Toadstool growth-promoting strain Clonostachys rosea MSF05

Through high-throughput sequencing analysis and isolation, morel-promoting strain Clonosachysrosea MSF05 was screened, which solved the problem of continuous cropping obstacles in morel cultivation, significantly improved the growth rate and biomass of morels, and improved soil microecology.

CN120118754AActive Publication Date: 2025-06-10INST OF BIOTECHNOLOGY & GERMPLASM RESOURCES YUNNAN ACAD OF AGRI SCI

Patent Information

Application Number
CN202510553375.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-29
Publication Date
2025-06-10
Estimated Expiration
2045-04-29

AI Technical Summary

Technical Problem

There are problems of continuous cropping obstacles in morel cultivation, resulting in problems such as difficulty in emergence, poor seedling growth, increased pests and diseases, reduced yields and deterioration in varieties.

Method used

Morel planting soil microorganisms were analyzed by high-throughput sequencing, and the morel-promoting strain Clonosachysrosea MSF05 with a promoter was isolated and screened, and bacterial agents or composite microbial preparations were developed to promote the growth of morels and the recovery of soil microecology.

Benefits of technology

It significantly improves the growth rate and biomass of morels, improves the microbial diversity and community structure of continuous cropping barrier soil, enhances the resistance of morels to diseases and pests, and improves the adaptability of continuous cropping cultivation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120118754A_ABST
    Figure CN120118754A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of microorganisms, and particularly discloses a morchella growth-promoting strain Clonostachys roseMSF05, the classification name is Clonostachys rosea, and the preservation number is GDMCC No: 65937, morchella is used as a precious edible and medicinal fungus, the planting scale is continuously enlarged, but the soil continuous cropping problem has become a main obstacle for soil-covered cultivation and fruiting of the morchella, the soil microorganism structure of the morchella is studied, and the morchella growth-promoting strain CClonostachys roseMSF05 can be used for promoting growth of the morchella. And the beneficial microbial strain clonostachys rosea MSF05 is screened out, so that technical support is provided for rebuilding soil micro-ecology, relieving continuous cropping obstacles of morchella esculenta and biological prevention and control.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and particularly relates to a Clonostachys rosea strain MSF05 that promotes the growth of Morchella Clonostachys rosea MSF05. Background Art

[0002] Continuous cropping obstacle, also known as crop replant disorder or replant problem, refers to the problems such as difficult emergence, poor seedling growth, increased pests and diseases, reduced yield, and deterioration of variety when the same or closely related crops are continuously planted on the same piece of land under conventional cultivation management. This phenomenon widely affects the cultivation of various plants such as food crops, cash crops, vegetables, forest trees, and traditional Chinese medicinal materials, and has become a major obstacle to the development of the planting industry in China. Its sources include soil microorganisms, soil enzymes, soil-borne diseases, allelopathic autotoxicity, etc. One of the important reasons is the change in the soil microbial structure.

[0003] The genus Morchella ( Morchella spp.) belongs to the large class of fungi Ascomycota, and specifically belongs to the Pezizomycetes class, Pezizales order, and Morchellaceae family. This rare edible and medicinal fungus is named "Morchella" because its head has a unique uneven surface, similar to a sheep's stomach. Since the successful commercial cultivation of Morchella, the soil ecological problems caused by soil and continuous cropping have become obstacles to the sustainable development of Morchella. Various enzymes in the soil play a key role in the utilization of nutrients such as C, N, and P, and participate in the cycling of these elements in the soil. Soil enzyme activity is closely related to the abundance and diversity of microorganisms in the habitat and is a key factor in the function of the soil ecosystem.

[0004] Based on this, the present invention analyzes the evolution of culturable microbial groups in the soil of continuous cropping of Morchella, and isolates the dominant microorganisms in the continuous cropping soil of Morchella. Further screen the Morchella growth-promoting strains, and classify the species of each strain by combining microscopic and macroscopic characteristics such as morphology and physiology with molecular biology techniques, so as to provide theoretical support and practical guidance for the sustainable and stable development of the Morchella planting industry. Summary of the Invention

[0005] The main object of the present invention is to provide a Clonostachys rosea strain MSF05 that promotes the growth of Morchella to solve the problems of Morchella planting and growth mentioned in the background art.

[0006] The present invention systematically isolates and identifies beneficial microorganisms in the cultivation soil of Morchella, providing practical experience for the continuous cultivation and stable development of Morchella. By using the plate confrontation test combined with molecular biology techniques, strains with promoting effects can be quickly screened out, and the types of strains can be accurately determined through molecular-level identification, providing reliable technical support for the continuous high-yield cultivation of Morchella.

[0007] Specifically, the present invention provides the following technical solutions: The present invention has isolated and identified a Morchella growth-promoting strain Gliocladium roseum ( Clonostachys rosea ) MSF05, classified and named: Clonostachys rosea , with the preservation number GDMCC No: 65937.

[0008] In one embodiment, the present invention provides a microbial agent, and the microbial agent contains the Gliocladium roseum ( Clonostachys rosea ) MSF05. In some specific embodiments, the active ingredient of the microbial agent can be Gliocladium roseum MSF05 or / and the metabolite of Gliocladium roseum MSF05. Optionally, the microbial agent can be added with surfactants (such as Tween 20, Tween 80, etc.), protectants (such as glycerol, sodium alginate, etc.), stabilizers (such as agar, gelatin, etc.), buffers (such as phosphate buffer solution), etc.

[0009] In another embodiment, the present invention provides a compound microbial preparation, and the compound microbial preparation contains the Gliocladium roseum ( Clonostachys rosea ) MSF05. The active ingredient of the compound microbial preparation can also contain other biological components or non-biological components; in one embodiment, the compound microbial preparation is made from two or more non-antagonistic microbial strains.

[0010] In some embodiments, in the microbial agent or compound microbial preparation provided by the present invention, Gliocladium roseum MSF05 and / or the metabolite of Gliocladium roseum MSF05 can exist in the form of cultured live microorganisms, fermentation broth of live microorganisms, filtrate of live microorganism cultures, or a mixture of microorganisms and filtrate.

[0011] In other embodiments, the microbial agent or compound microbial preparation provided by the present invention can be in various dosage forms, such as liquid agents, emulsions, suspensions, powders, granules, wettable powders, or water-dispersible granules, etc.

[0012] In one embodiment, the present invention provides the application of the Gliocladium roseum ( Clonostachys rosea ) MSF05, or the microbial agent, or the compound microbial preparation in promoting the growth of Morchella or preparing a Morchella growth promoter.

[0013] In one embodiment, the present invention provides the application of the Clonostachys rosea f. catenulata ( Clonostachys rosea ), MSF05, or the bacterial agent, or the compound microbial agent in repairing the soil with continuous cropping obstacles of Morchella or in preparing a soil repair agent for continuous cropping obstacles of Morchella.

[0014] In a more specific embodiment, the present invention provides a growth promoter for Morchella, and the promoter contains the fermentation culture solution of the Clonostachys rosea f. catenulata ( Clonostachys rosea ), MSF05.

[0015] Further, in the promoter, the culture medium for fermentation culture is glucose 10 g / L, yeast 2 g / L, peptone 8 g / L, sodium chloride 0.1 g / L, potassium dihydrogen phosphate 0.4 g / L, magnesium sulfate 0.2 g / L, and sodium hydroxide 0.24 g / L.

[0016] In one embodiment, the present invention provides a method for culturing Morchella strains. During the process of culturing strains, the above-mentioned growth promoter for Morchella is added. Those skilled in the art can understand that as an edible and medicinal fungus, the process of producing Morchella strains includes multiple processes such as the propagation culture of mother strains (primary strains), the propagation culture of original strains (secondary strains), and the propagation culture of cultivated strains (tertiary strains). During the propagation culture process, adding a growth promoter can shorten the culture process, reduce the production time cost, and improve the industrial production efficiency. In some specific embodiments, such as the growth promoter culture with the improved YPD medium provided by the present invention and the growth promoter culture with the Morchella wheat grain medium, the production rate of Morchella has been improved.

[0017] In one embodiment, the present invention provides a cultivation method for Morchella. During the process of covering the soil with Morchella, the above-mentioned growth promoter for Morchella is applied. Those skilled in the art know that during the cultivation process of Morchella, it is necessary to cover the soil with the strains to complete the processes of mycelial growth, primordium differentiation, and fruiting body formation. In the specific implementation process, adding the growth promoter for Morchella provided by the present invention can improve the production efficiency of Morchella.

[0018] A method for improving the adaptability of continuous cropping cultivation of Morchella, applying the Clonostachys rosea f. catenulata ( Clonostachys rosea ), MSF05, or the bacterial agent, or the compound microbial agent to the soil with continuous cropping obstacles. It should be understood that the strains screened by the present invention are growth-promoting strains obtained based on the differential strain analysis of continuous cropping soil and healthy soil. Based on this, adding the growth-promoting strains lacking in the continuous cropping obstacles to the continuous cropping obstacle soil can repair the continuous cropping obstacle soil to improve the utility of the adaptability of continuous cropping cultivation of Morchella.

[0019] The technical effects achieved by the present invention: In this invention, high-throughput sequencing was used to analyze the soil samples of Morchella sextelata YMe151 cultivation. It was found that the microbial diversity of non-continuous cropping healthy soil was significantly higher than that of continuous cropping soil, and there were obvious differences in the community structure. Based on the idea of reconstructing the soil flora, culturable microorganisms were isolated from the soil where Morchella grew well and there were no continuous cropping diseases. Through the plate confrontation experiment with Morchella, multiple target strains that promoted the mycelial growth of Morchella were obtained. The strains with obvious growth promotion effects were screened out, and the growth-promoting bacteria were morphologically observed, physiologically and biochemically determined, and molecularly identified as Gliocladium roseum Clonostachys rosea ), MSF05. Further, its bacterial liquid was added to plate culture and test tube culture to verify its effect on the growth of Morchella. When the concentration of MSF05 bacterial liquid was 50%, the growth rate of Morchella mycelium in test tube culture reached 22.13 mm / d, and the biomass was as high as 2.407 g, showing a significant growth promotion effect.

[0020] As a precious edible and medicinal mushroom, the cultivation scale of Morchella has been continuously expanding, but the problem of soil continuous cropping has become the main obstacle to fruiting in its covered soil cultivation. This invention explored the soil microbial structure of Morchella and screened out the beneficial microorganism Gliocladium roseum Clonostachys rosea ), MSF05, which provided technical support for reconstructing the soil microecology, alleviating the continuous cropping obstacle of Morchella and biological control. Description of the Drawings

[0021] Figure 1 Bacterial community structure diagram of non-continuous cropping soil and continuous cropping soil of Morchella at the phylum level; Figure 2 Fungal community structure diagram of non-continuous cropping soil and continuous cropping soil of Morchella at the phylum level; Figure 3 Co-culture plate diagram of MSF05 and Morchella; on the left side of the plate is the target strain MSF05, and on the right side is Morchella. There is no obvious gap between the mycelium of Morchella and the colony of the target strain. Co-culture shows that the strain has a typical growth promotion effect; Figure 4 Macroscopic morphological structure diagram (A) and microscopic morphological structure diagram (B) of the growth-promoting strain MSF05 on the plate; Figure 5 Growth promotion effect diagram of strain MSF05 on the mycelium of Morchella test tube species. In the figure, the comparison diagrams of the growth conditions of Morchella under the influence of CK and MSF05 bacterial liquid are shown in sequence; Figure 6 Growth promotion effect diagram of plate culture and test tube culture with MSF05 bacterial liquid added on the mycelium of Morchella. Detailed Embodiments

[0022] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. For purchased commodities in the test methods, if no specific conditions are indicated, they shall be carried out according to conventional conditions or the conditions recommended by the manufacturer. For reagents or instruments whose manufacturers are not indicated, they can all be obtained as conventional products through commercial purchase.

[0023] The pink Sporidesmium sclerotivorum provided by the present invention Clonostachys rosea MSF05, taxonomic name: Clonostachys rosea , with the preservation number GDMCC No: 65937, preservation unit: Guangdong Microbial Culture Collection Center, address: 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou; Institute of Microbiology, Guangdong Academy of Sciences, preservation date: February 25, 2025.

[0024] Example 1 1. Test materials Morchella sextelata YMe151, the culture medium is shown in Table 1.

[0025] Table 1 Test medium Composition YPD medium Glucose 20 g / L, yeast 2 g / L, peptone 2 g / L, agar 16 g / L Solid modified YPD medium Glucose 10 g / L, yeast 2 g / L, peptone 8 g / L, sodium chloride 0.1 g / L, potassium dihydrogen phosphate 0.4 g / L, magnesium sulfate 0.2 g / L, sodium hydroxide 0.24 g / L, agar 16 g / L Liquid modified YPD medium Glucose 10 g / L, yeast 2 g / L, peptone 8 g / L, sodium chloride 0.1 g / L, potassium dihydrogen phosphate 0.4 g / L, magnesium sulfate 0.2 g / L, sodium hydroxide 0.24 g / L Morchella wheat grain medium Wheat grains 49.5%, buckwheat husks 49.5%, lime 1% Beef extract peptone agar medium Peptone 10 g / L, beef extract powder 3 g / L, sodium chloride 5 g / L, agar 15 g / L Rose bengal medium Peptone 5 g / L, glucose 10 g / L, potassium dihydrogen phosphate 1 g / L, magnesium sulfate 0.5 g / L, agar 15 g / L, rose bengal 0.033 g / L, chloramphenicol 0.1 g / L 2. Methods Collection of soil samples Investigate the continuous cropping obstacle situation of Morchella, select greenhouse cultivation, and the planting soil (dNC) where Morchella grows well and there is no continuous cropping disease. Use the five-point sampling method to collect the soil of the mycelium layer after the harvest of Morchella as samples, take 0.5 kg at each point, and bring it back to the laboratory in a 4°C cold chain. Mix the 5 samples and divide them into 2 equal parts for storage and standby.

[0026] High-throughput Illumina sequencing analysis of soil microorganisms Taking the continuous cropping soil of Morchella as the comparison group (dCC), send the dNC and dCC soil samples to Shanghai Personal Biotechnology Co., Ltd. within 24 hours. Use the MP FastDNA® Spin Kit for Soil kit (MP Biomedical, USA) to extract DNA from the soil samples. Using the diluted genomic DNA as a template, use specific primers with Barcodes for PCR amplification. The amplified products are cloned and sequenced on the Illumina platform. Through splicing (FLASH software), filtering (Vsearch software), and OTUs clustering, species annotation and abundance analysis are carried out to reveal the species composition of bacteria and fungi in the samples.

[0027] Isolation of culturable soil microorganisms For bacterial culture, nutrient agar medium was used, while for fungal culture, Rose Bengal medium was selected. Take 1 gram of soil sample, perform gradient dilution with sterile water, and then take 0.1 mL of the 10 -3 , 10 -4 , 10 -5 dilution solutions respectively, set three replicates, and evenly spread them on the surface of the medium. Invert the petri dishes and place them in a constant temperature incubator at 37°C for bacterial culture, while fungi are cultured at 28°C. After 24 hours of bacterial culture, observe the formation of single colonies; fungal culture takes 3 to 5 days.

[0028] Compare the control group CK with the experimental group T in the experimental design, and further pick the dominant single colonies on the gradient plates of T samples for streak pure culture to isolate and purify the dominant bacteria.

[0029] Screening of growth-promoting strains of Morchella Using the Morchella sextelata strain YMe151 as the indicator bacterium, the separated bacterial and fungal strains were used for growth-promoting experiments by the plate confrontation culture method and co-culture to screen for potentially beneficial bacteria in the Morchella soil. Use a punch with a pore diameter of 6 mm to take well-grown Morchella mycelium blocks after activation and inoculate them on one side of the modified YPD plate. In the treatment group, streak-inoculate the activated dominant strains on the other side of the Morchella mycelium blocks; while the control group is not inoculated with the dominant strains. Set three replicates. Continue to culture at a constant temperature of 24°C and observe.

[0030] Identification of growth-promoting strains Inoculate the screened growth-promoting strains on the corresponding fungal or bacterial media, use the streak plate method to isolate single colonies, and observe the size, color, surface characteristics, edge shape, etc. of the colonies at the end of the culture to preliminarily determine the strain type. For the target fungi: directly observe the morphology of the dominant fungal colonies after culture, and stain them with Congo red staining solution, and observe the individual morphology and staining conditions of the growth-promoting strains under a 100× oil immersion microscope.

[0031] Molecular biology identification: After purification of each strain, genomic DNA of fungi and bacteria was extracted using kits respectively, amplified with the fungal universal primers ITS1 / ITS4 and the bacterial 16S rDNA universal primer pair respectively. The synthesis of PCR primers and sequencing of amplification products were completed by Tsingke Biotechnology (Kunming). The sequences were bidirectionally sequenced and spliced, compared on NCBI, and the maximum similar sequences were selected to construct a tree. Use Clustalx for multiple sequence alignment, and import the results into the MEGA 6.0 software for cluster analysis and construct a phylogenetic tree diagram to determine their species.

[0032] Experiment of adding growth-promoting bacteria liquid and Morchella plate culture The strain MSF05, which was screened out through a plate confrontation experiment and has a growth-promoting effect on the mycelial growth of Morchella, was fermented and cultured in a liquid YPD medium (the formula removes agar): at a temperature of 28 °C and a rotation speed of 150 r / min. After 3 days of culture, the bacterial liquid concentration was measured by an ultraviolet spectrophotometer and reached 3.0×10 5 CFU; after the bacterial liquid was filtered through sterile gauze, the filtrate was collected by a 0.22 μm sterile filter. The filtered bacterial liquid was added and formulated into a solid modified YPD medium at 5 concentration levels: no filtrate (0%), 10%, 20%, 30%, and 50%. Each concentration was set with 3 replicates, with 0% as the control (CK). A Morchella mycelial block was inoculated in the center of the prepared 9 cm solid medium using a punch with a diameter of 6 mm for culture. Starting from the 2nd day, the colony diameter was measured by the cross-streaking method every day for 7 consecutive days to obtain the daily average growth rate (mm / d) of the mycelium. On the 9th day, the weight of the mycelium was weighed, and the dry weight of the Morchella mycelial biomass was calculated to determine the effect of the dominant bacteria on the growth of Morchella mycelium.

[0033] Growth-promoting effect of strong growth-promoting strains The strain MSF05 was fermented and cultured in a liquid modified YPD medium at a temperature of 28 °C and a rotation speed of 150 r / min. After 3 days of culture, the bacterial liquid concentration was measured by an ultraviolet spectrophotometer and reached 3.0×10 5 CFU for standby. A Morchella mycelial block was inoculated into a sterilized test tube of Morchella wheat grain medium using a sterilized 6 mm punch. At the same time, the growth-promoting bacterial liquid was inoculated at 5 concentration levels: sterile liquid (0%), 10%, 20%, 30%, and 50%, and the water content was supplemented to be even. Each concentration of the growth-promoting strain was set with 3 replicates. The growth of Morchella mycelium in the test tube was observed under room temperature conditions. The length of the mycelial layer was measured after 3 - 4 days, and the growth rate (mm / d) of Morchella mycelium was calculated.

[0034] Results Analysis of soil microbial diversity in Morchella planting soil and continuous cropping soil As Figure 1 、 Figure 2 , taking the continuous cropping soil of Morchella as the comparison group (dCC), the microbial community composition characteristics of the healthy soil of non-continuous cropping Morchella soil (dNC) were analyzed. The results showed that the microbial diversity of non-continuous cropping soil was higher than that of continuous cropping soil, and the community structure was significantly different.

[0035] For bacteria, at the phylum level, the relative abundances of Chloroflexi, Acidobacteriota, and Bacteroidota in non - continuous cropping soil were significantly higher than those in continuous cropping soil, and they were the dominant species in non - continuous cropping healthy soil. The relative abundances of Actinobacteriota and Cyanobacteria were higher in continuous cropping soil. This indicates that Chloroflexi, Acidobacteriota, and Bacteroidota may be related to the normal growth of Morchella, and it is expected to screen probiotics for Morchella in healthy non - continuous cropping soil.

[0036] For fungi, the relative abundances of Ascomycota and Mortierellomycota in continuous cropping soil were higher than those in non - continuous cropping soil, while the relative abundances of Basidiomycota and Rozellomycota were significantly lower than those in non - continuous cropping soil.

[0037] Screening of beneficial microorganisms for Morchella Isolation of culturable dominant microorganisms in soil: Comparing the control group dCC and the experimental group dNC in the experimental design, picking dominant single colonies on the gradient plates of dNC samples for streak pure culture. After preliminary isolation and purification, multiple dominant microorganisms in the soil of Morchella mycelium were obtained.

[0038] Plate confrontation test of dominant strains and Morchella: Culturing multiple soil dominant strains and Morchella on improved YPD medium for 2 - 7 days respectively, comparing the mycelial growth of Morchella in the control group and the treatment group. There were differences in the mycelial growth rate and growth rate of Morchella, with both promoting and inhibitory effects. The MSF05 strain showed a promoting effect on the mycelial growth of Morchella ( Figure 3 ), and there was no obvious gap between the mycelium of Morchella and the colony of the target strain MSF05. Co - culture showed that the strain had a typical growth - promoting effect.

[0039] Species identification of the microorganism strain MSF05 with a growth - promoting effect on Morchella Figure 4 It can be seen that the isolated and screened MSF05 strain grew slowly on YPD medium. The mycelium was villous, light white, the colony was large, and there was a tendency to expand outwards; the mycelium was thick, non - septate, and there were a large number of spores. The morphological structure was consistent with the genus Clonostachys in the class Helotiales, order Botryosphaeriales, phylum Ascomycota Clonostachys roseaBasically similar. The size of the ITS amplified sequence fragment of the MSF05 strain is 574 bp, and the sequence is shown in SEQ ID No.1. Combining the morphological characteristics of the MSF05 strain and the ITS sequence alignment results, the MSF05 strain isolated in the present invention was identified as a growth-promoting bacterium of Morchella, belonging to the genus Clonostachys rosea, and the taxonomic name: Clonostachys rosea , after preservation, the preservation number is GDMCC No: 65937.

[0040] ITS amplified sequence of the MSF05 strain (SEQ ID No.1): GAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA TTACAGTAGTCATCCGGGTTGCCGCAAGGCCTCCCGGGTAACCTACCACC CTTTGTTTATTACACTTTGTTGCTTTGGCAGGCCTGCCCTCGGGCTGCTG GCTCCGGCCGGCGAGCGCCTGCCAGAGGACCTAAACTCTGTTTGTCTATA TTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGG TTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTG CAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGT ATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACAACCCTCAAGCTCAGC TTGGTGTTGGGCCCCGCCGCCCCGGCGGGCCCTAAAGTCAGTGGCGGTGC CGTCCGGCTCCGAGCGTAGTAATTCTTCTCGCTCTGGAGGTCCGGTCGTG TGCTCGCCAGCAACCCCCAATTTTTTTCAGGTTGACCTCGGATCAGGTAG GGATACCCGCTGAACTTAAGCATA Analysis of the growth-promoting effect of the growth-promoting strain MSF05 Add the bacterial liquid of MSF05 to the test tube of Morchella esculenta wheat grain medium, inoculate the Morchella esculenta fungal block for culture ( Figure 5 ). After 4 days of culture, in the wheat grain test tube culture experiment with the addition of MSF05 bacterial liquid, compared with CK, the growth rate of Morchella esculenta mycelium was 14.31 mm / d ( Figure 6 ). The effect of the growth rate of Morchella esculenta mycelium was not clear at low concentrations of MSF05 bacterial liquid, but the growth rate increased in a curve with the increase of concentration. Among them, when MSF05 was at 50%, the mycelium growth rate was the highest at 22.13 mm / d, and the growth promotion effect was obvious.

[0041] The results of the plate experiment with the addition of the bacterial filtrate of MSF05 strain showed that ( Figure 6 ): The growth rate of Morchella esculenta mycelium was the highest at 20% of its concentration, reaching 30.33 mm / d. With the increase of the bacterial liquid concentration, the growth rate decreased slightly, but compared with CK, they were all growth promotion effects; for the change of the biomass of Morchella esculenta mycelium, although the biomass decreased slightly at the low concentration of 10%, the biomass increased in a curve with the increase of concentration, and the 50% bacterial liquid concentration level promoted the increase of biomass, reaching 2.407 g.

[0042] Through the plate culture and test tube culture with the addition of the bacterial liquid of the growth-promoting strain, the comprehensive verification result is that the growth-promoting effect of MSF05 strain is significant, and the addition concentration of 30% - 50% is the appropriate concentration of the growth-promoting bacterial liquid.

[0043] In recent years, with the rapid growth of the consumption demand for Morchella esculenta, the production scale of Morchella esculenta has gradually increased, and continuous cropping obstacle has become a major problem. One of the important reasons for the occurrence of continuous cropping obstacle is the change of soil microbial structure. In this invention, high-throughput sequencing analysis was used to find that the microbial diversity of non-continuous cropping soil was significantly higher than that of continuous cropping soil, and there were obvious differences in the community structure. Therefore, culturable microorganisms were isolated from non-continuous cropping soil, and beneficial bacteria for Morchella esculenta planting soil were screened based on the theory of soil microbial flora restoration. By screening a variety of soil microorganisms from Morchella esculenta cultivation soil, and then through confrontation with Morchella esculenta, the target strains with promoting effects were screened. Their bacterial liquid was added to the Morchella esculenta plate medium for co-culture. Morphological observation, physiological and biochemical determination and molecular identification were carried out on the screened growth-promoting bacteria. Through the test tube culture experiment with the addition of the target bacteria bacterial liquid, it was verified many times and finally screened to obtain Clonostachys rosea MSF05 (Gliocladium roseum) has a strong growth promotion effect on the growth of Morchella esculenta mycelium. After testing, when the concentration of MSF05 bacterial liquid was 50%, the growth rate of Morchella esculenta mycelium in test tube culture reached 22.13 mm / d, and the biomass was as high as 2.407 g. The growth promotion effect was significant. This strain can be used for the growth promotion of Morchella esculenta mycelium in all stages of industrial production, and adding the growth-promoting strains with differential deficiencies to the continuous cropping obstacle soil of Morchella esculenta to repair the continuous cropping obstacle soil and improve the adaptability of continuous cropping cultivation of Morchella esculenta.

[0044] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A pink spiral polysporon ( Clonostachys rosea )MSF05, characterized in that, Category naming: Clonostachys rosea , the deposit number is GDMCC No:65937.

2. A bacterial agent, characterized in that The bacterial agent contains the pink spiral polysporus described in claim 1 ( Clonostachys rosea )MSF05.

3. A composite microbial preparation, characterized in that: The composite microbial preparation contains the pink spiral polysporus described in claim 1 ( Clonostachys rosea )MSF05.

4. The pink spiral polysporon of claim 1 ( Clonostachys rosea ) MSF05, or the bacterial agent described in claim 2, or the composite microbial preparation described in claim 3 in promoting the growth of morels or preparing a morel growth promoter.

5. The pink spiral polysporon of claim 1 ( Clonostachys rosea ) MSF05, or the bacterial agent described in claim 2, or the composite microbial preparation described in claim 3 in repairing soil with continuous cropping of morels or in preparing a soil repair agent for continuous cropping of morels.

6. A Morchella growth promoter, characterized in that The promoter contains the pink spiral polysporus described in claim 1 ( Clonostachys rosea ) Fermentation broth of MSF05.

7. The accelerator according to claim 6, characterized in that The fermentation culture medium is composed of 10 g / L glucose, 2 g / L yeast, 8 g / L peptone, 0.1 g / L sodium chloride, 0.4 g / L potassium dihydrogen phosphate, 0.2 g / L magnesium sulfate and 0.24 g / L sodium hydroxide.

8. A method for cultivating Morchella spp., characterized in that: During the bacterial strain cultivation process, the Morchella growth promoter according to claim 6 or 7 is added.

9. A method for cultivating morels, characterized in that: During the soil-covering cultivation of Morchella, the Morchella growth promoter according to claim 6 or 7 is applied.

10. A method for improving the adaptability of continuous cultivation of Morchella, characterized in that: Applying the pink spiral polysporus ( Clonostachys rosea ) MSF05, or the bacterial agent described in claim 2, or the composite microbial preparation described in claim 3.

Citation Information

Patent Citations

  • Clonostachys rosea (clonostachys rosea) strain YZC3 and application thereof

    CN110042063A

  • Food material composition and membrane bioreactor design comprising filamentous fungal particles

    CN114126412A

  • Active compound combinations comprising fatty acids

    CN114760842A

  • Spiropolyspora pink strain, microbial agent, and preparation method and application of spiropolyspora pink strain and microbial agent

    CN116590155A

  • Shangri-La tricholoma matsutake growth-promoting microorganism SLTmB04 strain and application thereof

    CN117887638A

Cited By

  • Morchella growth-promoting strain bacillus MSB09

    CN120118808A

  • A Morchella growth-promoting strain Bacillus MSB09

    CN120118808B