Antibody specifically combined with thiamethoxam and application thereof
The obtained anti-thiamethoxam single-chain antibody gene was screened to construct an expression plasmid and express it in E. coli, which solved the problem of complex and difficult to overcome animal source interference by existing antibody preparation methods, achieved simple, low-cost and efficient production of anti-thiamethoxam antibodies, and provided a fast and simple detection method for thiamethoxam residue in food.
Patent Information
- Application Number
- CN202510224494.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-27
- Publication Date
- 2025-06-10
AI Technical Summary
The existing preparation methods for anti-thiamethoxam single-chain antibodies are complex, the production process is cumbersome, and it is difficult to overcome the interference of animal sources, making it difficult to achieve rapid and simple detection of thiamethoxam residues in food.
Through multiple immunized mouse splenocyte RNA sequence amplification and phage library screening, a highly specific anti-thiamethoxam single-chain antibody sequence gene was obtained, and the pET-28a-TMX expression plasmid was constructed. E. coli expression was used and purified using Ni-NTA affinity column to achieve stable large-scale production of antibodies.
Simple preparation, low-cost production and efficient purification of anti-thiamethoxam antibodies are achieved, providing a fast and simple method for the detection of thiamethoxam residues in food, with a linear range of detection ranging from 8.13-137.97 ng/mL and a minimum detection limit of 3.43 ng/mL.
Smart Images

Figure CN120118191A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering antibodies and relates to a variable region sequence of a thiamethoxam antibody and its application. Background Art
[0002] Thiamethoxam (TMX) belongs to a class of neonicotinoid pesticides. It mainly acts as an agonist of the insect nicotinic acetylcholine receptor, affecting the central nervous system of insects and causing their paralysis and death. Due to its effectiveness against a variety of pests, it is widely used in agriculture. However, its persistence in soil and water has led more and more researchers to investigate its impact on non-target organisms and food safety. Currently, the general trend is for stricter regulation and restriction of it to reduce its impact on the environment and non-target organisms.
[0003] For the determination of thiamethoxam residues in food matrices and biological matrices, large-scale instrument methods such as high-performance liquid chromatography and liquid chromatography-mass spectrometry are generally used. However, these methods require expensive large-scale instruments and complex sample pretreatment processes, and many operations can currently only be completed by technicians with long-term training. Therefore, it is difficult to achieve on-site rapid analysis and detection. The preparation of antibodies is the core key to realizing rapid immunoassay. Traditional antibodies include monoclonal and polyclonal antibodies. Although monoclonal antibodies have strong homogeneity and consistency, the production process is relatively cumbersome. It is also difficult to overcome the interference of animal sources using traditional methods for antibody preparation. Compared with traditional antibodies, single-chain antibodies also have the characteristics of small size, low production cost, and easy expression. Therefore, there is an urgent need to develop a simple-to-prepare, low-cost, and low-detection-limit anti-thiamethoxam single-chain antibody that can be combined with the enzyme-linked immunosorbent assay method to provide a rapid and simple method for the determination of thiamethoxam residues in food. Summary of the Invention
[0004] Aiming at the deficiencies of the above-mentioned prior art, the present invention provides an anti-thiamethoxam single-chain antibody with simple preparation, low cost, and low detection limit, aiming to solve the technical problems that the existing preparation method of the anti-thiamethoxam single-chain antibody is complex, the production process is relatively cumbersome, and it is also difficult to overcome the interference of animal sources.
[0005] The first technical solution provided by the present invention is a thiamethoxam antibody, which comprises a heavy chain variable region and a light chain variable region. The heavy chain variable region has heavy chain CDRs composed of HCDR1, HCDR2, and HCDR3, and the light chain variable region has light chain CDRs composed of LCDR1, LCDR2, and LCDR3. The amino acid sequence of HCDR1 is GFSLTSYG, the amino acid sequence of HCDR2 is IWAGGST, the amino acid sequence of HCDR3 is ARNWGSYWYFDV, the amino acid sequence of LCDR1 is SSVSY, the amino acid sequence of LCDR2 is LTS, and the amino acid sequence of LCDR3 is QQRSSYPLT.
[0006] In some embodiments, the amino acid sequences of the light chain variable region and the heavy chain variable region are as shown in SEQ ID NO.6 and SEQ ID NO.7, respectively.
[0007] The second technical solution provided by the present invention is a gene encoding the antibody of the first technical solution.
[0008] The third technical solution provided by the present invention is a recombinant vector carrying the gene of the second technical solution.
[0009] In some embodiments, the recombinant expression vector uses plasmid pET-28a as the expression vector.
[0010] The fourth technical solution provided by the present invention is a recombinant cell expressing the antibody of the first technical solution, or containing the gene of the second technical solution, or transformed with the recombinant vector of the third technical solution.
[0011] In some technical solutions, the host of the recombinant cell is an animal cell, a plant cell or a microbial cell.
[0012] In some embodiments, the microbial cells include fungi and bacteria.
[0013] In some embodiments, the bacteria include Escherichia coli.
[0014] The fifth technical solution provided by the present invention is a detection reagent product, which contains the antibody of the first technical solution.
[0015] In some embodiments, the product includes test strips and reagent kits.
[0016] The sixth technical solution provided by the present invention is a method for detecting thiamethoxam, which uses the antibody of the first technical solution to determine thiamethoxam by enzyme-linked immunosorbent assay.
[0017] The seventh technical solution provided by the present invention is the application of the antibody described in the first technical solution, or the gene described in the second technical solution, or the recombinant vector described in the third technical solution, or the recombinant cell described in the fourth technical solution in detecting thiamethoxam.
[0018] The technical effects of the present invention are as follows:
[0019] (1) The heavy chain variable region and light chain variable region sequences of the thiamethoxam single-chain antibody disclosed in the present invention are derived from a highly specific anti-thiamethoxam single-chain antibody sequence gene obtained by amplifying the RNA sequence of immunized mouse spleen cells multiple times and constructing and screening a phage library. This sequence gene was used to construct the pET-28a-TMX expression plasmid, and the recombinant antibody was expressed using Escherichia coli and purified using a Ni-NTA affinity column, enabling the large-scale and stable production of the anti-thiamethoxam antibody and providing a reliable core reagent for various immunoassay methods for thiamethoxam residue detection.
[0020] (2) The thiamethoxam antibody provided by the present invention does not require animal immunization during subsequent preparation, and the preparation method is simple and inexpensive.
[0021] (3) The thiamethoxam recombinant antibody expressed in the present invention can be genetically modified according to experimental purposes and is widely used in the rapid preparation of antibodies for other targets.
[0022] (4) The kit prepared with the thiamethoxam recombinant antibody of the present invention has a detection linear range (IC 20 -IC 80 ) of 8.13 - 137.97 ng / mL, and the lowest detection limit IC 10 is 3.43 ng / mL. Description of the Drawings
[0023] Figure 1 For the verification of thiamethoxam hapten and artificial antigen, where: A: Fourier transform infrared spectrum of thiamethoxam hapten; B: UV scanning spectrum of immunogenic antigen TMX-BSA; C: UV scanning spectrum of coated antigen TMX-OVA.
[0024] Figure 2 For the verification result of the titer of mouse antiserum after booster immunization with TMX-BSA.
[0025] Figure 3 For the recombinant phagemid construction process, where: A: Agarose gel electrophoresis pattern of total RNA from immunized mouse spleen; B: Agarose gel electrophoresis pattern of cDNA amplified antibody variable region gene; C: Agarose gel electrophoresis pattern of assembled scFv; D: Double digestion and recombinant agarose gel electrophoresis pattern of pCANTAB-5E plasmid and scFv, where lane 1: scFv after digestion, lane 2: pCANTAB-5E plasmid after digestion, lane 3: recombinant phagemid.
[0026] Figure 4 For the identification of recombinant phagemid colonies by colony PCR, lanes 1-20 represent different colonies respectively.
[0027] Figure 5 It is a plate for the titration determination of the primary antibody library capacity.
[0028] Figure 6 It is the result of phage-ELISA verification.
[0029] Figure 7 It is an SDS-PAGE electrophoresis diagram related to the expression of TMX-scFv. Lane 1 represents the bacterial cell precipitate, lanes 2-5 represent the washing solution, and lanes 6-10 represent the antibody after elution.
[0030] Figure 8 It is the ic-ELISA inhibition curve of the TMX-scFv antibody.
[0031] Figure 9 It is the ic-ELISA standard curve of the TMX-scFv antibody. Detailed implementation manners
[0032] The following are the preferred embodiments of the present invention. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.
[0033] In the present disclosure, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. And the terms and laboratory operation steps related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are all widely used terms and conventional steps in the corresponding fields.
[0034] In the present invention, the amino acids at the corresponding sites are represented by the well-known single-letter abbreviations of IUPAC. Among them, each amino acid and its abbreviation are as follows: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine (Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y), and valine (Val or V).
[0035] The raw materials used in the examples:
[0036] 1. LB liquid medium: 5.0 g yeast extract, 10.0 g tryptone, 10.0 g sodium chloride, made up to 1 L with distilled water.
[0037] 2. 2×YT liquid medium: 10.0 g yeast extract, 16.0 g tryptone, 5.0 g sodium chloride, made up to 1 L with distilled water.
[0038] 3. LB solid medium: 5.0 g yeast extract, 10.0 g tryptone, 10.0 g sodium chloride, 15 g agar powder, made up to 1 L with distilled water.
[0039] 4. 2×YT solid medium: 10.0 g yeast extract, 16.0 g tryptone, 5.0 g sodium chloride, 15 g agar powder, made up to 1 L with distilled water.
[0040] 5. BL21(DE3) competent cells were purchased from Shanghai Titan Scientific Co., Ltd.
[0041] 6. Balb / c mice were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd.
[0042] 7. pCANTAB-5E vector was obtained from Beijing Solarbio Science & Technology Co., Ltd.
[0043] 8. Helper phage M13KO7 was purchased from NEB (New England Biolabs), USA.
[0044] 9. pET-28a plasmid is a commercial plasmid and was obtained from our laboratory.
[0045] Example 1 Preparation of murine thiamethoxam single-chain antibody (scFv)
[0046] I. Synthesis of artificial antigen
[0047] Dissolve 0.204 g CH 3 COONa and 0.258 mL 3-mercaptopropionic acid in 10 mL DMSO. After mixing evenly, add 0.437 g thiamethoxam (TMX) standard, and stir at 80 °C for 8 h. Add 20 mL ultrapure water to terminate the reaction after the solution is completely mixed. Adjust the pH of the reaction solution to 3.0 with 6 mol / L HCl, and extract with 30 mL chloroform three times. Dry with anhydrous sodium sulfate, centrifuge, take the supernatant, and freeze-dry to generate a yellow solid of thiamethoxam (TMX) hapten. The synthesized hapten was examined by Fourier transform infrared spectroscopy.
[0048] Weigh 5 mg of the TMX hapten standard and dissolve it in 500 μL of N,N-dimethylformamide. Then add 0.135 mmol of NHS and 0.202 mmol of EDC·HCl respectively, and mix well. Shake and activate at 25 °C for 6 h. After the reaction solution cools naturally, centrifuge it at 8000 r / min for 5 min. Slowly add the clear supernatant to 5 mL of a BSA (bovine serum albumin) solution with a concentration of 8 mg / mL. After the reaction mixture is stirred overnight at room temperature, dialyze it against 0.01 mol / L PBS buffer with pH 7.4 in an ice bath, changing the dialysis solution every 4 h for a total of 3 days to obtain TMX-BSA. Aliquot and store at -20 °C. The method for synthesizing the coated antigen is the same, just replace BSA with OVA (ovalbumin). Verify the synthesized antigen by ultraviolet spectroscopy and ELISA.
[0049] The identification of hapten and complete antigen is as Figure 1 shown. Through Figure 1 A, the successful synthesis of the hapten can be proved. The TMX hapten and the original TMX drug have similar characteristic absorption peaks at 800 - 1200 cm -1 , while the absorption peaks at 1200 - 1400 cm -1 belong to the absorption peaks of the methyl and nitro groups which are the pharmacophore groups in the original TMX drug, indicating that the synthesized TMX hapten retains the characteristic functional groups. The stretching vibration peak of the carboxyl group usually appears in the range of 2500 - 3300 cm -1 . It can be found from the image that compared with the original TMX drug, the infrared absorption peak of the TMX hapten shows an obvious absorption peak in this range. Therefore, it can be shown that the carboxyl group has been successfully added to the TMX hapten. From Figure 1 B and C, it can be seen that the ultraviolet absorption spectrum of the artificial antigen product is between that of TMX and the conjugate protein macromolecule, and is relatively close to the protein ultraviolet absorption curve, probably due to an excess of protein and a low concentration of the artificial antigen. Verified by ELISA, both TMX-BSA and TMX-OVA have good specific binding with the thiamethoxam antibody.
[0050] II. Mouse Immunization
[0051] Fuse and emulsify the synthesized immunogen TMX-BSA with Freund's complete adjuvant in equal proportion and then inject it into the abdominal cavity of 6 - 8-week-old Balb / c mice for the first time, with an injection dose of 100 μg / mouse (calculated by protein mass). For subsequent booster immunizations, use Freund's incomplete adjuvant, and boost immunize once every two weeks for a total of 4 times, with an injection dose of 50 μg / mouse. Finally, use physiological saline as the adjuvant for the boost immunization, with an immunization dose of 25 μg / mouse. The specific procedure is shown in Table 1.
[0052] Table 1 TMX-BSA Immunization Procedure
[0053]
[0054] From the third immunization, starting one week after the completion of immunization, 100 - 200 μL of tail vein blood was collected from the immunized mice to measure the titer. After the tail blood was collected, it was left to stand at 37 °C for 1 h until the plasma coagulated, then transferred to 4 °C and left to stand for another 3 h. It was centrifuged at 5000 r / min for 10 min at 4 °C, and the upper serum was taken. Serial two-fold dilutions were made for ELISA titer detection. Using the OD 450nm value of the serum of the immunized mice as P and the OD 450nm value of the serum of healthy non-immunized mice as N, a P / N ≥ 2.1 was considered positive, and the maximum serum dilution factor with a P / N value meeting the requirements was taken as the antibody titer. The results of the mouse serum titer were as Figure 2 shown. After measurement, the highest serum titer of the immunized mice was 1:51200.
[0055] III. Construction of recombinant phagemid
[0056] The mouse with the highest antibody titer was selected as the target. After sacrifice, its spleen was taken to extract total RNA. The integrity of the RNA was verified by agarose gel electrophoresis and reverse transcription was performed to obtain cDNA. Using the cDNA as a template, the VH and VL fragments of the antibody were amplified separately using degenerate primers common to murine antibodies. A short flexible linker (GGGGSGGGGSGGGGS) was assembled with VH and VL by nested PCR to form scFv, and SfiⅠ and NotⅠ restriction enzyme sites were introduced at both ends of the antibody. The scFv and the pCANTAB-5E vector were double-digested with SfiⅠ and NotⅠ restriction endonucleases respectively, and ligated with T4 DNA ligase to form a recombinant phagemid. The results of extracting RNA from the spleen of immunized mice were as Figure 3 shown in A. The extracted RNA had clear 28S and 18S bands, indicating good RNA quality and it could be used as a template for reverse transcription. The agarose gel electrophoresis pattern of the amplified VH and VL bands using cDNA as a template is shown in Figure 3 B. The size of VH was approximately 340 bp and the size of VL was approximately 320 bp, which was consistent with the expected results, indicating that the variable region fragments of the antibody were successfully amplified. The results of assembling scFv are shown in Figure 3 C. The size of the assembled scFv band was approximately 800 bp, which was consistent with the expectation, indicating that scFv was successfully assembled. The results of double digestion of the vector and the antibody are as Figure 3 shown in D. Since scFv was linearized itself and only a few bases were reduced before and after digestion, there was no obvious change in size. The original size of the pCANTAB-5E vector was approximately 5200 bp, and the size of the recovered linearized fragment after digestion was approximately 4400 bp, as shown in lane 2. The assembled phagemid band was approximately 5200 bp, as shown in lane 3, indicating the successful ligation of the vector and scFv.
[0057] IV. Construction and screening of phage library
[0058] After the constructed recombinant plasmid pCANTAB5E-scFv was electrotransformed into TG1 competent cells, it grew well on the 2×YT-Amp plate, indicating successful transformation. Twenty transformant single colonies were randomly selected for colony PCR identification, and the results are as Figure 4 shown. It can be seen from the figure that the target fragments were amplified from 18 colonies, and the positive insertion rate was 90%. The monoclonal bacterial liquid containing the target fragment of the correct size was sent to Azenta for sequencing. After sequencing result analysis, it was found that the target gene sequences with different sizes of about 750 bp were successfully inserted between the two restriction enzyme sites of Not I and Sif I.
[0059] The electrotransformed colonies were collected as a single-chain antibody library. When the antibody library was cultured to OD 600nm = 0.6 - 0.8 (logarithmic phase), the phage antibody library was amplified by infecting with the helper phage M13KO7. TMX-OVA was used as the coating antigen for solid-phase panning. After panning, the colonies were identified by colony PCR and phage-ELISA. The colonies that met the criteria of positive colony PCR and sample absorbance / control absorbance ≥ 2.1 were identified as positive clones. The positive clones were preserved, plasmids were extracted and sent to Azenta for sequencing.
[0060] After titer determination, the primary library capacity of the constructed BA single-chain antibody library was about 8.4×10 9 pfu / mL (the titer determination plate is as Figure 5 shown). After amplification by infecting with the helper phage M13KO7, the library capacity of the TMX phage antibody library was about 1.6×10 10 pfu / mL, which can be used for subsequent screening. After each round of screening, the titer of the eluate and the amplified product was determined, and the number of phages enriched in each round was calculated. The specific titer determination results are shown in Table 2. It can be seen from the data in the table that with the increase of the panning rounds, obvious enrichment of phages occurred, proving that the solid-phase panning method successfully enriched the specific phages. Twelve single colonies were randomly selected, cultured to the logarithmic phase and then infected with the helper phage M13KO7 to prepare monoclonal phage supernatants for phage-ELISA identification. The clones with sample absorbance / control absorbance ≥ 2.1 were selected as positive. From Figure 6 the results, it can be seen that the color development effect of clone No. 4 was better than that of other clones. Therefore, clone No. 4 (scFv4) was determined as the positive clone, and it was preserved and sequenced.
[0061] Table 2 Titer determination of TMX-scFv particles during the screening process
[0062]
[0063] After analyzing the sequencing results, the full length of the scFv4 sequence is 774bp. Among them, the size of VH is 387bp, and the size of VL is 342bp. After alignment with NCBI BLAST, the homology of its VH gene sequence with the variable region gene of mouse immunoglobulin heavy chain (GenBank: AAO18968.1) is 93.64%, and the homology of its VL gene sequence with the variable region gene of mouse immunoglobulin light chain kappa (GenBank: WKW91922.1) is 92.45%. According to the amino acid sequence of the variable region of murine antibodies published in the NCBI database, the CDR regions of scFv were annotated using the IMGT coding rules (the bold and underlined parts are the CDR regions). The specific annotation results are as follows:
[0064] Amino acid sequence of the variable region VH of TMX-scFv heavy chain:
[0065]
[0066] Nucleotide sequence of the variable region VH of TMX-scFv heavy chain:
[0067] CCTCTGTGGACTCTGCCGTCTATTACTGTGCAAGATCTAGGGAACTACTACTTTGACCCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACCGTCTCAGGGTTTTCATTAACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGCTGGTGGAAGCACAAACTATAATTCAGCTCTCAAATCCAGACTGAACATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTCCAAACTGATGACACAGCCATGTACTACTGTGCCAGAAACTGGGGCAGCTACTGGTACTTCGATGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA(SEQ ID NO.8)
[0068] Among them, the sequences of the heavy chain CDR regions are as follows:
[0069] Heavy chain HCDR1 region, SEQ ID NO.1: GFSLTSYG
[0070] Heavy chain HCDR2 region, SEQ ID NO.2: IWAGGST
[0071] Heavy chain HCDR3 region, SEQ ID NO.3: ARNWGSYWYFDV
[0072] Amino acid sequence of the variable region VL of the light chain of TMX-scFv4:
[0073] DIELTQSPAIMSASPGEKVTISCSAS SSVSY MYWYQQKPGSSPKVWIY LTS NLASGVPA RFSGSGSGTSYSLTISSMEAEDAATYYC QQRSSYPLT FGAGTKLEIKRAAAGAPV (SEQ ID NO.7)
[0074] Nucleotide sequence of the variable region VL of the light chain of TMX-scFv4:
[0075] GACATTGAGCTCACCCAGTCTCCAGCAATCATGTCTGCATCTCCAGGGGAGAAGGTCACCATATCCTGCAGTGCCAGCTCAAGTGTAAGTTACATGTACTGGTACCAGCAGAAGCCAGGATCCTCCCCCAAAGTCTGGATTTATCTCACATCCAACCTGGCTTCTGGAGTCCCTGCTCGCTTCAGTGGCAGTGGGTCTGGGACCTCTTACTCTCTCACAATCAGCAGCATGGAGGCTGAAGATGCTGCCACTTATTACTGCCAGCAAAGGAGTAGTTACCCGCTCACGTTCGGTGCTGGCACCAAGCTGGAAATCAAACGGGCGGCCGCAGGTGCGCCGGTG (SEQ ID NO.9)
[0076] Among them, the sequences of the light chain CDR regions are as follows:
[0077] Light chain LCDR1 region, SEQ ID NO.4: SSVSY
[0078] Light chain LCDR2 region, LTS
[0079] Light chain LCDR3 region, SEQ ID NO.5: QQRSSYPLT
[0080] Example 2: Construction and heterologous expression of the thiamethoxam single-chain antibody scFv plasmid
[0081] The scFv4 sequence obtained by screening in Example 1 was introduced into the pET-28a expression vector between the two restriction enzyme sites of Nde I and HindⅢ in the form of homologous recombination to construct the plasmid pET-28a-TMX (VL and VH are connected by a Linker, and the Linker is a GS linker peptide: GGGGSGGGGSGGGGS), and then transferred into Escherichia coli BL21(DE3) competent cells for heterologous expression of the recombinant single-chain antibody. The specific operations are as follows:
[0082] I. Prokaryotic expression of single-chain antibody
[0083] The recombinant bacteria successfully transfected with the pET-28a-TMX plasmid were streaked and cultured overnight at 37°C. Single colonies were picked and inoculated into LB liquid medium and cultured overnight. The plasmid was extracted the next day and quantified using Nanodrop. 3 μg of the plasmid was added to BL21(DE3) competent cells. After ice-bathing for 30 min, heat shock was performed at 42°C for 90 s, and then immediately ice-bathed for 2 min. 800 μL of LB culture medium was added to the above-mentioned competent cells, and after shaking culture at 37°C and 220 r / min for 1 h, it was spread on an LB / Amp plate and cultured overnight. Single colonies were picked and inoculated into LB-Amp liquid medium and cultured overnight for 12 h as the seed solution. The seed solution was added to 100 mL of LB-Amp medium at a ratio of 1:100 and cultured until OD 600nm = 0.6, and an IPTG solution with a final concentration of 0.1 mM was added, and induction was carried out overnight at 16°C and 180 r / min. The next day, centrifugation was performed at 8000 r / min and 4°C for 10 min. After ultrasonic disruption, the cell precipitate and supernatant were collected separately.
[0084] II. Purification of single-chain antibody
[0085] The collected supernatant was filtered through a 0.45 μm filter membrane to remove impurities and then reserved. 1 mL of Ni-NTA resin was loaded into an empty affinity chromatography column and equilibrated 3 times with 500 μL of non-denaturing lysis buffer. The supernatant to be filtered was added to the affinity chromatography column, and the flow-through was collected, and the sample was loaded onto the column 2-3 times in a cycle. Elution was performed with an imidazole solution of gradient concentration, and the target protein was collected. The purified sample was aspirated and verified by SDS-PAGE gel electrophoresis. The collected eluted protein solution was dialyzed against 0.01 M PBS solution with pH 7.4 at 4°C for 3 d, and the dialysis solution was changed every 4 h.
[0086] The SDS-PAGE gel electrophoresis identification results of the single-chain antibody TMX-scFv after expression and purification in Escherichia coli are as Figure 7As shown. Lane 1 is the bacterial precipitate, from which we can see that the expression product is mainly located in the supernatant of the broken liquid, and lanes 6-10 are the target proteins eluted in sequence. The results show that the single-chain antibody expressed by E. coli exists in the supernatant. The theoretical molecular weight of TMX-scFv is about 27kDa, which is consistent with the electrophoresis band.
[0087] Example 3: ELISA kit for thiamethoxam
[0088] The optimal coating concentration of TMX-OVA and the reaction concentration of scFv were determined by the chessboard method. TMX-OVA was diluted to 1.625μg / mL, 3.125μg / mL, 6.25μg / mL, 12.5μg / mL, 25μg / mL and 50μg / mL, added to a 96-well plate, coated at 37°C for 2h, washed three times with 0.05% PBST and patted dry. 250μL of 3% skim milk powder was added to each well and blocked at 37°C for 2h, washed three times and patted dry. 100μL of scFv diluted to 4μg / mL, 8μg / mL, 16μg / mL, 32μg / mL, 64μg / mL and 128μg / mL of antibody was added to each well, incubated at 37°C for 1h, washed three times and patted dry. Add 100 μL of 1:5k diluted anti-His-HRP secondary antibody and incubate at 37℃ for 30 min, wash the plate three times and pat dry. Mix equal volumes of TMB colorimetric solution A and solution B, add 100 μL to each well, react at 37℃ in the dark for 15 min, add stop solution and measure OD 450nm Select OD 450nm The optimal concentration of antigen and antibody is close to 1.0. The optimal TMX-OVA coating concentration is determined by the checkerboard titration method, and the optimal genetic engineering antibody concentration is 8 μg / mL.
[0089] After coating TMX-OVA (6.25 μg / mL) with the optimal antigen concentration and blocking, add 50 μL of thiamethoxam standard with a concentration range of 1.5-200 ng / mL and 50 μL of single-chain antibody at twice the optimal concentration to each well, and the subsequent operations are the same as above. The absorbance value corresponding to the standard concentration of 0 ng / mL is recorded as B, and the absorbance value corresponding to adding different concentrations of standard is B 0 , with the concentration of TMX standard as the horizontal axis, B / B 0 Plot a standard curve for the ordinate.
[0090] The competitive standard inhibition curves for TMX concentrations in the range of 1.5-200 ng / mL are shown in Figure 2. Figure 8 As shown, the IC of the standard curve was calculated 50 The value was 25.952ng / mL. The detection linear range (IC 20 -IC 80) was 8.13 - 137.97 ng / mL, and the lowest detection limit IC 10 was 3.43 ng / mL. The linear equation was Y = -48.52 LgX + 119.69, and R 2 = 0.967( Figure 9 ).
[0091] The specificity of the above scFv to thiamethoxam was evaluated by the cross - reaction rate. The specific steps were as described above. The thiamethoxam standard was replaced with six structurally similar compounds, namely imidacloprid, clothianidin, acetamiprid, thiacloprid, dinotefuran, and thiamethoxam. After the reaction, the OD value of each well at 450 nm was measured, and the corresponding IC 50 value was calculated. According to the following calculation formula, the cross - reaction rate = [IC 50 (thiamethoxam) / IC 50 (structurally similar compound)] × 100% to calculate the cross - reaction rate respectively. The specific calculation results are shown in Table 3. According to the data, the cross - reaction rates of the antibody with thiacloprid and imidacloprid were 16.3% and 10.6% respectively, and the cross - reaction rates with other analogues were <1%. These results indicate that the antibody has good specificity to thiamethoxam.
[0092] Table 3 Specificity determination results of thiamethoxam single - chain antibody
[0093]
[0094] To evaluate the practicability and applicability of the ELISA method, a spiked recovery experiment of three different concentrations of thiamethoxam was carried out on green pepper and Chinese cabbage samples within the working range. Taking green pepper as an example, thiamethoxam standard solutions with concentrations of 0.1, 0.5, and 1.0 mg / kg were added to the samples respectively. After thorough mixing, they were left standing overnight. The next day, 3 g of the spiked samples were weighed, 6 mL of methanol was added, sonicated for 30 min, and then centrifuged at 5000 rpm for 10 min. The supernatant was filtered through a 0.22 - μm filter membrane for standby. The established ELISA method was used for detection, and the results were verified by instrumental analysis. As shown in Table 4, the average recovery rate of TMX in Chinese cabbage was 71.80% - 97.87%, and the coefficient of variation (CV) was 4.09% - 6.68%; for green pepper, the average recovery rate was 71.14% - 110.49%, and the CV value was 2.22% - 7.92%. These results indicate that the ELISA method based on this antibody has good accuracy, stability, and repeatability, and is suitable for the detection of TMX in vegetable samples.
[0095] Table 4 Determination results of spiked recovery experiment
[0096]
[0097] Although the present invention has been disclosed above in preferred embodiments, it is not intended to limit the present invention. Anyone skilled in this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.
Claims
1. An anti-thiamethoxam antibody, characterized in that The anti-thiamethoxam antibody comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region has a heavy chain CDR consisting of HCDR1, HCDR2, and HCDR3, and the light chain variable region has a light chain CDR consisting of LCDR1, LCDR2, and LCDR3, wherein the amino acid sequence of the HCDR1 is GFSLTSYG, the amino acid sequence of the HCDR2 is IWAGGST, the amino acid sequence of the HCDR3 is ARNWGSYWYFDV, the amino acid sequence of the LCDR1 is SSVSY, the amino acid sequence of the LCDR2 is LTS, and the amino acid sequence of the LCDR3 is QQRSSYPLT.
2. The antibody according to claim 1, characterized in that The amino acid sequences of the light chain variable region and the heavy chain variable region are shown in SEQ ID NO.6 and SEQ ID NO.7, respectively.
3. A gene encoding the antibody according to claim 1 or 2.
4. A recombinant vector carrying the gene according to claim 3.
5. The recombinant vector according to claim 4, characterized in that The recombinant expression vector uses plasmid pET-28a as the expression vector.
6. A recombinant cell expressing the antibody according to claim 1 or 2, or containing the gene according to claim 3, or transformed with the recombinant vector according to claim 4 or 5.
7. A detection reagent product, characterized in that: The detection reagent product contains the antibody according to claim 1 or 2.
8. The product according to claim 7, characterized in that The products include test strips and test kits.
9. A method for detecting thiamethoxam, characterized in that: The method comprises using the antibody according to claim 1 or 2 to determine thiamethoxam by enzyme-linked immunosorbent assay.
10. Use of the antibody according to claim 1 or 2, or the gene according to claim 3, or the recombinant vector according to claim 4 or 5, or the recombinant cell according to claim 6 in detecting thiamethoxam.