients or diluents, or one or more buffers, detergents or cell culture media, or one or more containers for containing any of the above, or instructions for expressing or enhancing the expression of a target protein, or instructions for using any component of the kit, or any combination of the above components.

[0254] The kit may include a composition having SEQ ID NO: 1 or 4, wherein the composition may be in the form of capsules, injections, topical creams or powders or any other form known in the art. In some embodiments, the composition may be in the form of injections.

[0255] In other embodiments, the kit may comprise the above-mentioned nucleic acid-, vector- and cell-based embodiments alone or in combination, optionally comprising one or more pharmaceutically acceptable carriers, excipients or diluents.

[0256] The kit may additionally comprise a container device, which may include at least one vial, test tube, flask, bottle, syringe or other container device, into which the nucleic acid, vector, cell, composition and / or other material may be placed, and in various embodiments, the kit will include instructions for use of the materials contained in the kit.

[0257] For all of the above kit-based embodiments referencing SEQ ID NO: 1 or 4, the present invention also contemplates alternative embodiments comprising any UL27 sequence (ie, SEQ ID NO: 7 or 10), as well as alternative embodiments comprising any UL19 sequence (ie, SEQ ID NO: 13 or 16).

[0258] Methods for producing a protein of interest or increasing expression

[0259] In one embodiment of the invention, a method for producing a target protein in a cell is provided, wherein the method comprises administering a nucleic acid to the cell. The administered nucleic acid comprises a promoter, SEQ ID NO: 1, and a sequence encoding the target protein expressed by the nucleic acid in the cell. Alternative embodiments are also contemplated, wherein the method employs an RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4).

[0260] In an alternative embodiment, a method for increasing the expression, synthesis or production of a target protein in a cell is provided, comprising the steps of administering a nucleic acid to a cell, wherein the nucleic acid comprises a promoter, SEQ ID NO: 1 and a sequence encoding a target protein expressed by the nucleic acid in the cell, wherein the increase in expression, synthesis or production of the target protein is relative to a similar step of administering the nucleic acid in the absence of SEQ ID NO: 1. Alternative embodiments are also contemplated, wherein the method employs an RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4). In some embodiments, the method may additionally include the step of preparing a nucleic acid, wherein the promoter is located upstream or 5' of SEQ ID NO: 1 or 4, and the sequence encoding the target protein is located downstream or 3' of SEQ ID NO: 1 or 4. In some other embodiments, the method may additionally include the step of infecting cells or patients in need with the HSV1 virus, wherein the step of infecting the cells occurs before administering the nucleic acid to the cells, which results in increased protein production in the cells, which may help treat or improve the medical condition, cell defect or disease being targeted. Alternatively, as described above, live viral vectors or oncolytic viral vectors may be used to eliminate the step of pre-infecting cells or patients to enhance protein production.

[0261] In some embodiments, the method can additionally include inserting the nucleic acid into a gene delivery vehicle, wherein the step of inserting the nucleic acid occurs before infecting the cell with the HSV1 virus and before administering the nucleic acid to the cell, wherein the nucleic acid is administered to the cell by infecting the cell with a gene delivery vehicle containing the nucleic acid. The gene delivery vehicle can be selected from any of the non-limiting examples provided above. As previously discussed, administration of a nucleic acid containing SEQ ID NO: 1 or 4 results in a several-fold increase in protein production compared to production in the absence of SEQ ID NO: 1 or 4.

[0262] The method may comprise the use of any of the nucleic acids, vectors, gene delivery vehicles, compositions or kits described above, or may be used to target any of the cell lines described above.

[0263] In the above embodiment, the promoter may be located upstream or 5' of SEQ ID NO:1 (or SEQ ID NO:4), and the sequence encoding the protein of interest is located downstream or 3' of SEQ ID NO:1 (or SEQ ID NO:4). The nucleic acid can be inserted into HSV1, and as previously described, the expected effect of enhancing protein expression can be observed when the cell is infected with the HSV1 virus. In some embodiments, the method can be performed using a nucleic acid in the form of a plasmid or vector. The vector may be selected from, but is not limited to, a viral vector, a live viral vector, an oncolytic viral vector, an attenuated viral vector, a recombinant vector, or an amplicon vector.

[0264] For all of the above production method embodiments citing SEQ ID NO: 1 or 4, the present invention also contemplates alternative embodiments comprising any UL27 sequence (ie, SEQ ID NO: 7 or 10), and alternative embodiments comprising any UL19 sequence (ie, SEQ ID NO: 13 or 16).

[0265] Methods of treating medical conditions, cellular defects or diseases

[0266] In one embodiment of the invention, a method for improving or treating a medical condition, cell defect or disease in a subject is provided. The method comprises administering a nucleic acid to a cell of a subject exhibiting a medical condition, cell defect or disease, wherein the nucleic acid comprises a promoter, SEQ ID NO:1 and a sequence encoding a protein of interest expressed by the nucleic acid in the cell. The selected protein of interest is capable of improving or treating a medical condition, cell defect or disease in the subject, and therefore, the expression, synthesis or production of the protein of interest in the subject's cells can improve or treat a medical condition, cell defect or disease in the subject. An alternative method is also contemplated, wherein the nucleic acid comprises SEQ ID NO:4.

[0267] In the nucleic acid, the promoter is located upstream or 5' of SEQ ID NO: 1 (or SEQ ID NO: 4), and the sequence encoding the protein of interest is located downstream or 3' of SEQ ID NO: 1 (or SEQ ID NO: 4). The nucleic acid can be inserted into HSV1, and in order to achieve the desired result, the subject or the subject's cells are infected with HSV1, thereby allowing the delivery of the nucleic acid. As previously suggested, the nucleic acid can be inserted into HSV1, where it is a live viral vector, an oncolytic viral vector, or an attenuated viral vector. In an alternative embodiment, it is possible that the method employs the RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4).

[0268] In one embodiment of the present invention, a method for treating a medical condition, a cell defect or a disease in a patient is provided, comprising: administering a nucleic acid to a cell of a patient in need, the nucleic acid comprising a promoter, SEQ ID NO: 1 or 4, and a gene encoding a protein of interest expressed by the nucleic acid in the cell, wherein the protein of interest is capable of treating / improving the medical condition; wherein the expression, synthesis or production of the protein of interest in the patient's cells improves the medical condition, cell defect or disease in the patient. More specifically, the transcription of SEQ ID NO: 1 or 4 increases the translation of the gene encoding the protein of interest by several folds compared to the translation in the absence of SEQ ID NO: 1 or 4, and the large amount of the protein of interest provides the necessary treatment. The method may additionally include the step of infecting the cell or patient with the HSV1 virus, wherein the step of infecting the cell or patient occurs before administering the nucleic acid to the cell. In addition, the method may include the step of inserting the nucleic acid into any of the vectors, gene delivery vehicles, constructs, compositions or kits described above, wherein the step of inserting the nucleic acid occurs before infecting the cell or patient with the HSV1 virus and before administering the nucleic acid to the cell or patient in need. In the presence of HSV1 infection, the sequence SEQ ID NO: 1 or 4 increases protein expression several fold (eg 8 fold).

[0269] In an alternative embodiment, a method for treating cancer in a subject is also provided. The method comprises administering a nucleic acid to a cell of a patient / subject, wherein the nucleic acid comprises a promoter, SEQ ID NO: 1, and a sequence encoding a protein of interest expressed by the nucleic acid in the cell. The protein of interest is carefully selected to improve or treat cancer in the subject. Thus, enhancing the expression, synthesis or production of the protein of interest in the patient's cells can treat cancer or cancerous conditions. In an alternative embodiment, the cancer can be melanoma. Alternative embodiments are also contemplated, wherein the method employs an RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4).

[0270] In an alternative embodiment, a method of treating melanoma in a subject is also provided. The method comprises administering to cells of the patient / subject a nucleic acid, wherein the nucleic acid comprises a promoter, SEQ ID NO: 1, and a sequence encoding GM-CSF expressed by the nucleic acid in the cells. Thus, the expression, synthesis or production of GM-CSF in the patient's cells is enhanced to treat the melanoma condition. Alternative embodiments are also contemplated wherein the method employs the RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4).

[0271] The above methods can be used to treat a variety of medical conditions, cell defects or diseases. The following is a non-limiting list of examples: cancer, melanoma, immune deficiency, celiac disease, liver or kidney disorders or any protein deficiency.

[0272] For all of the above method of treatment embodiments citing SEQ ID NO: 1 or 4, the present invention also contemplates alternative embodiments comprising any UL27 sequence (ie, SEQ ID NO: 7 or 10), and alternative embodiments comprising any UL19 sequence (ie, SEQ ID NO: 13 or 16).

[0273] Ways to improve existing gene therapies

[0274] In an alternative embodiment, a method for improving the efficacy of existing gene therapy is provided, wherein the method includes modifying the gene delivery medium used in the existing gene therapy by inserting the sequence of SEQ ID NO: 1, wherein the gene delivery medium comprises a sequence encoding a target protein. The modified gene delivery medium can be administered to patients in need of gene therapy. Relative to the expression, production or synthesis of the target protein in the absence of SEQ ID NO: 1, the transcription of SEQ ID NO: 1 increases the translation of the sequence encoding the target protein, and thereby causes an increase in the expression, production or synthesis of the target protein, which improves the efficacy of the existing gene therapy. Therefore, the method can be used to improve the efficiency of any existing viral or non-viral gene therapy. As shown in the above experiments, compared with the expression, production or synthesis of the target protein in the absence of SEQ ID NO: 1 or 4, the method can increase the expression, production or synthesis of the target protein by several times (e.g., 8 times), thereby improving the efficiency of the existing gene therapy. An alternative method is also contemplated, wherein the nucleic acid comprises the RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4). In some embodiments, the expression, production or synthesis of the target protein is increased by 0.5 times, 1 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times or more compared to the expression, production or synthesis of the target protein in the absence of SEQ ID NO: 1 (or SEQ ID NO: 4). The following is a non-limiting list of gene therapies that can use this method to improve efficiency: Zolgensma, Yescarta, Luxturna, Kymriah, Zynteglo, MB-107, Strimvelis, Tecartus or any existing gene therapy in phase trials. Some examples of commercially available vectors that can be modified include T-vec (Amgen), HSV-1716 (Virttu Therapeutics-acquired by Sorrento), Immvira, Virogin, Replimune, Treovir, J&J, BeneVir and Oncorus. In order to enhance the increased protein expression in non-HSV1 gene therapies, simultaneous infection with HSV1 virus or HSV1 live viral vectors may be required. In one embodiment of the present invention, the existing gene therapy may be oncolytic virus therapy or gene-based immunotherapy or any other existing gene therapy.

[0275] For all of the above method embodiments referencing SEQ ID NO: 1 or 4, the present invention also contemplates alternative embodiments comprising any UL27 sequence (ie, SEQ ID NO: 7 or 10), and alternative embodiments comprising any UL19 sequence (ie, SEQ ID NO: 13 or 16).

[0276] Methods to increase transgene expression

[0277] A method for increasing transgene expression in a cell is provided, comprising administering to the cell a nucleic acid comprising a promoter, SEQ ID NO: 1, and a transgene expressed by the nucleic acid in the cell. The transgene encodes a protein of interest, and expression of the transgene is increased relative to a similar step in which the nucleic acid is administered in the absence of SEQ ID NO: 1. The method can also be performed using an RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4).

[0278] For the above embodiments citing SEQ ID NO: 1 or 4, the present invention also contemplates alternative embodiments comprising any UL27 sequence (ie, SEQ ID NO: 7 or 10), and alternative embodiments comprising any UL19 sequence (ie, SEQ ID NO: 13 or 16).

[0279] Methods for identifying transcription start sites

[0280] In one embodiment of the present invention, a method for identifying a transcription start site (TSS) (or 5'UTR sequence or leader sequence) in a viral genome that can increase protein expression, synthesis or production is provided, comprising: sequencing a copy of the viral genome to obtain sequencing data; mapping the sequencing data with pre-existing / annotated sequencing data of the viral genome by aligning short reads to identify splicing sites on the mRNA transcripts of the viral genome; identifying multiple TSSs by locating stacked short reads on each mRNA transcript; using the identified TSSs to perform a reporter gene assay with a reporter protein; and identifying TSSs that increase the expression, synthesis or production of reporter proteins compared to a control assay in which the TSS is not present. Multiple copies of the identified TSS for reporter gene assays can be obtained by amplification from a cDNA library, and copies of the viral genome can be obtained from virus-infected cells. The mapping step can be performed using RNA sequencing or any currently available or currently used advanced sequencing technology. The reporter protein can be selected from any of the following non-limiting examples: GFP, RFP, lacZ, LUC, CAT, or any other reporter protein known in the art. The reporter gene assay can be performed using a reporter gene construct containing a reporter protein and one of the identified TSSs, wherein the reporter gene construct can be a plasmid, a vector, any gene delivery vehicle, or a nanoparticle. In some embodiments, the TSS can be identified by locating the 5' and 3' ends of pre-existing / annotated sequencing data of the viral genome. For greater certainty, the reporter gene assay can be performed in multiple cell lines, or using a specific cell line selected from the non-limiting examples provided above.

[0281] In some of the above embodiments, the present disclosure provides theories and speculations regarding the mechanisms of biological processes. The present invention is not intended to be bound by theories or speculations regarding the mechanisms of biological processes, and they should not be used to limit the present invention in any way.

[0282] For all of the above embodiments citing US11, alternative embodiments with a UL27 or UL19 5' leader sequence are also contemplated.

[0283] Discussion, Experimental Results, and Examples

[0284] Determine the HSV1 mRNA sequence or 5' leader sequence

[0285] HSV1 is an enveloped dsDNA virus with a 153Kb genome consisting of covalently linked long (L) and short (S) segments encoding a total of approximately 80 genes. Multiple single-gene studies have identified and characterized the 5' leader sequences and 3' untranslated regions (3'UTRs) of a limited number of HSV1 genes (Table 1). However, most transcripts do not have such annotations in the public NCBI database (e.g., NCBI accession numbers JQ780693 for strain KOS and JN555585 for strain 17). Therefore, RNA-seq data of HSV1-infected 4T1 murine breast cancer cells were generated. By mapping the HSV1 reads in this dataset to the KOS strain reference (JQ780693.1), RNA transcripts from each positive and negative gDNA strand (e.g., Figure 2 A and 2E). Figure 2 A shows the total RNA-seq coverage of the HSV1 genome of 4T1 infected cells. Of note, strand-specific RNA reads were mapped to the HSV1 genome and separated by strand direction to avoid ambiguous mapping of overlapping genes. By mapping the HSV1 reads in this dataset to the KOS strain reference genome (JQ780693.1), RNA transcripts derived from each positive and negative gDNA strand can be distinguished ( Figure 2 B). In addition, the splice junctions of the four known spliced ​​transcripts of HSV1 (i.e., UL15, US1, US12, and RL2) were discerned during this process, as well as the previously reported intron retention of RL2 ( Figure 7 ).like Figure 7 As shown, individual transcripts (RL2, UL15, US1, US12) can be identified by RNA-seq coverage on both the positive strand (blue) and the negative strand (red).

[0286] One might think that identifying transcription start sites (TSSs) from long-read sequencing technologies (e.g., the PacBio approach) or whole transcript sequencing (e.g., the Oxford Nanopore MinION platform) would be more straightforward than RNA-Seq, which relies on aligning short reads, especially in the presence of overlapping ORFs. However, it was observed that standard RNA-seq read mapping adequately identified TSSs for non-overlapping HSV1 genes. This was made possible by the high depth and coverage achieved in infected cells despite a low multiplicity of infection (MOI) of 0.1. TSS locations were identified by monitoring “walls” of stacked short reads that were interpreted as transcript starts (e.g., Figure 2 B and Figure 2 C). Figure 2 B shows RNA-seq coverage of the US1 gene in the HSV1 genome, where intron-spanning reads were also detected and shown using a Sashimi plot. Figure 2 C shows RNA-seq coverage of the 5' region of the US1 gene, with the lower panel showing the predicted TSS region at nucleotide resolution. A similar approach was recently used by Whisnant et al. to enumerate the HSV1 TSS, although their approach used a more specialized RNA-seq method.

[0287] Through this experiment, reads flanking the 5' and 3' ends of most annotated ORFs were detected (e.g. Figure 2 C and 2D ), confirming that all annotated HSV1 transcripts contain a 5' leader sequence and a 3' UTR. Figure 2 The RNA-seq coverage of the 3' region of the US1 gene can be clearly seen in D. Although the 3'UTR of most viral genes overlaps with the downstream ORF, the peak read density at a single nucleotide position upstream of the start codon is consistent with the TSS and can be clearly distinguished from the low read density on the 3'UTR ( Figure 2 B, 2C, inset and Table 1). Figure 2E A schematic of the workflow for identifying HSV1 5' leader sequences from RNA-seq reads, screening for enhanced translation of 5' leader sequences in HSV1-infected cells, and integrating 5' leader sequences into transgene expression in the oncolytic HSV1 genome for testing in in vivo tumor models can be seen. Using these TSS coordinates, we identified 61 5' leader sequences for the HSV1 gene (Table 2). Importantly, when the identified TSSs were compared to the few TSSs annotated in NCBI (recently identified by long-read sequencing by Tombachz et al., or RNA-seq of enriched 5' end reads by Whisnant et al.), we found that the coordinates of the TSSs were exact or differed by only a few nucleotides (Table 1). Figure 8 shows the read density coverage of each identified TSS more clearly. Figure 8 shows the total RNA-seq coverage of the HSV1 genome, as well as RNA-seq data for 4T1 infected with HSV1 previously published in Hoang et al., 2019. To avoid ambiguous mapping of overlapping genes, strand-specific RNA reads were mapped to HSV1 (JQ780693.1) and separated by orientation. The diagram shown in Figure 8 shows an inset of each identified TSS for all HSV1 genes.

[0288] Using these TSS coordinates, the inventors were able to identify 61 5' leader sequences of the HSV1 gene (see Table 2). Importantly, when the identified TSSs were compared to the few TSS lines annotated in NCBI (recently identified by long-read sequencing performed by Tombácz et al., or RNA-Seq performed on enriched 5' end reads by Whisnant et al.), the inventors found that the coordinates of the TSSs were exact or differed by only a few nucleotides (Table 1). These studies confirm that this method can robustly detect and confidently annotate every HSV1 transcript 5' leader sequence.

[0289] Table 1. HSV1 TSSs identified in this study (Hoang et al.) compared with Tombachz et al., 2017 and Whisnant et al., 2020

[0290]

[0291]

[0292]

[0293]

[0294]

[0295]

[0296]

[0297]

[0298]

[0299]

[0300]

[0301] The US11 leader sequence enhances the translation of downstream ORFs in HSV1-infected cells

[0302] After in silico identification of the 5' leader sequences of most HSV1 genes, it was important to determine their ability to modify the translational output of downstream cistrons. It was hypothesized that the leader sequences of HSV1 late genes expressed during established stages of infection should be best adapted to the altered translational control of HSV1 infection and should therefore be more likely to possess motifs that actively modify translation in HSV1-infected cells. To confirm this hypothesis, ten late genes were selected to test the translational modification effects of their 5' leader sequences in HSV1-infected cells (e.g. Fig. 9 The left heatmap shows the relative mRNA expression levels of 10 late genes selected as candidates, and the right heatmap shows the relative mRNA expression levels of 4 immediate early genes. The mRNA expression was obtained from a previously reported study by Rutkowski et al. 2015. To normalize the levels to percentages, the expression levels were normalized to the percentage of the highest expression level at all time points.

[0303] The HSV1 5' leader sequence of selected late genes was amplified from a cDNA library generated from HSV1-infected 4T1 cells and inserted upstream of a chloramphenicol acetyltransferase (CAT) reporter gene construct ( Figure 3 A and Fig.10 A). Figure 3 The HSV1 US11 5' leader sequence is shown, which can enhance the expression of protein reporter genes in HSV1 infected mammalian cells. Specifically, Figure 3 (A) provides a schematic diagram of the mRNA expressed by the CAT reporter construct with or without the HSV1 5'UTR sequence. In addition, Fig.10 A translation reporter screen for 5'UTRs that enhance translation during HSV1 infection is provided, and Fig.10 (A) provides other HSV1 5' leader sequences (including Figure 3 Agarose gel visualization of the remaining 5' leader sequence shown in .

[0304] Negative controls (i.e., RNA isolated from uninfected cells) confirmed that the PCR products were specific for HSV1 transcripts only. Translational reporter gene assays were also performed under uninfected and HSV1-infected conditions by co-transfecting 4T1 cells after infection with monocistronic plasmids expressing CAT and β-galactosidase, including the latter construct to normalize for differences in transfection efficiency. In uninfected cells, the viral 5' leader sequence had both positive and negative effects on reporter gene expression, although no clear trend was observed (e.g., Figure 3 B). Figure 3 B shows the results of a translation reporter assay used to screen for HSV1 5' leader sequences that enhance translation during HSV1 infection. Specifically, 4T1 cells were infected with HSV-1716-GFP at an MOI of 5 and then transfected with a CAT plasmid, and a β-GAL expression plasmid was used as a transfection control. Cells were lysed 24 hours after infection and CAT expression was quantified by ELISA, while β-GAL activity was quantified by colorimetric assay using ONPG substrate. A two-way ANOVA with Tukey's post hoc test was also performed. Only significance tests are shown in the figure, where n = at least 3 biological replicates, and error bars indicate standard deviations (sd). *p<0.05, **p<0.01.

[0305] The US11 5' leader sequence exerted the highest effect in enhancing the translation of the CAT mRNA reporter gene. In contrast, the 5' leaders of UL1 and US8 were found to have no inhibitory effect during HSV1 infection ( Fig.10 B). Fig.10 B shows a translation reporter assay for screening HSV-1 leader sequences that enhance translation during HSV-1 infection. 4T1 cells were transfected with CAT plasmid and β-GAL expression plasmid as a transfection control. 8 hours after transfection, cells were infected with HSV-1716-GFP at an MOI of 5. 18 hours after infection, cells were lysed and CAT expression was quantified by ELISA, while β-GAL activity was quantified by colorimetric assay using ONPG substrate.

[0306] However, after HSV1 infection, we found that US11 and UL27 5' leaders significantly enhanced CAT protein expression compared with the reporter lacking the leader sequence (no leader) ( Figure 3 B). Importantly, these observations were not due to 5' leader-mediated upregulation of CAT mRNA transcription ( Figure 3 C).

[0307] After infection with HSV1, it was observed that the 5'UTR genes (specifically US11 and UL27 5' leaders) significantly enhanced CAT expression compared to reporter constructs lacking a leader sequence (i.e., no leader sequence) ( Figure 3 B). In addition, the UL19 5' leader sequence enhanced CAT protein expression under HSV1 infection conditions but suppressed CAT protein expression under uninfected conditions. It is noteworthy that these observations were not due to upregulation of CAT mRNA transcription mediated by the 5' leader sequence (e.g. Figure 3 C). Figure 3 C shows relative CAT mRNA expression from a CAT translation reporter assay, where 4T1 cells were treated as in 2(C) and then lysed using Trizol. RT-qPCR was then used to quantify mRNA expression of CAT mRNA and normalized to the expression of Rps20. In addition, a two-way ANOVA with Sidak post hoc test was performed. Only significant tests are shown in the figure, where n=3 biological replicates, and error bars indicate standard deviations (sd). *p<0.05, **p<0.01, ****p<0.0001.

[0308] The folding free energy and potential secondary structure of the US11 and UL27 leader sequences were also predicted ( Fig.10 C) and the folding free energy of other screened HSV1 leader sequences ( Fig.10 D). Fig.10 B shows the secondary structures and folding free energies of US11 (left) and UL27 (right) leader sequences predicted using Vienna RNAfold, where the color scale indicates base pairing probability. Fig.10 (C) Shown is a heat map representing the folding free energies of candidate HSV1 leader sequences calculated using Vienna RNAfold.

[0309] It was observed that although the 5' leader sequences of US11 and UL27 had the strongest translational enhancing effect on CAT expression, they had lower predicted folding free energies compared to the other HSV1 leader sequences. Taken together, these results suggest that the 5' leader sequences from US11 or UL27 mRNA can mediate HSV1 infection-dependent increases in protein expression when inserted upstream of the transgene in cells.

[0310] Lytic infection with HSV1 has been reported to induce profound reprogramming of cellular transcription, splicing, and nuclear export. Therefore, plasmid-based overexpression reporter gene assays may be impaired by HSV1 infection and may not faithfully reflect gene expression processes, including mRNA translation, of HSV1-encoded transgenes. Therefore, the effect of the US11 5' leader sequence on regulating transgene expression directly from an expression cassette designed to be inserted into the tk locus of the HSV1 genome was investigated. Without limiting the scope of this application, it is noteworthy that transcription of the pTK plasmid expression cassette is driven by the CMV promoter and includes the SV40 polyadenylation signal (e.g., Figure 3 D). However, any other upstream promoter, enhancer or regulatory element may be used together with the 5' leader sequence. Figure 3 D provides a schematic diagram of the pTK-Green plasmid, which contains the HSV1 5' leader sequence-reporter gene construct inserted into the HSV1 TK gene and the transcripts produced thereby. As shown in the figure, the ribosomal skipping sequence P2A is inserted between the luciferase CDS and the GFP CDS, which allows the synthesis of both proteins from one cistron. This bicistronic transgenic cassette is created to allow the simultaneous expression of the therapeutic protein and the reporter protein to facilitate the selection and monitoring of recombinant viruses, all under the control of a putative enhancer element inserted at the 5' end of the expression cassette (from Figure 3 D can be seen). The ORF consists of luciferase (LUC; however, any protein of interest can be used and LUC can be replaced to create a desired therapeutic ORF). In addition, green fluorescent protein (GFP) isolated from the self-cleaving peptide porcine teschovirus-1 2A (P2A) was inserted into the ORF. It is known that the addition of P2A causes the intercistronic translating ribosome to skip the peptide bond formation between glycine and proline residues, resulting in the production of separate LUC and GFP proteins from a single luc-gfp mRNA transcript. At the same time, GFP fluorescence in 4T1 cells transfected with a plasmid without a leader sequence or a plasmid containing a US11 leader sequence and subsequently infected with or without HSV1 was quantified, and GFP expression was monitored by fluorescence microscopy. As Figure 3 As shown in E, low fluorescence was observed in leader-less and uninfected cells.

[0311] Figure 3E shows quantification of GFP fluorescence in cells transfected with the LUC-GFP reporter plasmid, infected with HSV1 (KOS strain mentioned above) at an MOI of 2.5 4 hours after transfection, and images were taken 24 hours after infection. As expected, the construct containing the US11 leader sequence showed significant GFP expression, however this peak of expression was only observed in cells infected with HSV1. Further Western blot analysis of transfected cell lysates confirmed that the addition of the US11 5' leader sequence resulted in increased GFP protein levels in HSV1 infected cells (Figure 2A). Figure 3 F and 3G). Figure 3 (F) shows a Western blot of lysates of 293T cells that had been cultured as described above. Figure 2 (B) The cells were treated with antibodies against GFP, anti-HSV1, or anti-β-actin antibodies. Figure 3 (G) shows Figure 2 Quantification of GFP expression from Western blot shown in (F).

[0312] Consistent with the results obtained previously, the addition of the US11 5' leader sequence did not affect the levels of GFP transcripts in uninfected cells compared to HSV1-infected cells (e.g. Figure 3 H). Figure 3 H shows RT-qPCR quantification of LUC-GFP mRNA in the experiment described above. In the figure, two-way ANOVA with Sidak post hoc test was performed, where n=3 biological replicates, and error bars indicate standard deviation (sd). *p<0.05, **p<0.01, ****p<0.0001, ns, not significant.

[0313] US11 5' leader sequence enhances transgenic protein expression from engineered HSV1 virions

[0314] To verify the potential of the US11 5' leader sequence as a transgene enhancer, a recombinant HSV1 strain was constructed based on the above-mentioned bicistronic pTK transgene expression plasmid. After co-transfection with purified HSV1 genomic DNA, the linearized pTK plasmid was used to generate recombinant virus. Homologous recombination of the expression cassette into the tk locus produced Δtk viral progeny, which constitutively expressed the transgene under the CMV promoter (e.g., Figure 4 As previously mentioned, different promoters, translation enhancers and regulatory elements can be used together with or in place of the CMV promoter.

[0315] Figure 4 It was shown that the recombinant HSV1 virus exhibited enhanced GM-CSF expression dependent on the US11 5' leader sequence. Specifically, Figure 5A shows a schematic diagram of the insertion scheme of the expression cassette from the pTK-CSF2-GFP plasmid into the HSV1 genome and the resulting transcripts expressed from the inserted cassette (note that the TK gene is located on the minus strand). Consistent with the enhanced expression of GFP conferred by the US11 5' leader sequence in the plasmid-based system, plaques on Vero cells of HSV1 US11-Csf2 showed increased GFP fluorescence compared to plaques of HSV1 Csf2 without the leader sequence (see Figure 2A). Figure 4 C). Figure 4 C shows the fluorescence imaging results of single plaques of wild-type HSV1, HSV1 Csf2 construct and HSV1 US11-Csf2 construct.

[0316] To better demonstrate clinical potential, the LUC ORF in the LUC-GFP expression cassette was replaced with the GM-CSF (Csf2) ORF, a virally expressed gene in the FDA-approved oncolytic HSV1. A leader-free (HSV1Csf2) virus and two virus clones containing the US11 5' leader sequence (HSV1 US11-Csf2) were constructed. Figure 4 (B) shows the results of viral genotyping to confirm the insertion of the expression cassette. PCR was performed using HSV1 gDNA extracted from purified virus to confirm the insertion of the leaderless CSF2-GFP cassette (~400 bp) and the US11 5' leader-CSF2-GFP cassette (~600 bp) into the TK region of the HSV1 genome.

[0317] Cells infected with either HSV1 US11-Csf2 clone produced many times more GM-CSF than cells infected with HSV1 Csf2 ( Figure 4 D. Fig.15 ). Figure 4 D shows quantification of GM-CSF production in culture supernatants of Vero cells infected with HSV1 expressing leaderless CSF2-GFP or US11 5' leader-CSF2-GFP. Vero cell monolayers were infected with the indicated viruses at an MOI of 5, and culture supernatants were collected 24 hours after infection. GM-CSF concentrations were quantified by ELISA. One-way ANOVA with Dunnett's post hoc test was performed. n=3 biological replicates. Error bars: ±sd. ****p<0.0001.

[0318] Fig.15 The enhanced expression of the US11 5' leader sequence in oncolytic HSV1 was characterized. Specifically, Fig.15A shows Vero cell monolayers infected with the indicated viruses at an MOI of 5, and culture supernatants were collected 24 hours after infection. GM-CSF concentrations were quantified by ELISA. One-way ANOVA with Dunnett's post hoc test was performed. n = 3 biological replicates. Error bars: +sd. ****< <p<0.0001。 Fig.15 B shows representative GFP fluorescence of HSV1 expressing leaderless CSF2-GFP or US11 5' leader-CSF2-GFP. CT26 monolayers were infected with the indicated viruses at an MOI of 5, and fluorescence microscopy images were taken 24 hours after infection. Fig.15 C shows the time course of GFP fluorescence of HSV1 expressing leaderless CSF2-GFP or US11 5' leader-CSF2-GFP. CT26 monolayers were infected with the indicated viruses at an MOI of 0.2, 1, or 5, and GFP fluorescence was monitored over 2 days post-infection using the Incucyte Live Cell Imaging System. Fig.15 D shows the dose-dependency analysis of secreted GM-CSF. CT26 cells were infected with the indicated viruses at an MOI of 0.2, 1, or 5, and the culture supernatants were collected 24 hours after infection. GM-CSF concentrations were quantified using ELISA. Two-way ANOVA with Sidak post hoc test was performed. n=3 biological replicates. Error bars: +sd. ****p<0.0001.

[0319] In some cases, production increased by nearly 8-fold. Although a high increase in protein expression is likely, it is important to assess whether the enhanced GM-CSF production is a result of higher viral replication. To determine this, replication kinetics were measured by single-step growth curves and it was observed that all viral clones exhibited comparable replication kinetics ( Figure 4 E). Figure 4 E shows the results of single-step growth curves of HSV1 Csf2 and HSV1 US11-Csf2. Vero cell monolayers were infected at an MOI of 5, and intracellular and extracellular viruses were collected and titrated at the indicated time points.

[0320] RT-qPCR of mRNA extracted from infected cells at different time points showed that the presence of the 5' leader sequence did not affect the expression kinetics of the HSV1 transcript US6 (e.g. Figure 4 F), nor did it affect transgenic transcripts expressed in cis during infection (Csf2 and GFP, Figure 4 F (middle and right) expression kinetics. Figure 4F shows the transcription levels of HSV1 endogenous genes (US6) and transgenes. More specifically, Vero cell monolayers were infected at an MOI of 5, then cells were lysed using Trizol at indicated time points, and finally mRNA abundance was quantified by RT-qPCR and normalized to Rps20. ANOVA, analysis of variance. MOI, multiplicity of infection.

[0321] To understand whether transgene-enhanced protein production might be a cell type- or species-dependent effect, the human prostate cancer line DU145 and the human renal cell carcinoma line 786-O were infected with wild-type, leader-sequence, and leader-less viruses. Monitoring of GFP fluorescence intensity in these cells during infection showed that US11 5' leader-mediated transgene protein expression was robust in all cell lines tested ( Fig.11 ). It was observed that US11 leader sequence enhancement was robust across different cell types and species. Fig.11 The experimental results of the monolayer of African green monkey kidney cell line Vero, mouse breast cancer cell line 4T1, human pancreatic cancer cell line DU145 and human renal cancer cell line 786-0 are shown, wherein the cell lines are infected with HSV1KOS without leader sequence or HSV1US11 5' leader sequence at an MOI of 0.1. The GFP fluorescence intensity was observed for 48 hours using the Incucyte live cell imaging system. These results demonstrate the ability of the US11 5' leader sequence to enhance the production of clinically relevant therapeutic transgenes in mammalian cells infected by HSV1. It will be appreciated by those skilled in the art that the above examples are by no means restrictive, and similar results will be observed if other cell lines or strains are used.

[0322] It was therefore concluded that the 5' leader sequence of the HSV1 late gene US11 was able to increase translation of the downstream cistron in a heterologous reporter construct and, notably, this effect was only observed in the presence of concurrent HSV1 infection. As previously described, HSV1 viruses engineered to express a cassette containing the US11 5' leader sequence upstream of the GM-CSF ORF conferred superior GM-CSF expression compared to their leaderless counterparts in multiple mammalian cell lines and, most importantly, resulted in improved antitumor efficacy and prolonged survival in mouse cancer models. This demonstrates that it is possible to enhance therapeutic payload expression of the oncolytic HSV1 platform by incorporating a viral 5' leader sequence into the expression transgene cassette.

[0323] The HSV1 US11 5' leader sequence increases the translation efficiency of the associated transcript in an HSV1-dependent manner

[0324] Without wishing to be bound by theory, the inventors sought to determine the potential mechanism for increased protein expression in cells infected with HSV1 US11-Csf2. To evaluate the effect of the US11 5' leader sequence on the translation of the transgenic mRNA, a polysome profiling technique was employed. Briefly, ribosome-bound mRNA was isolated by sucrose gradient ultracentrifugation, which causes the mRNA to precipitate according to the number of bound ribosomes. Thus, mRNA that migrates toward the heavier sucrose gradient has more bound ribosomes and has a higher translation efficiency. Vero cells ( Figure 5 A), the lysate containing ribosome-bound mRNA was then resolved on a 10-50% sucrose gradient ( Figure 5 B). Figure 5 A shows fluorescence and phase contrast images of HSV1-infected Vero cells used for polysome fractionation experiments in 5B and 5C, scale bar, 400 μm. Figure 5 B shows polysome traces of Vero cells infected with HSV1 Csf2 or HSV1 US11-Csf2 at an MOI of 5, where cells were lysed 24 hours after infection for polysome fractionation.

[0325] It was observed that the presence of the US11 5' leader sequence caused a shift in the distribution of Csf2-gfp transcripts toward the heavier polysomal fraction, indicating an increase in translation efficiency compared to leader-less Csf2-gfp transcripts (e.g. Figure 5 C and 5D). Figure 5 C shows the mRNA distribution in the polysomal fraction of Csf2 (shown in the upper panel) and endogenous HSV1 transcripts US6 (shown in the middle panel) and US11 (shown in the lower panel), quantified by RT-qPCR, with two-sided t-tests performed, n=3 biological replicates, and error bars indicate standard deviations. **: p<0.01, *: p<0.05. Figure 5 D shows the mRNA distribution in the untranslated fraction (sub-polysomes), poorly translated fraction (2-4 ribosomes) and highly translated fraction (>4 ribosomes) of Csf2 (as shown in the upper panel), US6 (as shown in the middle panel) and US11 (as shown in the lower panel) transcripts. Multiple unpaired t-tests were performed, with n=3 biological replicates and error bars indicating standard deviation (sd). ***: p<0.00.

[0326] Interestingly, it was observed that US6 and US11 viral mRNAs were mostly distributed to the heavier polysomal fractions (e.g. Figure 5C and 5D), indicating that despite the global cessation of protein synthesis caused by HSV1 infection, HSV1 transcripts are normally highly translated. Notably, due to the absence of the US11 5' leader sequence, translation of the transgenic Csf2-gfp mRNA is suboptimal compared to US6 and US11 viral mRNAs (e.g. Fig.12 A and 12B). Fig.12 A and 12B show that the transgenic mRNA without a leader sequence is poorly translated compared to the viral mRNA. Figure 5 In the same polysome profiling experiments described in , the mRNA distribution of US6 and US11 was compared with that of leaderless Csf2 ( Fig.12 A) or US11-Csf2 (as Fig.12 The distribution of mRNA in HSV1 infected cells was compared with that in the control cells (shown in Figure 2A). The data indicate that the traditional transgene cassette lacking cis-acting translation enhancing elements is poorly translated when compared to the HSV1 endogenous transcript. The experiment also showed that the addition of the HSV1 US11 5' leader sequence significantly improved the translation of the transgene in HSV1 infected cells.

[0327] To clarify whether the translation enhancement mediated by the US11 5' leader sequence is specific to HSV1-infected cells or is caused by a general antiviral state, GFP expression from the plasmid pTK-Csf2-gfp in Vero cells was mimicked by transfection with dsRNA poly(I:C) or infection with another virus (such as VSV). It was observed that neither poly(I:C) transfection nor VSV infection could induce GFP expression (e.g. Figure 5 E). Figure 5 E shows quantification of GFP fluorescence in Vero cells transfected with pTK-CSF2-GFP plasmid (with or without US11 leader sequence), co-transfected with poly(I:C), or transfected immediately after infection with VSV or wild-type HSV1 at an MOI of 5. Therefore, enhancement of gene expression by the US11 5' leader sequence appears to be specific to HSV1 infected cells. These data suggest that translation of conventional transgene cassettes lacking cis-acting translation enhancing elements is suboptimal when compared to HSV1 endogenous transcripts. The data also demonstrate that addition of the HSV1 US11 5' leader sequence can significantly and specifically improve translation of HSV1 encoded transgenes.

[0328] US11 5' leader sequence enhances the antitumor effect of GM-CSF-expressing HSV1 in vivo

[0329] The inventors further investigated whether enhancing the expression of the transgene beyond that achieved by the current oncolytic HSV1 platform could improve cancer outcomes. To evaluate this, the CT26 syngeneic tumor model of colon cancer was generally used to evaluate the efficacy of oncolytic HSV1. Tumors were established on both sides of the abdomen of mice, and one side of the tumor was injected with HSV1 Csf2 or HSV1 US11-Csf2 viral particles. The contralateral tumor was injected with virus resuspension buffer (such as Figure 6 A). Tumors were established on both sides of the abdomen of mice, and the tumors on one side were injected with resuspension buffer or 5x10 5 Virus particles. Figure 6 It was shown that the US11 leader sequence enhanced the antitumor effect of oncolytic HSV1 expressing GM-CSF. Figure 6 A shows a schematic diagram of the in vivo study design, where 10 ^5 CT26 cells were injected into the bilateral flanks of BALB / c mice. When the tumors reached approximately 5x5 mm, 5x10 CT26 cells were injected intratumorally twice at an interval of 2 days (day 0 and day 2). ^5 PFU of the indicated virus, and tumor size was measured every 2 days.

[0330] Analysis of injected tumors confirmed that addition of the US11 5' leader sequence enhanced intratumoral GM-CSF expression in tumors treated with HSV1US11-Csf2 ( Figure 6 B), and both viruses have similar replication kinetics in vivo, as shown by comparable transcription levels of viral genes US6 and UL30 ( Figure 6 C). This observation suggests that both viruses infect tumor cells similarly, but an increase in GM-CSF production was only observed in HSV1 US11-Csf2-infected cells. Figure 6 B shows intratumoral GM-CSF levels in tumors treated with no leader or HSV1 US11-Csf2. Tumors generated in 6A were excised one day after the second injection and homogenized in PBS, and GM-CSF levels were quantified by ELISA. Two-sided t-tests were also performed, with n=3 biological replicates and error bars indicating standard deviation (sd).

[0331] Figure 6 C shows the results of HSV1 replication in tumors, as measured by viral transcript expression levels. More specifically, RNA from tumors in 5B was extracted with Trizol, and then the mRNA abundance of the indicated transcripts was quantified by RT-qPCR and normalized to Actb. A two-tailed unpaired t-test was also performed, with n=3 biological replicates, and error bars indicate standard deviation (sd).

[0332] GM-CSF is known to be a pro-inflammatory cytokine, but it may exert anti-inflammatory properties in certain circumstances. After probing the tumor microenvironment of infected tumors by analyzing the mRNA levels of representative inflammatory genes, elevated levels of Il1b, Il6, and Tnfa mRNA were observed in tumors treated with HSV1 US11-Csf2 ( Figure 6 D). Figure 6 D shows the expression of representative inflammatory genes in injected tumors. RNA from tumors in 6B was extracted with Trizol, and the mRNA abundance of the indicated transcripts was quantified by RT-qPCR and normalized to Actb. Eight days after the first injection, systemic antitumor responses were also analyzed by IFNγ ELISPOT on splenocytes co-cultured with UV-irradiated CT26 cells. No CT-26-specific immune cell responses were found in the spleens of vehicle-treated mice, while HSV1 without a leader sequence was able to induce a certain level of CT26-specific immune cells. However, HSV1 US11-Csf2 induced significantly higher CT26-specific T cell responses compared to the virus without a leader sequence ( Figure 6 D, Fig.14 ).

[0333] Finally, the anti-tumor effects of the two viruses were directly compared ( Figure 6 E, Fig.13 As expected, HSV1-injected tumors showed reduced tumor growth relative to vehicle-injected tumors, regardless of viral clone ( Figure 6 F), a result consistent with the oncolytic and immunomodulatory properties of this viral platform. Importantly, the growth of tumors injected with the US11 5' leader virus was significantly lower than that of tumors injected with the leaderless virus ( Figure 6 F, left panel). More interestingly, treatment with the leaderless virus had no significant effect on the contralateral tumor, whereas treatment with the US11 5' leader virus significantly slowed tumor growth in the contralateral side, comparable to that observed in the treated tumor ( Figure 6 F, right); indicating that the distal effect is consistent with the increased anti-tumor immune response observed by ELISPOT. Finally, we found that the US11 5' leader sequence virus significantly improved the survival rate of mice ( Figure 6 F). Collectively, these data demonstrate that increasing GM-CSF expression by incorporation of the translation enhancing US11 5' leader sequence increases intratumoral cytokine production and enhances anticancer efficacy in preclinical colon cancer models.

[0334] This observation suggests that HSV1US11-Csf2 can induce a more inflammatory tumor microenvironment even at the same therapeutic dose and growth rate as the leaderless virus. Finally, the anti-tumor effects of the two viruses were directly compared. As expected, tumors injected with HSV1 showed reduced tumor growth relative to tumors injected with vehicle, regardless of the viral clone (Figure 2A). Figure 6 E), an observation consistent with the oncolytic and immunomodulatory properties of this viral platform. Figure 6 E shows the effect of leaderless- or HSV1 US11-Csf2 treatment on tumor growth, and the number of mice is shown in brackets. ANOVA with Sidak post hoc test was also performed, with error bars ± sd (standard deviation). Fig.13 Shows Figure 6 The size of individual tumors in E.

[0335] The growth of tumors injected with the US11 5' leader sequence virus was significantly lower than that of tumors injected with the leaderless virus (eg Figure 5 E left panel). More interestingly, treatment with the leaderless virus failed to show a significant effect on the contralateral tumor compared to vehicle, whereas treatment with the US11 5' leader virus showed slower tumor growth characteristics comparable to those observed in the ipsilateral tumor (see Figure 5A). Figure 6 E right figure); indicating the existence of distal effects. Finally, we found that the presence of the US115' leader sequence significantly increased the survival rate of mice infected with the US11 leader sequence virus, which is consistent with its excellent GM-CSF expression (as shown in Figure 2). Figure 6 F). Figure 6 F shows the results of Kaplan-Meier survival curves of mice treated with leaderless- or US11-Csf2 HSV1, with the number of mice indicated in parentheses.

[0336] Collectively, these experimental data suggest that increasing the dose of GM-CSF by incorporating the translation enhancing US11 5' leader sequence improves intratumoral cytokine production, thereby enhancing anticancer efficacy in preclinical colon cancer models.

[0337] In view of the discussion and experimental data above, it is clear that the addition of the HSV1 5' leader sequence enhances the expression of transgenic proteins downstream of the recombinant HSV1 virus. It is hypothesized that the elevated expression is mediated by increased mRNA translation of the modified transgenic transcripts and within infected cancer cells. It was also observed that oncolytic HSV1 containing a 5' leader sequence upstream of the therapeutic transgene had superior antitumor activity compared to HSV1 without a leader sequence. This approach represents a simple but highly effective way to improve the current generation of oncolytic HSV1 platforms currently in clinical trials. This strategy can also be used as a complementary technology to approaches that employ strong heterologous promoters to drive transgene expression or to insert transgenes into highly transcriptionally active regions of the HSV1 genome. As an example of the former strategy, Toda et al. found that a cassette inserted into the TK region and expressing GM-CSF driven by the CMV promoter expressed 10 5 Each Vero cell produced approximately 55 pg of GM-CSF. In this study (which also used a CMV-driven GM-CSF expression cassette inserted into the TK region of the HSV1 genome), we observed that each 10 5 Each Vero cell had 41.75 ± 2.35 pg GM-CSF, which is very close to the value reported previously (e.g. Figure 3 D. Fig.15 The value is calculated based on 167 ± 9.4 pg / ml GM-CSF observed in a 12-well plate format at confluence, which typically contains 4 x 10 5 cells). However, with the introduction of the US11 5' leader sequence, GM-CSF production increased nearly 8-fold, representing a significant improvement in transgene protein expression. It is possible that transgene production could be improved even further by combining a strong HSV1 promoter (such as the one driving HSV1 RL2 expression) with a translation enhancer (such as the US11 5' leader sequence).

[0338] It was observed that enhanced translation of Csf2 transcripts expressed from the HSV1 backbone improved antitumor efficacy in a dual-transplant flank tumor mouse cancer model. As expected, tumors treated with leaderless HSV1 progressed more slowly, and the corresponding mice also had a higher survival rate than mice that received mock treatment (e.g., Figure 6 E and 6F). However, HSV1 US11-csf2 virus not only inhibited tumor growth to a greater extent in the injected tumor, but also induced a significant inhibition of tumor growth in the contralateral tumor and improved survival. Consistently, it was observed that tumors from mice administered with US11 5' leader sequence HSV1 had higher intratumoral GM-CSF concentrations, which also correlated with upregulation of inflammatory gene markers (e.g. Figure 6B and 6D), and the spleens of treated mice showed increased levels of tumor-specific immune cells ( Figure 6 D), indicating that the tumor microenvironment has changed toward the desired inflammatory environment, which is due to the enhanced anti-tumor immune response. Since GM-CSF is shown to enhance systemic anti-tumor immune responses, the results indicate that increasing GM-CSF production may be sufficient to induce a more inflammatory tumor microenvironment in treated tumors and lead to improved systemic anti-tumor immune responses against distant tumors. Overall, the results show that although the use of a strong promoter (CMV promoter) alone does not maximize transgenic protein expression, for example, by adding a translation enhancer, the payload level can be further increased, thereby improving the efficacy of oncolytic viruses.

[0339] The following sections provide more information about the materials and how to prepare or obtain them.

[0340] Cell culture and viruses: Mouse breast cancer cell line 4T1, mouse colon carcinoma CT26, human prostate carcinoma DU145, human renal carcinoma 786-O, HEK293T and Vero cells were obtained from the American Tissue Culture Collection. 4T1 was maintained in Roswell Park Memorial Institute (RPMI) 1640 (Fisher) supplemented with 10% fetal bovine serum (FBS) (Sigma-Aldrich) and 1X penicillin / streptomycin (Fisher). HEK293T and Vero cells were maintained in Dulbecco's modified Eagle's medium (DMEM) (Fisher) supplemented with 10% FBS and 1X penicillin / streptomycin (Fisher). Cells were incubated at 37°C, 5% CO2 v / v. All HSV1 strains were propagated on Vero cells. HSV1 was inoculated into Vero cell monolayers at an MOI of 0.1 and then cultured for about 24-48 hours until a cytopathic effect close to 100% was observed. The supernatant was then collected separately, and the infected cells were frozen and thawed three times to release intracellular viruses. The culture supernatant and freeze-thaw lysate were clarified by centrifugation at 1000g for 5 minutes to remove cell debris. The supernatants were merged and filtered through a 0.45 μm filter. The supernatant was covered on a 36% sucrose cushion in PBS and centrifuged at 18,000g for 2 hours at 4°C, using a sucrose cushion to further purify the virus particles. The virus in the precipitation was resuspended in HNE buffer (HEPES10mM, NaCl 150mM, EDTA 0.1mM, pH7.2), and stored at -80°C.

[0341] RNA-Seq mapping and TSS identification: RNA-seq data of HSV1-infected 4T1 cells have been published previously. To map the RNA-seq, RNA reads were mapped to the HSV1 reference genome JQ780693.1 using HISAT262. Only one copy of the two flanking inverted repeat regions was used: the TRL region 1-8870 and the TRS region 144602-151023 were omitted. Transcription start sites (TSSs) were manually identified based on RNA read coverage, defined as a sudden increase in read coverage at a base position (e.g. Figure 2 ). The leader sequence was defined as the sequence from the TSS to the annotated start codon of the relevant HSV1 gene, excluding any spliced ​​introns if applicable. To convert the leader sequence coverage between different HSV1 reference genomes (JQ780693.1 to JN555585.1), the leader sequence identified from JQ780693.1 was aligned with JN555585.1 using NCBI-BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to find the corresponding coordinates on JN555585.1. The raw data were deposited in the Galaxy server (https: / / galaxyproject.org) and analyzed. Gene expression levels of mapped RNA-seq and Ribo-seq reads were calculated using Cuffdiff.

[0342] Plasmid construction: For leader sequence translation activity screening using the CAT reporter assay, viral leader sequences were amplified by PCR from cDNA reverse transcribed from mRNA of HSV1-infected 4T1 cells. Briefly, total RNA was extracted from cells using TRIzol reagent (Fisher), treated with the Turbo DNA-free kit (Thermo Fisher) to remove potential contamination with viral genomic DNA, and then reverse transcribed by using the iScript Advanced cDNA Synthesis Kit (BioRad). The forward and reverse primers for each leader sequence (NotI_5'UTR-F and XhoI_5'UTR-R) also contained restriction sites for NotI and XhoI, respectively, for subsequent cloning. The amplification specificity of each primer pair was confirmed by incorporating a negative control cDNA of mRNA from uninfected 4T1. The PCR amplicons were cloned into the CAT reporter plasmid pMCpA using the NotI-XhoI restriction sites. A CAT reporter construct without a leader sequence (in which only a short residual sequence from the plasmid MCS is transcribed with the CAT CDS) is used as a control (this residual sequence is also present in all viral 5' leader sequence constructs, located 5' upstream of the leader sequence). In order to insert the transgenic expression cassette into the HSV1 genome, the cassette is cloned into the pTK-Green plasmid, flanked by two regions of the HSV1TK gene to allow homologous recombination. The expression cassette consists of a leader sequence, a subsequent transgene (firefly luciferase or mouse GM-CSF), a self-cleaving peptide porcine Teschovirus-1 2A (P2A) and GFP. Inserts are generated by fusion PCR. The viral leader sequence is amplified as described above using a forward primer containing an AgeI cleavage site (AgeI_5'UTR-F) and a reverse primer with an overlapping portion of the 5' end of the transgene (5'UTR_LUC-R or 5'UTR_CSF2-R). A second fragment containing the transgenic CDS was amplified using a forward primer (5'UTR_LUC-F or 5'UTR_CSF2-F) and a reverse primer consisting of the CDS 3' end, a GSG linker and a partial P2A sequence (LUC-GSG-P2A-R). A third fragment containing GFP was amplified using a forward primer (GSG-P2A-GFP-F) and a reverse primer including the KpnI cutting side (GFP-KpnI-R). All three fragments were purified using a QIAquick PCR purification kit (Qiagen) and then used as templates for fusion PCR using the most 5' primer (AgeI_5'UTR-F) and the most 3' primer (GFP-KpnI-R). The resulting PCR product was cloned into pTK-Green using AgeI and XhoI sites. All plasmids were verified by Sanger sequencing.Leader-less LUC-GFP or CSF2-GFP constructs, in which only a short residual sequence from the plasmid MCS was transcribed together with the transgene CDS, were used as controls (this residual sequence was also present in all viral 5' leader constructs, directly 5' upstream of the leader sequence). All primer sequences are listed in Table S1.

[0343] Table S1

[0344] Table S1. Oligonucleotides used in this study (Hoang et al.)

[0345]

[0346]

[0347] CAT reporter gene assay: The CAT reporter gene assay was performed as previously described. Cells were seeded in 6-well plates at approximately 75% confluence and incubated for one day before transfection. In the case of HSV1 infection, cells were infected with HSV1 at an MOI of 5 1 hour before transfection. The CAT reporter gene plasmid was co-transfected with the β-galactosidase plasmid at 1 μg per plasmid using Lipofectamine 2000 (Thermofisher) according to the manufacturer's protocol. Cells were lysed 24 hours after transfection and CAT expression was determined using a CAT ELISA kit (Roche). β-galactosidase activity was also measured from the lysate using the o-nitrophenyl-β-galactoside (ONPG) colorimetric assay. CAT expression was normalized to β-galactosidase activity to control for transfection efficiency.

[0348] Quantitative RT-PCR: DNase-treated RNA and cDNA were prepared as described above. For RT-qPCR, SsoAdvanced Universal SYBR Green supermix (BioRad) was used with the CFX96 Touch Real-Time PCR Detection System (BioRad). PCR conditions were 3 min at 95 °C, followed by 40 cycles of 10 s at 95 °C and 30 s at 60 °C, and finally a standard melting curve cycle. Gene expression was calculated using the ΔΔCt method relative to the indicated reference genes. The list of primers used for the target genes or sequences is shown in Table S1.

[0349] Western blotting: cells were washed once with 1X PBS and then incubated with RIPA buffer (150 mM NaCl, 1.0% Cells were lysed on ice with 1% 4% lysate (1% CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, 50 mM NaF, 15 mM NaVO3, pH 8.0). The lysate was centrifuged at 10,000 g for 10 minutes at 4°C to remove cell debris. Protein concentration was determined using a DC protein assay kit (BioRad). The indicated amount of total protein was used for SDS-polyacrylamide gel electrophoresis (PAGE) using 10% SDS-polyacrylamide gel. The separated proteins were transferred to a PVDF membrane, the membrane was blocked with 5% w / v skim milk in TBS-T buffer (10 mM Tris, 50 mM NaCl, 0.1% Tween-20, pH 7.5), and then blotted for the indicated antibodies. The following antibodies and corresponding dilutions were used: 1:2000 anti-GFP (Abclonal, CAT#AE011), 1:10,000 anti-β-actin (Sigma, #A5441), 1:20,000 anti- 800CW goat anti-mouse IgG secondary antibody (LICOR, CAT#926-32210) and 1:20,000 680RD goat anti-rabbit IgG secondary antibody (LICOR, CAT#926-68071).

[0350] Live cell monitoring of GFP expression: Live cell monitoring of GFP expression was performed using the IncuCyte live cell. Sartorius was used as the monitoring system. Transfection and / or infection was performed as indicated, and then the cell plate was placed inside the IncuCyte system and cultured and monitored at 37°C, 5% CO2, with phase contrast and fluorescence images taken every 2 hours. Images were analyzed using the IncuCyte ZOOM software, with the following parameters: background subtraction using the Top-Hat method (disc-shaped structural element with a radius of 10 μm and a threshold of 1.0 green calibration unit), edge segmentation: off, hole filling: none, resizing: none, and filters: none.

[0351] Generation of recombinant HSV1 virus: To insert the expression cassette into the HSV1 genome, the TK gene was targeted for insertion as described previously. HSV1 genomic DNA was extracted from the purified virus stock using the QIAamp DNA mini kit (Qiagen). HEK293T cells were seeded in 6-well plates at 75% confluence the day before and then co-transfected with HSV1 gDNA:pTK-Green plasmid at a ratio of 1:40 using Lipofectamine 2000 (Thermo Fisher) according to the manufacturer's protocol for a total of 1 tg DNA / well. The cells were then cultured for 3-5 days until cytopathic effects were observed. The cells were then frozen and thawed three times, centrifuged at 1000g for 5 minutes to remove cell debris and the supernatant was collected. Different dilutions of the supernatant were then inoculated onto a monolayer of Vero cells to isolate single plaques covered with DMEM supplemented with 10% FBS and 1% carboxymethylcellulose (CMC) to allow the formation of single plaques. GFP positive plaques were selected and multiple rounds of plaque purification were performed until a pure population of GFP expressing HSV1 was obtained. Insertion of the cassette into the HSV1 genome was confirmed first by PCR genotyping using a forward primer on the TK gene (pTK-seq) and a reverse primer on the transgene (CSF2.eR) followed by Sanger sequencing.

[0352] Plaque titration: Virus stocks or solutions were serially diluted and then inoculated into a monolayer of Vero cells and incubated for 1 hour at 37°C, 5% CO2 with frequent shaking. The virus-containing medium was then removed and an overlay of DMEM+10% FBS+1% agar was added. The cells were then incubated at 37°C, 5% CO2 until visible plaques could be observed using a bright field microscope. Plaques were visualized and counted using crystal violet staining.

[0353] Polysome fractionation: Polysome fractionation was performed as previously described. Briefly, cells were treated with 100 tg / ml cycloheximide (CHX) (Bioshop, CAT# 66-81-9) for 5 minutes to stop ribosomes, washed three times with ice-cold PBS supplemented with CHX (100 tg / ml), and lysed using polysome lysis buffer (5 mM Tris pH 7.5, 2.5 mM MgCl2, 1.5 mM KCl, 100 tg / ml CHX, 2 mM DTT, 0.5% Triton X-100, 0.5% sodium deoxycholate) supplemented with 100 units of RNAsin ribonuclease inhibitor (Promega). Cell debris was removed by centrifugation at 14,000 g, 4°C for 10 minutes. The supernatant was then loaded onto a 10%-50% continuous sucrose gradient and centrifuged at 36,000 rpm in a SW41Ti rotor at 4°C for 90 minutes. Fractions were then collected and the OD260 absorbance of the fractions was monitored using a Brandel fraction collection system (Brandel). RNA was extracted from each fraction using TRIzol reagent (Thermo Fisher) according to the manufacturer's protocol.

[0354] GM-CSF quantification: To measure GM-CSF production from engineered HSV1 infection, cells were seeded at 80-90% confluence and then infected with the indicated HSV1 at an MOI of 5. 24 hours after infection, culture supernatants were collected and GM-CSF production was measured using a mouse GM-CSF ELISA kit (CSF2) (Abcam, CAT# ab100685) according to the manufacturer's protocol.

[0355] Single-step growth curve and monitoring of HSV1 gene expression: To monitor viral replication and viral gene transcription during the single-step growth curve, cells were seeded at 80-90% confluence and infected the next day at an MOI of 5. Cells and culture supernatants were collected at the indicated time points and subjected to virus titration by plaque assay or RNA was extracted as described above to quantify viral transcript expression.

[0356] CT26 subcutaneous tumor model: Female BALB / c were ordered from Charles River (Kingston, NY, USA). Animals were received at 5-6 weeks of age, 5 per cage, fed ad libitum, and allowed to acclimate to the facility for 2 weeks prior to experimental manipulation. For tumor implantation, 10 5 CT26 cells were injected subcutaneously into the flanks of mice. When the tumors were palpable (~5x5 mm), 50 μl DMEM or 5x10 5PFU of the indicated virus, while the tumor on the other side was not treated (contralateral). Tumor size was measured every two days using a caliper. When a humane endpoint was reached or a single tumor reached 2000mm 3 Or at an alternative humane endpoint, animals were euthanized. In vivo studies were performed single-blind: animal handlers were unaware of the treatment given to each group of mice. To assess intratumoral GM-CSF levels and HSV1 transcript abundance, tumors were excised, minced and homogenized at 20 Hz / s using 2.0 mm zirconium oxide beads (Thomas Scientific, CAT#1197P96) and TissueLyzer II (QIAGEN) in PBS buffer. Half of the homogenate was measured using a mouse GM-CSF ELISA kit (CSF2) (Abcam, CAT#ab100685) according to the manufacturer's protocol to measure mouse GM-CSF. The other half of the homogenate was subjected to RNA extraction using Trizol reagent (Thermo Fisher), and transcript mRNA was then quantified by RT-qPCR as described above.

[0357] IFNγELISPOT assay: Splenocytes were freshly isolated from mouse spleens 8 days after the first injection and cultured in RPMI (Fisher) supplemented with 10% FBS (Sigma-Aldrich) and 1X penicillin / streptomycin (Fisher). IFNγELISPOT was performed using a mouse interferon-γ ELISPOT kit (Abcam, CAT# ab64029) according to the manufacturer's protocol. Briefly, 100,000 splenocytes were co-cultured with / without 50,000 UV-irradiated CT26 in ELISPOT wells for 24 hours. The cells were then thoroughly rinsed from the wells, and IFNγ spots from stimulated T cells were generated. Individual wells were imaged using a stereomicroscope LEICA EZ4 W, and the spots were counted manually.

[0358] Data and code availability: RNA-seq data have been published previously and are available at the NCBI Gene Expression Omnibus (GEO: GSE137757) with sample IDs GSM4086602 and GSM4086610 (mRNA replication in HSV1 infection).

[0359] Statistical analysis: All experiments were performed with at least three biological replicates. Statistical analysis was performed using GraphPad Prism8 using the methods indicated in the figure legends. Error bars indicate standard error of the mean (SEM). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns, not significant.

[0360] Discussion and Analysis

[0361] The findings presented above identify cis-acting sequences in viral-based therapies that can be used to enhance transgene expression. The approach was conceptualized by first comprehensively annotating the viral 5' leader sequences through TSS identification by RNA-seq and mapping the translation efficiency of the viral genome by ribosome profiling. In this way, the TSSs of 61 / 73 genes of HSV1 were identified. During the lytic cycle, HSV1 expresses its genes in an orderly manner, divided into immediate early (IE), early (E) and late (L) genes. The main focus was on a few selected 5' leader sequences that are highly expressed in the late stages of HSV1 infection, as they may be better tuned to enhance translation in the final stages of infection (such as Figure 2 Although the present application focuses on the US11 5' leader sequence, those skilled in the art will appreciate that there may be other specific viral sequences that have potentially superior translation enhancing activity at different times of infection and that may be revealed by a more comprehensive screening of all HSV1 5' leader sequences.

[0362] Potential mechanisms for US11 5' leader-mediated translation enhancement during infection

[0363] The most widely studied viral-derived translation enhancer element is IRES, which supports cap-independent translation of viral transcripts. Viral proteins can also act in trans with the 5' leader sequence to change the translation efficiency of viral mRNA. In this regard, it has been shown that the HSV1 protein VHS can regulate the translation activity of certain host 5'UTRs and HSV1 viral sequences in a cap-independent manner. VHS is the main translation modifier protein of HSV1, and it has RNase activity on ssRNA and interacts with the translation initiation complex, thereby mediating the degradation of actively translated mRNA in infected cells. In the late stages of HSV1 infection, VHS activity is attenuated by viral proteins VP16 and VP22, allowing efficient translation of viral transcripts in a cap-dependent mode. The cap-independent translation mode adopted by the above-mentioned 5' leader sequence may bring advantages to the relevant transcripts in the early stages of HSV1 infection.

[0364] Another HSV1 translation modifier is ICP27, which is essential for the translation of viral mRNA by promoting nuclear export. ICP27 contains an RGG motif at its N-terminus that can bind to viral transcripts through a GC-rich region and link transcripts to the host nuclear export complex through interactions with the nuclear export factors REF and NXF1. Although this study was limited to the HSV1 5' leader sequence, the same strategy may be applicable to other viral vectors and OV backbones. For example, in poxviruses, a non-templated poly(A) sequence is added to the 5' leader sequence of late viral transcripts due to viral polymerase slippage, thereby promoting the translation of viral RNA, and this activity has been attributed to phosphorylation of the small ribosomal protein RACK1 by the viral kinase B160. Recently, it has been shown that the 5' leader sequence of SARS-CoV-2 sgRNA as well as the gRNA can also protect viral transcripts from translation arrest by the viral NS1 protein. Therefore, viral leader sequences are likely enriched for cis -regulatory sequences that have co-evolved with viral trans -acting protein factors to post-transcriptionally control viral gene expression but are not effectively exploited by current virus-based therapeutic applications.

[0365] Therefore, the inventors have shown that the addition of the HSV1 5' leader sequence can enhance the expression of downstream transgenic proteins of the recombinant HSV1 virus. The experiment tested intracellular transgenes (CAT, LUC, GFP) or secreted transgenes (GM-CSF), and during HSV1 infection, the addition of the US11 5' leader sequence continued to induce expression levels. This increased expression is mediated by increasing the mRNA translation of modified transgenic transcripts in infected cancer cells. Importantly, it was found that oncolytic HSV1 containing a 5' leader sequence upstream of the therapeutic transgene had superior anti-tumor activity compared to HSV1 without a leader sequence. This method represents a simple but very effective way to improve the oncolytic HSV1 platform currently in clinical trials. This strategy can be complemented by methods that use strong heterologous promoters to drive transgenic expression or methods that insert transgenes into highly transcriptionally active regions of the HSV1 genome. Although secreted cytokines were used in this study, membrane-bound transgenes can also benefit from the expression enhancement effect of the 5' leader sequence. The 5' leader sequence can also be incorporated into multiple transgene expression cassettes and inserted into multiple locations within the HSV1 genome to simultaneously enhance the expression and therapeutic effect of each transgene. As an example of the former strategy, Toda et al. found that the GM-CSF expression cassette driven by the CMV promoter and inserted in the TK region was expressed every 10 5 Each Vero cell produced approximately 55 pg of GM-CSF. In this study, a CMV-driven GM-CSF expression cassette inserted into the TK region of the HSV1 genome was also used, and the results observed were 10 541.75±2.35pg GM-CSF per Vero cell, which is very close to the value reported previously ( Fig.15 A; Calculated based on 167 ± 9.4 pg / ml GM-CSF observed in a 12-well plate format at confluence, which typically contains 4 x 10 5 cells). However, with the introduction of the US11 5' leader sequence, GM-CSF production increased nearly 8-fold, representing a significant improvement in transgene protein expression. Transgene production can be further improved by combining a strong HSV1 promoter, such as the one driving HSV1 RL2 expression, with translational enhancers found in the viral 5' leader sequence as well as in the viral 3' UTR. Furthermore, minimal translational enhancement motifs specific for HSV1 infection may provide a lower risk of recombination than full-length 5' leader sequences, particularly if applied to new generation oncolytic HSV1 encoding multiple therapeutic transgenes.

[0366] The present invention has been described in terms of one or more embodiments, however, it will be apparent to those skilled in the art that numerous variations and modifications may be made without departing from the scope of the invention as defined in the claims.

[0367] All citations and / or references cited herein are hereby incorporated by reference in their entirety.

[0368] References

[0369] 1. Rauch, S., Jasny, E., Schmidt, KE & Petsch, B. New vaccine technologies to combat outbreak situations. Front. Immunol. 9, 1963 (2018).

[0370] 2. Macedo, N., Miller, DM, Haq, R. & Kaufman, HLClinical landscape of oncolytic virus research in 2020. Journal for ImmunoTherapy of Cancer 8, 1486 (2020).

[0371] 3.Bulcha,J.T.,Wang,Y.,Ma,H.,Tai,P.W.L.&Gao,G.Viral vector platformswithin the gene therapy landscape.Signal Transduct.Target.Ther.2021 61 6,1–24(2021).

[0372] 4.Serafini,P.et al.High-dose granulocyte-macrophage colony-stimulating factor-producing vaccines impair the immune response through therecruitment of myeloid suppressor cells.Cancer Res.64,6337–6343(2004).

[0373] 5.Conner,J.&Braidwood,L.Expression of inhibitor of growth 4by HSV1716improves oncolytic potency and enhances efficacy.Cancer Gene Ther.19,499–507(2012).

[0374] 6.Pearl,T.M.,Markert,J.M.,Cassady,K.A.&Ghonime,M.G.Oncolytic Virus-Based Cytokine Expression to Improve Immune Activity in Brain and SolidTumors.Molecular Therapy-Oncolytics 13,14–21(2019).

[0375] 7.Zhang,Q.&Liu,F.Advances and potential pitfalls of oncolytic virusesexpressing immunomodulatory transgene therapy for malignant gliomas.CellDeath and Disease 11,1–11(2020).

[0376] 8.Zheng,M.,Huang,J.,Tong,A.&Yang,H.Oncolytic Viruses for CancerTherapy:Barriers and Recent Advances.Molecular Therapy-Oncolytics 15,234–247(2019).

[0377] 9.Cripe,T.P.et al.Pediatric cancer gone viral.Part I:Strategies forutilizing oncolytic herpes simplex virus-1in children.Molecular Therapy-Oncolytics2,15015(2015).

[0378] 10.Walsh,D.&Mohr,I.Viral subversion of the host protein synthesismachinery.Nat Rev Microbiol 9,860–875(2011).

[0379] 11.Hoang,H.-D.,Graber,T.E.&Alain,T.Battling for Ribosomes:Translational Control at the Forefront of the Antiviral Response.J.Mol.Biol.(2018).doi:10.1016 / j.jmb.2018.04.040

[0380] 12.Hu,J.C.C.et al.A phase I study of OncoVEXGM-CSF,a second-generation oncolytic herpes simplex virus expressing granulocyte macrophagecolony-stimulating factor.Clin.Cancer Res.12,6737–6747(2006).

[0381] 13.Breitbach,C.J.et al.Intravenous delivery of a multi-mechanisticcancer-targeted oncolytic poxvirus in humans.Nat.2011 4777362 477,99–102(2011).

[0382] 14.Dhungel,P.,Cao,S.&Yang,Z.The 5’-poly(A)leader of poxvirus mRNAconfers a translational advantage that can be achieved in cells with impairedcap-dependent translation.PLoS Pathog.13,e1006602(2017).

[0383] 15.Jha,S.et al.Trans-kingdom mimicry underlies ribosome customizationby a poxvirus kinase.Nature 546,651–655(2017).

[0384] 16.Mears,W.E.&Rice,S.A.The RGG box motif of the herpes simplex virusICP27 protein mediates an RNA-binding activity and determines in vivomethylation.J.Virol.70,(1996).

[0385] 17.Sandri-Goldin,R.M.ICP27 mediates HSV RNA export by shuttlingthrough a leucine-rich nuclear export signal and binding viral intronlessRNAs through an RGG motif.Genes Dev.12,868–79(1998).

[0386] 18.Rivera,A.A.et al.Mode of transgene expression after fusion toearly or late viral genes of a conditionally replicating adenovirus via anoptimized internal ribosome entry site in vitro and in vivo.Virology 320,121–134(2004).

[0387] 19.Bommareddy,P.K.,Peters,C.,Saha,D.,Rabkin,S.D.&Kaufman,H.L.Oncolytic Herpes Simplex Viruses as a Paradigm for the Treatment ofCancer.Annu.Rev.Cancer Biol 2,155–173(2018).

[0388] 20.Huang,C.J.&Wagner,E.K.The herpes simplex virus type 1 major capsidprotein(VP5-UL19)promoter contains two cis-acting elements influencing lateexpression.J.Virol.68,5738–5747(1994).

[0389] 21.Steffy,K.R.&Weir,J.P.Upstream promoter elements of the herpessimplex virus type 1 glycoprotein H gene.J.Virol.65,972–975(1991).

[0390] 22.Pederson,N.E.,Person,S.&Homa,F.L.Analysis of the gB promoter ofherpes simplex virus type 1:high-level expression requires both an89-base-pair promoter fragment and a nontranslated leader sequence.J.Virol.66,(1992).

[0391] 23.Goodart,S.A.,Guzowski,J.F.,Rice,M.K.&Wagner,E.K.Effect of genomiclocation on expression of beta-galactosidase mRNA controlled by the herpessimplex virus type 1 UL38 promoter.J.Virol.66,2973–2981(1992).

[0392] 24.Mavromara-Nazos,P.&Roizman,B.Delineation of regulatory domains ofearly(β)and late(γ2)genes by construction of chimeric genes expressed inherpes simplex virus 1 genomes.Proc.Natl.Acad.Sci.U.S.A.86,4071–4075(1989).

[0393] 25.Rixon,F.J.&Clements,J.B.Detailed structural analysis of twospliced HSV-1 immediate-early mRNAs.Nucleic Acids Res.10,2241–2256(1982).

[0394] 26.Greco,A.et al.The DNA sequence coding for the 5’untranslatedregion of herpes simplex virus type 1 ICP22 mRNA mediates a high level ofgene expression.J.Gen.Virol.75,1693–1702(1994).

[0395] 27.Hoang,H.D.et al.Induction of an Alternative mRNA 5′Leader EnhancesTranslation of the Ciliopathy Gene Inpp5e and Resistance to Oncolytic VirusInfection.Cell Rep.29,4010-4023.e5(2019).

[0396] 28.Tang,S.,Patel,A.&Krause,P.R.Hidden regulation of herpes simplexvirus 1 pre-mRNA splicing and polyadenylation by virally encoded immediateearly gene ICP27.PLOS Pathog.15,e1007884(2019).

[0397] 29.Tombácz,D.et al.Long-Read Isoform Sequencing Reveals a HiddenComplexity of the Transcriptional Landscape ofHerpes Simplex Virus Type1.Front.Microbiol.8,1079(2017).

[0398] 30.Tombácz,D.et al.Multiple Long-Read Sequencing Survey of HerpesSimplex Virus Dynamic Transcriptome.Front.Genet.10,834(2019).

[0399] 31.Whisnant,A.W.et al.Integrative functional genomics decodes herpessimplex virus 1.Nat.Commun.11,1–14(2020).

[0400] 32.Rutkowski,A.J.et al.Widespread disruption of host transcriptiontermination in HSV-1 infection.Nat.Commun.6,7126(2015).

[0401] 33.Zhao,T.T.et al.hnRNP A1 regulates UV-induced NF-κB signallingthrough destabilization of cIAP1 mRNA.Cell Death Differ.16,244–252(2009).

[0402] 34.Tang,S.,Patel,A.&Krause,P.R.Herpes simplex virus ICP27 regulatesalternative pre-mRNA polyadenylation and splicing in a sequence-dependent manner.Proc.Natl.Acad.Sci.U.S.A.113,12256–12561(2016).

[0403] 35.Minaker,R.L.,Mossman,K.L.&Smiley,J.R.Functional inaccessibility ofquiescent herpes simplex virus genomes.Virol.J.2,(2005).

[0404] 36.Donnelly,M.L.L.et al.Analysis of the aphthovirus 2A / 2B polyprotein‘cleavage’mechanism indicates not a proteolytic reaction,but a noveltranslational effect:A putative ribosomal‘skip’.J.Gen.Virol.82,1013–1025(2001).

[0405] 37.Kim,J.H.et al.High cleavage efficiency of a 2A peptide derivedfrom porcine teschovirus-1 in human cell lines,zebrafish and mice.PLoS One 6,(2011).

[0406] 38.Pol,J.,Kroemer,G.&Galluzzi,L.First oncolytic virus approved formelanoma immunotherapy.Oncoimmunology 5,(2016).

[0407] 39.Malhotra,S.et al.Use of an oncolytic virus secreting GM-CSF ascombined oncolytic and immunotherapy for treatment of colorectal and hepaticadenocarcinomas.Surgery 141,520–529(2007).

[0408] 40.Moesta,A.K.et al.Local delivery of OncoVEXmGM-CSF generatessystemic antitumor immune responses enhanced by cytotoxic T-lymphocyte–associated protein blockade.Clin.Cancer Res.23,6190–6202(2017).

[0409] 41.Bhattacharya,P.et al.Dual Role of GM-CSF as a Pro-Inflammatory anda Regulatory Cytokine:Implications for Immune Therapy.J.Interf.CytokineRes.35,585(2015).

[0410] 42.Kim,K.J.et al.Antitumor effects of IL-12 and GM-CSF co-expressedin an engineered oncolytic HSV-1.Gene Ther.1–13(2020).doi:10.1038 / s41434-020-00205-x

[0411] 43.Toda,M.,Martuza,R.L.&Rabkin,S.D.Tumor growth inhibition byintratumoral inoculation of defective herpes simplex virus vectors expressinggranulocyte–Macrophage colony-stimulating factor.Mol.Ther.2,324–329(2000).

[0412] 44.Thomas,S.et al.Development of a new fusion-enhanced oncolyticimmunotherapy platform based on herpes simplex virus type1.J.Immunother.Cancer 7,214(2019).

[0413] 45.Yan,W.L.,Shen,K.Y.,Tien,C.Y.,Chen,Y.A.&Liu,S.J.Recent progress inGM-CSF-based cancer immunotherapy.Immunotherapy 9,347–360(2017).

[0414] 46.Honess,R.W.&Roizman,B.Regulation ofHerpesvirus MacromolecularSynthesis I.Cascade Regulation of the Synthesis of Three Groups of ViralProteins 1.J.Virol.14,8–19(1974).

[0415] 47.Lee,K.M.,Chen,C.J.&Shih,S.R.Regulation Mechanisms of Viral IRES-Driven Translation.Trends in Microbiology 25,546–561(2017).

[0416] 48.Mailliot,J.&Martin,F.Viral internal ribosomal entry sites:fourclasses for one goal.Wiley Interdiscip.Rev.RNA 9,e1458(2018).

[0417] 49.Dauber,B.,Saffran,H.A.&Smiley,J.R.The Herpes Simplex Virus 1VirionHost Shutoff Protein Enhances Translation of Viral Late mRNAs by PreventingmRNA Overload.J.Virol.88,9624–9632(2014).

[0418] 50.Saffran,H.A.,Read,G.S.&Smiley,J.R.Evidence for TranslationalRegulation by the Herpes Simplex Virus Virion Host ShutoffProtein.J.Virol.84,6041–6049(2010).

[0419] 51.Doepker,R.C.,Hsu,W.-L.,Saffran,H.A.&Smiley,J.R.Herpes SimplexVirus Virion Host Shutoff Protein Is Stimulated by Translation InitiationFactors eIF4B and eIF4H.J.Virol.78,4684–4699(2004).

[0420] 52.Feng,P.,Everly,D.N.&Read,G.S.mRNA Decay during Herpes SimplexVirus(HSV)Infections:Protein-Protein Interactions Involving the HSV VirionHost Shutoff Protein and Translation Factors eIF4H and eIF4A.J.Virol.79,9651–9664(2005).

[0421] 53.Taddeo,B.,Zhang,W.&Roizman,B.The virion-packaged endoribonucleaseof herpes simplex virus 1 cleaves mRNA in polyribosomes.Proc.Natl.Acad.Sci.U.S.A.106,12139–12144(2009).

[0422] 54.Taddeo,B.,Sciortino,M.T.,Zhang,W.&Roizman,B.Interaction of herpessimplex virus RNase with VP16 and VP22 is required for the accumulation ofthe protein but not for accumulation of mRNA.Proc.Natl.Acad.Sci.U.S.A.104,12163–12168(2007).

[0423] 55.Corbin-Lickfett,K.A.,Chen,I.H.B.,Cocco,M.J.&Sandri-Goldin,R.M.TheHSV-1 ICP27 RGG box specifically binds flexible,GC-rich sequences but not G-quartet structures.Nucleic Acids Res.37,7290–7301(2009).

[0424] 56.Chen,I.-H.B.,Li,L.,Silva,L.&Sandri-Goldin,R.M.ICP27 Recruits Aly / REF but Not TAP / NXF1 to Herpes Simplex Virus Type 1 Transcription Sitesalthough TAP / NXF1 Is Required for ICP27 Export.J.Virol.79,3949–3961(2005).

[0425] 57.Koffa,M.D.et al.Herpes simplex virus ICP27 protein provides viralmRNAs with access to the cellular mRNA export pathway.EMBO J.20,5769–5778(2001).

[0426] 58.Schwer,B.,Visca,P.,Vos,J.C.&Stunnenberg,H.G.Discontinuoustranscription or RNA processing of vaccinia virus late messengers results ina5′poly(A)leader.Cell 50,163–169(1987).

[0427] 59.Shirokikh,N.E.&Spirin,A.S.Poly(A)leader of eukaryotic mRNAbypasses the dependence of translation on initiation factors.Proc.Natl.Acad.Sci.U.S.A.105,10738–10743(2008).

[0428] 60.Jha,S.et al.Trans-kingdom mimicry underlies ribosome customizationby a poxvirus kinase.Nature 546,651–655(2017).

[0429] 61.Finkel,Y.et al.SARS-CoV-2 utilizes a multipronged strategy tosuppress host 2 protein synthesis Introduction.bioRxiv 2020.11.25.398578(2020).doi:10.1101 / 2020.11.25.398578

[0430] 62.Kim,D.,Langmead,B.&Salzberg,S.L.HISAT:A fast spliced aligner withlow memory requirements.Nat.Methods 12,357–360(2015).

[0431] 63.Afgan,E.et al.The Galaxy platform for accessible,reproducible andcollaborative biomedical analyses:2018 update.Nucleic Acids Res.46,W537–W544(2018).

[0432] 64.Trapnell,C.et al.Transcript assembly and quantification by RNA-Seqreveals unannotated transcripts and isoform switching during cell differentiation.Nat.Biotechnol.28,511–515(2010).

[0433] 65.Graber,T.E.,Baird,S.D.,Kao,P.N.,Mathews,M.B.&Holcik,M.NF45functions as an IRES trans-acting factor that is required for translation ofcIAP1 during the unfolded protein response.Cell Death Differ.17,719–29(2010).

[0434] 66.Gandin,V.et al.Polysome fractionation and analysis of mammaliantranslatomes on a genome-wide scale.J.Vis.Exp.1–9(2014).doi:10.3791 / 51455y.

Claims

1. A nucleic acid comprising: a) SEQ ID NO: 1 or a fragment thereof comprising at least 180 nucleotides or a sequence at least 90% identical to SEQ ID NO: 1; in, The nucleic acid does not comprise SEQ ID NO: 2, SEQ ID NO: 3 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO: 2, 3 or both, wherein the fragment of SEQ ID NO: 2, 3 or both is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases thereof immediately contiguous with the 5' or 3' end of SEQ ID NO: 1; or b) SEQ ID NO: 7 or a fragment thereof comprising at least 180 nucleotides or a sequence at least 90% identical to SEQ ID NO: 7; wherein the nucleic acid does not comprise SEQ ID NO:8, SEQ ID NO:9 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:8, 9 or both, said fragment of SEQ ID NO:8, 9 or both being at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases thereof immediately contiguous with the 5' or 3' end of SEQ ID NO:7; or c) SEQ ID NO: 13 or a fragment thereof comprising at least 180 nucleotides or a sequence at least 90% identical to SEQ ID NO: 13; wherein the nucleic acid does not comprise SEQ ID NO: 14, SEQ ID NO: 15 or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO: 14, 15 or both, said fragment of SEQ ID NO: 14, 15 or both being at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases thereof immediately contiguous with the 5' or 3' end of SEQ ID NO: 13; or d) the RNA counterpart of a); or e) the RNA counterpart of b); or f) RNA counterpart of c).

2. The nucleotide sequence according to claim 1, in, The nucleic acid does not comprise at least 250, 500, 1000 or more consecutive nucleotides of the complete genome of human herpesvirus 1 strain KOS or a sequence that is 95% identical thereto, the complete genome being defined by NCBI Accession No.: JQ673480.1GI:380776962 or Accession No. JQ780693.1GI:384597744.

3. A second nucleic acid consisting of the nucleic acid of claim 1. The nucleic acid according to claim 1 , which is a synthetic or recombinant nucleic acid. The nucleic acid according to claim 1 , which is an expression vector or a plasmid.

6. The nucleic acid according to claim 5, in, The expression vector or plasmid drives the production of a protein of interest that is heterologous to HSV1.

7. The nucleic acid according to claim 1, further comprising a promoter, a nucleotide sequence encoding a target protein, one or more regulatory sequences, one or more restriction endonucleases or cloning sites, one or more polyadenylation sites or any combination thereof, in, At least one or more of the promoter, the nucleotide sequence encoding the target protein, one or more restriction endonucleases or cloning sites, one or more polyadenylation sites, or any combination thereof are heterologous to HSV1.

8. The nucleic acid according to claim 7, in, The promoter is located upstream or 5' of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or the RNA counterpart thereof.

9. The nucleic acid according to claim 7, in, The nucleotide sequence encoding the protein of interest is located downstream or 3' of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart.

10. The nucleic acid according to claim 7, in, The promoter is located immediately upstream of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart, and the nucleotide sequence encoding the target protein is located immediately downstream of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart.

11. The nucleic acid according to any one of claims 1 to 10, in, The nucleotide sequence is circular or linear.

12. An RNA nucleic acid defined by the counterpart of the nucleic acid of claim 1.

13. The nucleic acid according to claim 7, in, SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13 or their RNA counterparts increase translation of the nucleotide sequence encoding the target protein in the cell compared to the translation in the absence of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13 or their RNA counterparts, wherein the increased translation occurs only when the cell is previously infected with the HSV1 virus.

14. The nucleic acid according to claim 7, in, The target protein is a reporter protein, a cell regulatory protein or a cytotoxic protein.

15. A carrier comprising: a) SEQ ID NO: 1 or a fragment thereof comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 1; or b) SEQ ID NO: 7 or a fragment thereof comprising at least 180 nucleotides, or a sequence that is at least 90% identical to SEQ ID NO: 7; or c) SEQ ID NO: 13 or a fragment thereof comprising at least 180 nucleotides, or a sequence that is at least 90% identical to SEQ ID NO: 13; or d) the RNA counterpart of a); or e) the RNA counterpart of b); or f) the RNA counterpart of c); as well as A promoter, a nucleotide sequence encoding a target protein, one or more regulatory sequences, one or more restriction endonucleases or cloning sites and one or more polyadenylation sites or any combination thereof.

16. The vector according to claim 15, in, The vector is a viral vector transformed with heterologous nucleic acid, and the heterologous nucleic acid comprises: a) SEQ ID NO: 1 or a fragment thereof comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 1; b) SEQ ID NO: 7 or a fragment thereof comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 7; c) SEQ ID NO: 13 or a fragment thereof comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 13; d) the RNA counterpart of a); e) the RNA counterpart of b), or f) the RNA counterpart of c); as well as A promoter, a nucleotide sequence encoding a target protein, one or more regulatory sequences, one or more restriction endonucleases or cloning sites and one or more polyadenylation sites or any combination thereof.

17. The viral vector according to claim 16, in, At least one of the following is heterologous to the viral vector: SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13, a fragment thereof or its RNA counterpart, a sequence at least 90% identical to SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or a fragment thereof comprising at least 180 nucleotides, the promoter, the nucleotide sequence encoding the protein of interest, the one or more regulatory sequences, the one or more restriction endonucleases or cloning sites, the one or more polyadenylation sites or any combination thereof.

18. The viral vector according to claim 16, in, The vector is live, attenuated, oncolytic, or any combination thereof. The viral vector according to claim 16 , which is an HSV1 viral vector.

20. The viral vector according to claim 19, in, The HSV1 viral vector is HSV1.

21. A cell comprising the nucleic acid of any one of claims 1-14, or the vector of any one of claims 15-20.

22. The cell according to claim 21, in, The cells are mammalian cells infected with the HSV1 virus.

23. The cell according to claim 22, in, The mammalian cell is a cancer cell infected by the HSV1 virus.

24. The cell according to claim 21, in, The cells exhibit an increase in protein expression, synthesis or production of more than about 0.5-fold, about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold or more when infected with the HSV1 virus, compared to the same control cells lacking the nucleic acid.

25. The nucleic acid according to any one of claims 1 to 14 or the vector according to any one of claims 15 to 20, or the cell according to claims 21 to 24, in, The nucleic acid is inserted at any position in HSV1.

26. The nucleic acid according to any one of claims 1 to 14 or the vector according to any one of claims 15 to 20, or the cell according to claims 21 to 24, in, The nucleic acid is inserted into any restriction site or tk locus of HSV1.

27. A composition comprising: A nucleic acid according to any one of claims 1 to 14, a vector according to any one of claims 15 to 20, or a cell according to any one of claims 21 to 24, alone or in combination, and; Optionally, one or more pharmaceutically acceptable carriers, excipients or diluents are included.

28. A kit comprising: a) a nucleic acid according to any one of claims 1 to 14, b) the vector according to any one of claims 15 to 20, c) the cell of any one of claims 21 to 24, d) one or more pharmaceutically acceptable carriers, excipients or diluents, e) one or more buffers, detergents or cell culture media, f) one or more containers for containing a)-e), g) instructions for expressing a target protein or enhancing the expression of a target protein; h) instructions for use of any component of the kit, Or any combination of a)-h).

29. A method for producing a target protein in a cell, include: A nucleic acid is administered to cells previously infected with HSV1 virus, wherein the nucleic acid comprises a) a promoter, b) SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart, and c) a sequence encoding a protein of interest expressed by the nucleic acid in the cells.

30. A method for increasing the expression, synthesis or production of a target protein in a cell, include: administering to the cell previously infected with HSV1 virus a nucleic acid comprising a) a promoter; b) SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart; and c) a sequence encoding a protein of interest expressed by the nucleic acid in the cell, Wherein, the increase in expression, synthesis or production of the protein of interest is relative to a similar procedure in which the nucleic acid is administered in the absence of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart.

31. The method according to claim 30, in, The promoter is located upstream or 5' of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart, and the sequence encoding the protein of interest is located downstream or 3' of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart.

32. The method according to claim 30, in, The promoter is located immediately upstream of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart, and the sequence encoding the protein of interest is located immediately downstream of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart.

33. The method according to claim 30, in, The nucleic acid is present in HSV1 and the cell is infected with the HSV1 virus.

34. The method according to claim 30, in, The nucleic acid is located in a plasmid or a vector.

35. The method according to claim 34, in, The vector is selected from a viral vector, a live viral vector, an oncolytic viral vector, an attenuated viral vector, a recombinant vector or an amplicon vector.

36. A method of improving or treating a medical condition, cellular defect or disease in a subject, include: Administering a nucleic acid to a cell of a subject in need thereof, wherein the cell is previously infected with the HSV1 virus; the nucleic acid comprises: a) a promoter, b) SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart, and c) a sequence encoding a protein of interest expressed by the nucleic acid in the cell, wherein the protein of interest improves or treats a medical condition, cellular defect or disease in the subject; wherein the expression, synthesis or production of the protein of interest in the cells of the subject improves or treats a medical condition, cellular defect or disease in the subject.

37. The method according to claim 36, in, The promoter is located upstream or 5' of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart, and the sequence encoding the protein of interest is located downstream or 3' of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart.

38. The method according to claim 36, in, The promoter is located immediately upstream of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart, and the sequence encoding the protein of interest is located immediately downstream of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart.

39. The method according to claim 36, in, The nucleic acid is in HSV1.

40. The method according to claim 39, in, The HSV1 is a live virus vector, an oncolytic virus vector or an attenuated virus vector.

41. A method of treating cancer in a subject, include: Administering a nucleic acid to cells of a patient in need thereof, wherein the cells are previously infected with HSV1 virus, the nucleic acid comprising a) a promoter, b) SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart and a sequence encoding a protein of interest expressed by the nucleic acid in the cells, wherein the protein of interest is capable of treating cancer in the subject; wherein the expression, synthesis or production of the protein of interest in the cells of the patient treats the cancer condition.

42. The method according to claim 41, in, The cancer is melanoma.

43. A method for improving the efficacy of existing gene therapy, include: Modifying a gene delivery vehicle used in an existing gene therapy by inserting a sequence of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13, or its RNA counterpart, wherein the gene delivery vehicle comprises a sequence encoding a protein of interest; administering the modified gene delivery vehicle to a patient in need thereof; wherein the patient is previously infected with HSV1 virus; Wherein, the transcription of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13 or its RNA counterpart increases the translation of the sequence encoding the target protein, thereby resulting in increased expression, production or synthesis of the target protein relative to the expression, production or synthesis of the target protein in the absence of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13 or its RNA counterpart, thereby improving the efficacy of the gene therapy.

44. The method according to claim 43, in, The expression, production or synthesis of the target protein is increased several fold compared to the expression, production or synthesis in the absence of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart.

45. The method according to claim 44, in, The increase in expression, production or synthesis of the target protein is 0.5-fold, 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold or more.

46. ​​The method according to claim 43, in, The existing gene therapy is oncolytic virus therapy.

47. The method according to claim 43, in, The existing gene therapy is a gene-based immunotherapy.

48. A method for increasing transgene expression in a cell: administering a nucleic acid to the cell, in, The cell is previously infected with HSV1 virus, the nucleic acid comprises a) a promoter, b) SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13 or its RNA counterpart, and c) a transgene expressed by the nucleic acid in the cell, wherein the transgene encodes a protein of interest; wherein the increase in expression of the transgene is relative to a similar procedure in which the nucleic acid is administered in the absence of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13, or its RNA counterpart.

Images