Key site of interaction between wheat scab resistance protein tasnRK1a and fusarium graminearum secreted protein osp24 and application thereof
By identifying the key interaction sites between the wheat disease resistance protein TaSnRK1α and the Fusarium graminearum secretory protein Osp24, and by using CRISPR-Cas9 technology to mutate valine at position 479 of TaSnRK1α, the problem of difficulty in breeding wheat scab resistance in existing technologies has been solved, and efficient disease resistance enhancement has been achieved.
Patent Information
- Application Number
- CN202510226436.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-27
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2045-02-27
AI Technical Summary
The lack of precise identification and modification of wheat scab resistance genes in existing technologies makes breeding difficult, and traditional methods may affect the normal function of crops, making it difficult to effectively improve wheat's disease resistance.
By deeply analyzing the interaction between wheat disease resistance protein TaSnRK1α and Fusarium graminearum secretory protein Osp24, key sites were accurately identified, and valine at position 479 of TaSnRK1α was mutated using CRISPR-Cas9 technology to block its interaction with Osp24, thus creating disease-resistant materials.
This study demonstrates a highly efficient and precise genetic modification approach that enhances wheat's resistance to Fusarium head blight while maintaining normal crop function, thereby blocking the pathogen's targeting and inhibition.
Smart Images

Figure BDA0005290257640000052 
Figure BDA0005290257640000061 
Figure HDA0005290257650000011
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a key interaction site between a wheat scab disease resistance protein TaSnRK1a and a Fusarium graminearum secreted protein Osp24 and an application thereof. BACKGROUND
[0002] Wheat scab is a major fungal disease caused by Fusarium spp. with F. graminearum as the dominant species, which not only leads to a significant decrease in wheat yield and quality, but also causes a large amount of mycotoxins to accumulate in the infected wheat heads, resulting in toxin exceeding standards in grains and wheat products, which seriously threatens human and animal health and poses a double challenge to agricultural production and food safety.
[0003] Breeding disease-resistant varieties is the most economical, sustainable and effective measure for preventing and controlling wheat scab. However, there is currently a severe lack of high-quality and high-yield resistant materials, and the available resistance sources are very limited. In addition, the complex resistance mechanism of wheat scab, the lack of major disease resistance genes, and the long traditional breeding cycle make it difficult to conduct molecular breeding of wheat scab. Plants have accumulated a wealth of disease resistance gene resources during long-term co-evolution with pathogenic fungi. When F. graminearum infects wheat, it uses secreted proteins to inhibit or manipulate key immune regulatory factors to facilitate infection. Therefore, identifying key disease resistance genes in the target of F. graminearum core pathogenic secreted proteins, analyzing the interaction and resistance mechanism, and genetically manipulating them are expected to create wheat materials with improved resistance to scab, and provide new ideas for solving the current problems of wheat scab prevention and control and molecular breeding.
[0004] However, since key disease resistance genes often play an important role in plant life activities, overexpression, silencing or knockout may have some negative effects, such as affecting major agronomic traits, yield and quality, etc. Therefore, using gene editing technology to precisely modify the interaction site to block the targeting and manipulation of the pathogen can avoid affecting the biological function of the target gene. This is a new approach to genetic improvement of crop disease resistance while maintaining the excellent traits of crops. An important basis for achieving this goal is to have a deep understanding of the interaction between pathogen proteins and host targets, especially the identification of key interaction sites.
[0005] The key disease resistance protein sucrose non-fermenting-1 related protein kinase 1 catalytic subunit alpha protein TaSnRK1a of wheat scab is a member of sucrose non-fermenting-1 related protein kinase family, which plays an important role in plant growth, metabolism and stress response. The core pathogenic secreted protein Osp24 of Fusarium graminearum targets and reduces the stability of TaSnRK1a protein, and interferes with the wheat scab resistance mediated by TaSnRK1a. In order to effectively utilize the CRISPR-Cas9 gene editing technology, the specific site of TaSnRK1a is reformed while the core function of TaSnRK1a protein is maintained, the targeting of Osp24 is blocked, and the wheat material with improved scab resistance is created. It is necessary to accurately identify the key interaction site of TaSnRK1a and Osp24. However, there is no related report about the key interaction site of TaSnRK1a and Osp24 in the prior art. SUMMARY
[0006] In view of the deficiencies in the prior art, the present application further identifies the key interaction site by analyzing the interaction between the important disease resistance protein TaSnRK1a of wheat and the core secreted protein of Fusarium graminearum, and the mutation of the site can block the targeting of the pathogen. This provides an important basis for subsequent precise editing of the site by CRISPR-Cas9 and other technologies to improve the disease resistance of wheat.
[0007] The main content of the present application is as follows:
[0008] The present application relates to the important disease resistance protein TaSnRK1a of wheat and the core pathogenic secreted protein of Fusarium graminearum. The nucleotide sequence of TaSnRK1a is shown as SEQ ID NO: 1, and the amino acid sequence is shown as SEQ ID NO: 2. The nucleotide sequence of the secreted protein Osp24 is shown as SEQ ID NO: 9, and the amino acid sequence is shown as SEQ ID NO: 10. The disease resistance protein TaSnRK1a plays an active regulatory role in the defense response of wheat against scab, and the core pathogenic secreted protein Osp24 of Fusarium graminearum targets and reduces the stability of TaSnRK1a protein to interfere with the wheat scab resistance and promote the infection of the pathogen.
[0009] The present application also relates to three homologous genes of TaSnRK1a, namely TaSnRK1a2, TaSnRK1a3 and TaSnRK1a4, and the nucleotide sequences correspond to SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, and the amino acid sequences correspond to SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8.
[0010] In one aspect, the present application provides a key region of interaction between the wheat scab resistance protein TaSnRK1a and the F. graminearum secreted protein Osp24, which is located at positions 381-500 of the sequence shown in SEQ ID NO: 2, positions 392-513 of the sequence shown in SEQ ID NO: 6, or positions 391-512 of the sequence shown in SEQ ID NO: 8. A key site of interaction between the wheat scab resistance protein TaSnRK1a and the F. graminearum secreted protein Osp24 is also provided, which is located at position 479 of the sequence shown in SEQ ID NO: 2.
[0011] Specifically, the present application divides TaSnRK1a into various forms by analyzing the protein domain distribution and sequence characteristics, and verifies the interaction with Osp24 using a yeast two-hybrid test to determine that the 381-500 aa segment of TaSnRK1a is the key region that determines the interaction with Osp24. Further, the present application verifies through tests that the segment (392-513 aa and 391-512 aa, respectively) of the homologous proteins TaSnRK1a3 and TaSnRK1a4 of TaSnRK1a in the wheat genome interacts with Osp24, while TaSnRK1a2 does not. Accordingly, by comparing the amino acid sequences of the segment in TaSnRK1a, TaSnRK1a2, TaSnRK1a3, and TaSnRK1a4, it is found that there are six amino acids that are the same in TaSnRK1, TaSnRK1a3, and TaSnRK1a4, and different from TaSnRK1a2. Point mutations of the above six amino acids are performed, and it is ultimately proved that the valine at position 479 of TaSnRK1a is the key site that determines the interaction with Osp24.
[0012] Further, based on the above research results, the present application proposes the use of the key region of interaction in blocking the interaction between the wheat scab resistance protein TaSnRK1a and the F. graminearum secreted protein Osp24, and the use of the key site of interaction in blocking the interaction between the wheat scab resistance protein TaSnRK1a and the F. graminearum secreted protein Osp24. The use is to mutate the valine at position 479 of the sequence shown in SEQ ID NO: 2 to block the interaction between the wheat scab resistance protein TaSnRK1a and the F. graminearum secreted protein Osp24. Further, the mutation includes substitution or deletion of an amino acid.
[0013] In another aspect, the present application provides a method for blocking the interaction between the wheat scab resistance protein TaSnRK1a and the Fusarium graminearum secreted protein Osp24, the method comprising the following steps: mutating the valine at position 479 of the sequence shown in SEQ ID NO: 2 into another amino acid, thereby blocking the interaction between the wheat scab resistance protein TaSnRK1a and the Fusarium graminearum secreted protein Osp24.
[0014] Further, the mutation is mutating the valine at position 479 of the sequence shown in SEQ ID NO: 2 into alanine.
[0015] The beneficial effects of the present application are:
[0016] The present application provides the key region of the interaction between the wheat scab resistance protein TaSnRK1a and the Fusarium graminearum secreted protein Osp24, and accurately identifies that the valine at position 479 of the TaSnRK1a protein is the site that determines the interaction with Osp24. After mutating the valine at position 479 of the TaSnRK1a protein, the interaction with Osp24 disappears, successfully blocking the targeting of the pathogen protein. The identification of this site provides an ideal molecular target for using CRISPR-Cas9 technology to precisely engineer TaSnRK1a, block the targeting and inhibition of the pathogen, and create scab-resistant materials.
[0017] In another aspect, the present application provides an innovative approach for engineering functional and conserved regulatory genes in wheat and improving disease resistance. By accurately identifying the sites that play a core role in protein resistance regulation, and combining CRISPR-Cas9 gene editing technology to finely regulate these key sites, the disease resistance of crops can be improved without affecting the normal physiological functions of plants. This provides an efficient and precise genetic improvement scheme for the field of agricultural biotechnology. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 The figure is a schematic diagram of the TaSnRK1a protein domain. "KD" is "Kinase Domain", indicating the kinase domain; "NKR" is "Non-kinase Region", indicating the non-kinase region.
[0019] Figure 2 The figure is a schematic diagram of the TaSnRK1a protein non-kinase region and the interaction result with Osp24. Figure 2 a is a schematic diagram of the TaSnRK1a protein non-kinase region and the interaction intensity with Osp24. "+" or "-" indicates the interaction, specifically, "+++" indicates strong interaction, "+" indicates weak interaction, and "-" indicates no interaction. Figure 2 b is a yeast two-hybrid result diagram of the interaction between different truncated forms of TaSnRK1a protein and Osp24.
[0020] Figure 3 Figure 2 is a schematic diagram of amino acid sequence alignment of the non-kinase domain of TaSnRKlα and the homologous proteins TaSnRKlα2, TaSnRKlα3 and TaSnRKlα4. "TaSnRKlα381-500aa" indicates the key region of TaSnRKlα protein mediating strong interaction with Osp24.
[0021] Figure 4 Figure 3 is a schematic diagram of sequence division of the TaSnRKlα381-500aa region and the corresponding conserved regions of the homologous proteins TaSnRKlα2, TaSnRKlα3 and TaSnRKlα4 and the interaction results with Osp24. "+++" indicates strong interaction and "-" indicates no interaction.
[0022] Figure 5 Figure 4 is an amino acid sequence alignment of the TaSnRKlα381-500aa region and the corresponding conserved regions of the homologous proteins TaSnRKlα2, TaSnRKlα3 and TaSnRKlα4. "396I", "444I", "462I", "479V", "483Q" and "495T" indicate the sites where TaSnRKlα is identical to TaSnRKlα3 and TaSnRKlα4 and different from TaSnRKlα2 in the illustrated region.
[0023] Figure 6 Figure 5 is a schematic diagram of the interaction of TaSnRKlα381-500aa region with Osp24 after the "396I", "444I", "462I", "479V", "483Q" and "495T" sites in TaSnRKlα are respectively mutated to the amino acids of the corresponding sites in TaSnRKlα2. "+++" indicates strong interaction, "++" indicates slightly lower intensity than "+++", and "-" indicates no interaction.
[0024] Figure 7 Figure 6 is a result diagram for verifying that the valine at the 479th site in TaSnRKlα is a key site determining the interaction with Osp24. DETAILED DESCRIPTION
[0025] In order to better understand the technical content of the present application, the present application will be further described below in combination with specific examples and drawings.
[0026] Example 1
[0027] This example identifies the key region of the interaction between the wheat scab resistance protein TaSnRKlα and the core pathogenic secreted protein Osp24 of F. graminearum.
[0028] The nucleotide sequence of the wheat sucrose non-fermenting-1 -type related protein kinase 1 catalytic subunit alpha gene TaSnRK1a is shown in SEQ ID NO: 1, and the nucleotide sequence of the secretory protein gene Osp24 is shown in SEQ ID NO: 9. Based on this, the specific primers TaSnRK1a1-F (5' ATGGACGCAGCAGGCAGAG 3') and TaSnRK1a1-R (5' TCAAAGGACTCTCAGCTGGGTTAGG 3') of TaSnRK1a1 and the specific primers Osp24-F (5' ATGGTTGCGCCATCCACTG 3') and Osp24-R (5' TCACAAGCTCGAGCGGTAGCAAAG 3') of Osp24 are designed. The homologous arms of the yeast two-hybrid vectors pKADT7 and pKBKT7 one-step cloning are added to the 5' of the TaSnRK1a and Osp24 primers, respectively.
[0029] The Norm wheat variety normally cultivated in a greenhouse was used as the material, and the ear of the wheat variety was inoculated with the wild-type strain PH-1 of Fusarium graminearum at the flowering stage. After 3 days, the spikelets were taken, total RNA was extracted, and the total RNA was reversely transcribed into cDNA as the template for PCR amplification. The primers used are shown in Table 1. FastPfu DNA Polymerase (Beijing Zoman Biotechnology Co., Ltd.), and the PCR reaction system is shown in Table 1.
[0030] Table 1. PCR reaction system of TaSnRK1a gene
[0031]
[0032]
[0033] The PCR reaction program is as follows: 95 °C pre-denaturation for 5 min; 95 °C for 30 sec, 58.5 °C for 40 sec, 72 °C for 1 min, 35 cycles; and 72 °C for supplementary extension for 10 min.
[0034] Sanger sequencing was performed on the PCR product, and it was confirmed that the obtained nucleotide sequence of the wheat sucrose non-fermenting-1 -type related protein kinase 1 catalytic subunit alpha gene TaSnRK1a was consistent with SEQ ID NO: 1, and the encoded amino acid sequence was consistent with SEQ ID NO: 2. The nucleotide sequence of the secretory protein gene Osp24 was consistent with SEQ ID NO: 9, and the encoded amino acid sequence was consistent with SEQ ID NO: 10.
[0035] Using the yeast two-hybrid system, the interaction region between TaSnRK1α and Osp24 was explored. TaSnRK1α is composed of the kinase domain (1-266aa) at the amino terminal and the non-kinase domain (267-500aa) at the carboxyl terminal. It is known that the non-kinase domain 267-500aa of TaSnRK1α is the interaction region with Osp24 Figure 1 ). Further, the non-kinase domain of TaSnRK1α was divided into three segments 267-344aa (TaSnRK1α1 M1 ), 268-423aa (TaSnRK1α1 M2 ) and 424-500aa (TaSnRK1α1 M3 ) to explore the key region mediating the interaction with Osp24. The DNA fragments of the above three segments were amplified by PCR using TaSnRK1α1-pKADT7 as the template and were constructed in the pKADT7 vector, respectively. The results of the yeast two-hybrid experiment showed that Figure 2 ), TaSnRK1α1 M1 and TaSnRK1α1 M2 did not interact with Osp24, and only TaSnRK1α1 M3 had weak interaction with Osp24, indicating that the 424-500aa region at the carboxyl terminal of TaSnRK1α was essential for the interaction with Osp24, and there was an important motif mediating the strong interaction between them in the M1 or M2 region.
[0036] By comparing the amino acid sequences of the non-kinase domains of TaSnRK1α and its homologous proteins TaSnRK1α2, TaSnRK1α3 and TaSnRK1α4, it was found that Figure 3 ) there was a longer conserved region 381-500aa (TaSnRK1α1 M4 ) in addition to the above-mentioned 424-500aa region. The results of the yeast two-hybrid experiment showed that Figure 2 ), TaSnRK1α1 M4 had the same interaction strength with Osp24 as the full-length TaSnRK1α, indicating that the 381-500aa region of TaSnRK1α was the key region mediating the strong interaction between them and Osp24.
[0037] Example 2
[0038] This example describes the identification of the key site of the interaction between the wheat scab resistance protein TaSnRK1α and the secreted protein Osp24 of Fusarium graminearum.
[0039] By comparing the sequence differences of the homologous proteins of TaSnRK1α and the interaction with Osp24, the key site affecting the interaction between TaSnRK1α and Osp24 was identified.
[0040] TaSnRK1a2 (the nucleotide sequence of which is shown as SEQ ID NO: 3, and the amino acid sequence of which is shown as SEQ ID NO: 4), TaSnRK1a3 (the nucleotide sequence of which is shown as SEQ ID NO: 5, and the amino acid sequence of which is shown as SEQ ID NO: 6), and TaSnRK1a4 (the nucleotide sequence of which is shown as SEQ ID NO: 7, and the amino acid sequence of which is shown as SEQ ID NO: 8) are selected as the conserved regions in the above-mentioned TaSnRK1a381-500aa segment of TaSnRK1a1, specifically TaSnRK1a2 384-503aa (TaSnRK1a2 M1 ), TaSnRK1a3 392-513aa (TaSnRK1a3 M1 ), and TaSnRK1a4 391-512aa (TaSnRK1a4 M1 ). Referring to Example 1, the corresponding pGADT7 vectors are constructed. The results of the yeast two-hybrid experiment show that TaSnRK1a2 Figure 4 ), TaSnRK1a3 M1 , and TaSnRK1a4 M1 interact with Osp24, and the interaction intensity is comparable to that of TaSnRK1a and Osp24, while TaSnRK1a2 M1 does not interact with Osp24.
[0041] Comparing the amino acid sequences of TaSnRK1a1 M4 , TaSnRK1a2 M1 , TaSnRK1a3 M1 , and TaSnRK1a4 M1 , it is found that there are 6 sites that are conserved in TaSnRK1a1 M4 , TaSnRK1a3 M1 , and TaSnRK1a4 M1 , but not in TaSnRK1a2 M1 , which are 396I, 444I, 462I, 479V, 483Q, and 495T (TaSnRK1a1 M4 ). Figure 5
[0042] The above-mentioned 6 sites in the TaSnRK1a1 M4 region are changed to the forms of TaSnRK1a2 M1 , i.e., TaSnRK1a M4 -I396V, TaSnRK1a M4 -I444P, TaSnRK1a M4 -I462L, TaSnRK1a M4 -V479A, TaSnRK1aM4 Q483H and TaSnRK1a M4 T495A, respectively. Yeast two-hybrid assay results show that Figure 6 ), TaSnRK1a M4 of the 479th valine (V) to alanine (A) lost the interaction with Osp24. In contrast, mutations at other sites did not significantly affect the interaction of TaSnRK1a M4 with Osp24. Further, the full-length TaSnRK1a 479th valine mutated to alanine (TaSnRK1a 479V-A) also did not interact with Osp24 Figure 7 ).
[0043] Further, the corresponding alanine in TaSnRK1a2 M1 was changed to valine (TaSnRK1a2 M1 -A482V), and the yeast two-hybrid results showed that Figure 7 , TaSnRK1a2 M1 changed from no interaction to interaction with Osp24. In summary, the 479th valine of TaSnRK1a1 is the key site that determines its interaction with Osp24.
[0044] The mutation of the 479th valine of TaSnRK1a lost its interaction with the Fusarium graminearum secreted protein Osp24. Fusarium graminearum cannot promote pathogenesis by targeting and inhibiting the function of TaSnRK1a. Therefore, the 479th valine of TaSnRK1a can be precisely edited using CRISPR-Cas9 technology in the future, and then the targeting of Fusarium graminearum is blocked to improve the resistance of wheat to scab.
[0045] The above only describes some embodiments of the present application and does not limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall fall within the protection scope of the present application.
Claims
1. The use of an interaction key site in blocking the interaction between the wheat scab resistance protein TaSnRK1α and the Fusarium graminearum secreted protein Osp24, characterized in that, The interaction key site is located at position 479 of the sequence shown in SEQ ID NO: 2; the application is to block the interaction between the wheat scab disease resistance protein TaSnRK1α and the Fusarium graminearum secreted protein Osp24 by mutating the valine at position 479 of the sequence shown in SEQ ID NO: 2 to alanine.
2. A method of blocking the interaction of the wheat scab resistance protein TaSnRK1a with the Fusarium graminearum secreted protein Osp24, characterized in that, The amino acid sequence of TaSnRK1α is shown in SEQ ID NO: 2, and the amino acid sequence of Osp24 is shown in SEQ ID NO. 10; The method comprises the following steps: mutating the valine at position 479 of the sequence shown in SEQ ID NO: 2 to alanine, thereby blocking the interaction between the wheat scab disease resistance protein TaSnRK1α and the Fusarium graminearum secreted protein Osp24.
Citation Information
Patent Citations
Application of wheat TaSnRK1 protein and related biological materials thereof in improving heat resistance of plants
CN118812685A