A non-specific nuclease dsNuc392 derived from the deep sea and its uses

By screening and identifying the non-specific nuclease dsNuc392 from the deep-sea hot spring metagenome, the problem of insufficient nuclease activity under low temperature conditions in the prior art was solved, efficient catalysis of DNA and RNA at 40°C was achieved, and the application of nucleases in food processing and biomedicine was expanded.

CN120118884BActive Publication Date: 2025-07-18SHANDONG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510622304.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-15
Publication Date
2025-07-18
Estimated Expiration
2045-05-15

AI Technical Summary

Technical Problem

The lack of nonspecific nucleases with high activity and stability under low temperature conditions in the prior art limits their wide application in temperature-sensitive industrial applications such as food processing and biomedicine.

Method used

The nonspecific nuclease dsNuc392 was screened and identified from the deep-sea hot spring metagenome, which has the characteristics of high activity and stability at 40°C. By constructing an expression vector and expressing it in E. coli, the efficient preparation and purification of this enzyme was achieved.

Benefits of technology

dsNuc392 exhibits efficient catalytic ability to DNA and RNA substrates at 40°C, broadening the application potential of nucleases under extreme conditions, and is particularly suitable for nucleic acid degradation in food processing and biomedicine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120118884B_ABST
    Figure CN120118884B_ABST
Patent Text Reader

Abstract

The present invention belongs to the technical fields of enzyme engineering and metagenomics, and relates to a non-specific nuclease dsNuc392 derived from the deep sea and its uses. The amino acid sequence of this enzyme is shown in Sequence Listing SEQ ID NO.1. The non-specific nuclease dsNuc392 provided by the present invention has high activity and stability, can efficiently catalyze DNA and RNA substrates at 40°C, and it is derived from deep sea metagenomic data mining, is a brand-new nuclease, and exhibits unique deep sea adaptability.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical fields of enzyme engineering and metagenomics, and relates to a non-specific nuclease dsNuc392 derived from the deep sea and its uses. Background Art

[0002] As an important biocatalyst, nucleases play a key role in multiple fields such as biopharmaceuticals, food processing, environmental governance, and the feed industry. They are mainly divided into endonucleases and exonucleases, which are responsible for degrading nucleic acids from the inside or the ends of nucleic acid molecules respectively. In the biopharmaceutical field, nucleases are used to remove nucleic acid contamination in the production of recombinant proteins, improving purity and production efficiency; in the food industry, they can be used to produce 5'-flavor nucleotides to improve food flavor; in environmental governance, nucleases help degrade microbial residues in wastewater and improve resource utilization rate. In addition, in the feed industry, nucleases can reduce the content of high-molecular nucleic acids in feed, improve the absorption efficiency of animals for nutrients, and promote the growth of livestock and poultry.

[0003] With the development of biotechnology, important progress has been made in the research of nucleases. Scientists optimize their activity, stability, and tolerance through genetic engineering and protein engineering. Nucleases with extreme environmental adaptability are screened from deep-sea metagenomes to explore their catalytic characteristics under conditions such as low temperature, high temperature, and high salt. At present, there are still research gaps in this field. By tapping the potential of these special nucleases, efficient biocatalytic tools can be provided for biomass conversion, biopharmaceuticals, and environmental governance, promoting their wide application in the industrial field. Summary of the Invention

[0004] The purpose of the present invention is to fill the gaps in the existing technology and provide a non-specific nuclease dsNuc392 mined and identified from the deep-sea hydrothermal vent metagenome. This enzyme is a brand-new enzyme resource obtained through metagenomic data mining and functional identification, and its optimal reaction temperature is 40°C.

[0005] To achieve the above purpose, the technical solution adopted by the present invention is: a non-specific nuclease dsNuc392 derived from the deep sea, whose amino acid sequence is as shown in SEQ ID NO.1 in the sequence listing.

[0006] Preferably, the nucleotide sequence of the gene encoding the non-specific nuclease dsNuc392 is as shown in SEQ ID NO.2 in the sequence listing.

[0007] Preferably, the present invention also provides an expression vector containing the above gene, and the expression vector is a eukaryotic vector, a prokaryotic vector, a plasmid vector, or a viral vector.

[0008] Preferably, the present invention also provides a host cell containing the expression vector, and the host cell is a bacterium.

[0009] Preferably, the present invention also provides an engineered strain, and the engineered strain contains the gene or the expression vector described above.

[0010] The present invention also provides the use of the non-specific nuclease dsNuc392, and this nuclease is used to degrade DNA or RNA, and its optimal temperature is 40 °C.

[0011] The present invention further provides the use of the expression vector, the gene, the host cell, and the engineered strain in the preparation of the non-specific nuclease dsNuc392.

[0012] The non-specific nuclease dsNuc392 provided by the present invention has higher activity and stability compared with the reported nucleases. It can efficiently catalyze DNA and RNA substrates at 40 °C, and this characteristic is relatively rare among similar enzymes. Moreover, it is derived from deep-sea metagenomic data mining and is a brand-new nuclease, showing unique deep-sea adaptability. This characteristic makes it particularly suitable for temperature-sensitive industrial applications, such as nucleic acid degradation in food processing, biopharmaceuticals, and marine environments, broadening the application potential of nucleases under extreme conditions. Description of the Drawings

[0013] Figure 1 It is the plasmid map of pET22b expressing dsNuc392 in the examples of the present invention;

[0014] Figure 2 It is the SDS-PAGE analysis result of purified dsNuc392; among them, M is the protein marker; 1 is the purified dsNuc392;

[0015] Figure 3 It is the schematic diagram of determining nuclease activity by spectrophotometry;

[0016] Figure 4 It is the activity comparison of dsNuc392 and NUC1 catalyzing different substrates. Detailed Embodiments

[0017] For the convenience of understanding this research, the following will combine the drawings and specific examples to describe this research in more detail. However, this research can be implemented in many different forms and is not limited to the embodiments described in this specification. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosed content of this research more thorough and comprehensive.

[0018] The present invention screens from deep-sea metagenomes and obtains a non-specific nuclease, named dsNuc392, which can non-specifically hydrolyze DNA and RNA. The amino acid sequence of this enzyme is shown in Sequence Listing SEQ ID NO.1, and the nucleotide sequence of its encoding gene is shown in Sequence Listing SEQ ID NO.2.

[0019] The following conducts tests and verifications on the functional characteristics and catalytic activity of this enzyme through experiments.

[0020] I. Preparation of the substrate of dsNuc392

[0021] Weigh 0.015 g of calf thymus DNA (D4522, Merck, Darmstadt, Germany), accurate to 0.0001 g, dissolve it in water to make the solution concentration 0.15 mg / ml, and prepare it fresh for use as the reaction DNA substrate for the DNA / RNA non-specific nuclease. Weigh 0.015 g of yeast RNA (R6750, Merck, Darmstadt, Germany), accurate to 0.0001 g, dissolve it in water to make the solution concentration 0.15 mg / ml as the reaction RNA substrate for the DNA / RNA non-specific nuclease.

[0022] II. Preparation of the reaction buffer of dsNuc392

[0023] Weigh 121.14 g of Tris (tris(hydroxymethyl)aminomethane) into a beaker, add about 800 mL of distilled water and dissolve it fully, then transfer it to a 1 L volumetric flask, adjust the pH to 8.0 ± 0.05 with hydrochloric acid (0.1 mol / L), and finally make up the volume with distilled water and shake well.

[0024] III. Analysis of the dsNuc392 gene and protein sequence

[0025] To determine the novelty of the dsNuc392 amino acid sequence, the present invention searches for its homologous proteins in GenBank through online BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and arranges them according to sequence similarity. Table 1 lists the 10 sequences with the highest identity to dsNuc392 in the GeneBank database. The identity of the protein that is evolutionarily closest to dsNuc392 is 56.35%, indicating that the full-length sequence of this protein has not been publicly disclosed and has novelty.

[0026] Table 1. Protein sequences with relatively high identity to dsNuc392 in GeneBank

[0027] GeneBank accession number Amino acids length Identity (%) MBU0791228.1 286 56.35 MEC8850306.1 286 55.95 MAY26273.1 286 55.95 MEN8664622.1 250 54.84 WP_052378665.1 285 54.76 WP_198022010.1 278 47.37 WP_420428973.1 287 46.80 WP_290575638.1 292 46.58 WP_350214478.1 287 46.34 WP_158523245.1 280 46.34 。

[0028] 1. Cloning of dsNuc392 Gene

[0029] The full gene was synthesized based on the dsNuc392 amino acid sequence and codon-optimized for E. coli expression. The synthesized sequence is shown in Sequence Listing SEQ ID NO.1. The dsNuc392 gene fragment was amplified using Nuc-F and Nuc-R as primers. Using pET22b as a template, pET22b was linearly amplified with 22b-F and 22b-R as primers. The primer sequences are shown in Table 2. The PCR amplification conditions were: 98°C for 30 s; 98°C for 10 s, 56°C for 5 s, 72°C for 10 s, for 35 cycles; 72°C for 1 min, and then cooled to 4°C for storage.

[0030] Table 2. Primers for Cloning dsNuc392 into pET22b and Their Sequences

[0031] Primer Primer sequence (5’ - 3’) Serial number Nuc-F ctgcccagccggcgatggccTTATGCTTTGAACAATGTCCACAGC SEQ ID NO.3 Nuc-R cagtggtggtggtggtggtgACGTTCACAACCCTCCGGTT SEQ ID NO.4 22b-F CACCACCACCACCACCACTG SEQ ID NO.5 22b-R GGCCATCGCCGGCTGGGC SEQ ID NO.6 。

[0032] 2. Construction of Expression Vector and Engineering Strain

[0033] The obtained dsNuc392 fragment and the linearized pET22b vector fragment were ligated using a seamless cloning kit (ClonExpress II One Step Cloning Kit, Novoprotein, Nanjing) to form the expression vector pET22b-dsNuc392. The map is as Figure 1 shown, and transformed into the E. coli expression strain Escherichia coli BL21(DE3) pLysS to obtain the expression strain E. coli dsNuc392. The strain E. coli dsNuc392 expresses a fusion protein with a pelB signal peptide at the N-terminus and a His tag at the C-terminus. dsNuc392 can be obtained by Ni-NTA affinity chromatography for activity detection.

[0034] 3. Expression and Purification of dsNuc392

[0035] Pick E. coli dsNuc392 monoclonal colonies into the medium (containing 50 μg / mL ampicillin and 20 μg / ml chloramphenicol double resistance) for seed culture, and culture in a shaker at 37°C and 220 rpm for 8 - 12 h; the scale of the expanded culture is 1:500 - 1:100, and culture in a shaker at 37°C and 220 rpm for about 4 - 6 h. When OD 600When it reaches 0.8 - 1.2, add IPTG to start induction, and the final concentration of IPTG can be 0.2 - 1 mM. The induction conditions are 18 - 30 °C for 18 - 24 h. Centrifuge the induced bacterial solution at 4 °C at 3000 - 6000 g for 10 minutes to collect the bacterial cells.

[0036] Resuspend the collected bacterial cells with 50 mL of pre - cooled lysis buffer, and use an ultrasonic crusher to lyse the bacterial cells in an ice bath. The lysis program is a power of 290 W, ultrasonic fragmentation for 4 s, stop for 8 s, and the total ultrasonic time is 15 min. Centrifuge at 4 °C at 13000 g for 60 min to obtain the supernatant. Incubate the supernatant with 3 mL of Ni - NTA resin at 4 °C for 1 hour to allow the target protein to bind fully to the resin. Wash successively with 15 mL of lysis buffer and 15 mL of wash buffer, and elute with 5 mL of elution buffer to collect the target protein. Concentrate the eluate to 2.5 mL using an Ultracel - 30K ultrafiltration tube. Equilibrate the desalting column PD - 10 with 25 mL of desalting buffer, add 2.5 mL of the concentrated protein solution to the desalting column PD - 10, add 3.5 mL of desalting buffer to collect the protein, and the collected effluent is dsNuc392. Concentrate dsNuc392 to 1 mL using an Ultracel - 30K ultrafiltration tube, measure the absorbance at 280 nm with a micro - spectrophotometer to determine the concentration of the purified protein, and take 5 μL of the protein for SDS - PAGE detection. The detection results are as Figure 2 shown. Quick - freeze the remaining protein with liquid nitrogen and store it at - 80 °C.

[0037] The formulations of each buffer for the above protein purification are as follows:

[0038] Lysis buffer (1 L): 7.8 g of NaH2PO4·3H2O, 17.532 g of NaCl, 100 g of glycerol, 0.6808 g of imidazole, pH 8.0.

[0039] Wash buffer (1 L): 7.8 g of NaH2PO4·3H2O, 17.532 g of NaCl, 100 g of glycerol, 1.3616 g of imidazole, pH 8.0.

[0040] Elution buffer (1 L): 7.8 g of NaH2PO4·3H2O, 17.532 g of NaCl, 100 g of glycerol, 17.02 g of imidazole, pH 8.0.

[0041] Desalting buffer (1 L): 7.8 g NaH2PO4·3H2O, 17.532 g NaCl, 100 g glycerol, pH 8.0.

[0042] IV. Hydrolysis reaction of dsNuc392 on DNA and RNA at different temperatures

[0043] For the nuclease activity assay, calf thymus DNA and yeast RNA were used as substrates. After the substrates were hydrolyzed, the nucleic acid structure disintegrated, the base stacking effect decreased, the ultraviolet absorption of single-stranded or single nucleotides increased, and at the same time, the degraded DNA and RNA fragmented, and the exposure of bases also caused an increase in absorption. The enzyme activity was compared by measuring the increment of the absorption peak at 260 nm. The process is as Figure 3 shown.

[0044] In the present invention, the enzyme activity was determined by spectrophotometry. The specific method is as follows: At pH 8.0 and 40 °C, a 3 ml reaction system included 0.5 mL of appropriately diluted enzyme solution, 1.5 mL of nuclease substrate, and 1 mL of buffer. After reacting for 10 min, the absorbance of the sample was measured at a wavelength of 260 nm. The blank control group was at pH 8.0 and 40 °C. First, 0.5 mL of water was added, then 1.5 mL of nuclease substrate was supplemented, and finally 1 mL of buffer was added. After incubating in a water bath for 10 min, the absorbance of the sample was measured at a wavelength of 260 nm. One enzyme activity unit (U) was defined as the amount of enzyme required to increase the absorbance of the reaction solution at 260 nm by 0.001 in 1 min under the conditions of 40 °C and pH 8.0.

[0045] One of the most representative proteins for DNA / RNA non-specific nucleases is NUC1, which was isolated from Serratiamarcescens , and showed high activity towards both DNA and RNA substrates. In this example, calf thymus DNA and yeast RNA were used as reaction substrates respectively to compare the activities of dsNuc392 and NUC1. 0.5 mL of dsNuc392 and NUC1 were incubated with 1.5 mL of DNA and RNA substrates together with 1 mL of buffer at pH 8.0 and 40 °C for 10 min, and then the absorbance of the sample was measured at a wavelength of 260 nm. The nuclease activity was calculated according to Equation 1.

[0046] The calculation formula for nuclease activity is as follows:

[0047] Equation 1;

[0048] In the formula, is the nuclease activity, U / mL; is the difference in absorption values measured at 260 nm between the test tube and the blank control tube; is the dilution factor; 1000 is the conversion factor between the original absorbance value and the specified absorbance of 0.001 in the activity regulation; 10 is the conversion factor between the reaction time and the activity unit definition.

[0049] The reaction results are as Figure 4 shown. Compared with NUC1, dsNuc392 showed higher activities towards both DNA and RNA substrates, reaching 355.56 U / mg and 333.33 U / mg, while NUC1 was only 336.28 U / mg and 287.63 U / mg, demonstrating its great application potential in the food processing and biomass conversion industries.

Claims

1. A non-specific nuclease dsNuc392 derived from the deep sea, characterized in that, The amino acid sequence is as shown in Sequence Listing SEQ ID NO.

1.

2. A gene encoding the non-specific nuclease dsNuc392 as claimed in claim 1, characterized in that, The nucleotide sequence is as shown in Sequence Listing SEQ ID NO.

2.

3. An expression vector containing the gene according to claim 2, characterized in that, The expression vector is a eukaryotic vector, a prokaryotic vector, a plasmid vector or a viral vector.

4. A host cell comprising the expression vector according to claim 3, characterized in that, The host cell is a bacterium.

5. An engineered strain, characterized in that, The engineered strain contains the gene described in claim 2 or the expression vector described in claim 3.

6. Use of the non-specific nuclease dsNuc392 according to claim 1, characterized in that: This nuclease is used to degrade DNA or RNA, and its optimal temperature is 40 °C.

7. Use of the gene described in claim 2, the expression vector described in claim 3, the host cell described in claim 4 or the engineered strain described in claim 5 in the preparation of the non-specific nuclease dsNuc392.

Citation Information

Patent Citations

  • PET hydrolase dsPETase01 from deep sea and application of PET hydrolase dsPETase01

    CN116904422A

  • Thermostable nuclease

    US20160053242A1