Plutella xylostella endogenous promoter and application thereof
By developing the endogenous EF1α promoter of Diamondella, the problem of lack of efficient promoters when expressing exogenous genes in Diamondella cells was solved, efficient exogenous gene expression in Diamondella cells was achieved, and a stable expression system was constructed to support a variety of research needs.
Patent Information
- Application Number
- CN202510276394.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-10
- Publication Date
- 2025-06-10
AI Technical Summary
When expressing exogenous genes in diamondback moth cells, it is difficult to meet the need to express multiple genes simultaneously.
A endogenous EF1α promoter of Diamond Moth was developed. By extracting the total DNA of Diamond Moth and amplifying it with specific primers, the EF1α promoter sequence was obtained and inserted into the expression vector to construct a stable expression system of Diamond Moth.
The endogenous EF1α promoter of Diamond moth can efficiently drive exogenous gene expression, and realizes a stable expression system in Diamond moth cells, providing a basis for gene function research, insect pathology, physiology and drug screening.
Smart Images

Figure CN120118904A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and specifically relates to an endogenous promoter of Plutella xylostella and its application. Background Art
[0002] Plutella xylostella (Linnaeus) belongs to the pest of Lepidopter Plutellidae, and is widely distributed all over the world. It mainly harms cruciferous vegetables. The annual cost for prevention and control and the losses caused by it exceed 1 billion US dollars globally. Due to the long-term unreasonable use of chemical insecticides, Plutella xylostella has currently developed high-level resistance to a variety of insecticides, and it is an ideal insect for studying the molecular mechanism of pest resistance. At the same time, finding the key genes that regulate the physiological activities of Plutella xylostella also provides a new solution for developing green prevention and control strategies for Plutella xylostella by manipulating these genes (targets), and is the key breakthrough point to solve the current problem of preventing and controlling Plutella xylostella.
[0003] Cells are the most basic functional units of organisms. Since the 1960s, hundreds of immortal insect cell lines have been established and widely used in research such as recombinant protein expression, insect physiology, pathology, and drug development. The first Plutella xylostella cell line BCIRL-PX2-HNU3 in China was established by Professor Chen Quhou of Central China Normal University in the 1980s. After that, multiple Plutella xylostella cell lines have been successively established and widely used in the research of Plutella xylostella physiology and pathology. With the development of target-based drug development technology, the traditional method of measuring insecticidal toxicity by raising Plutella xylostella is difficult to meet the needs of drug development. Expressing the required target genes in cells and carrying out cell biology detection methods provide the possibility for high-throughput drug screening.
[0004] A complete gene expression unit in eukaryotes at least includes a promoter sequence, a coding region, and a terminator sequence, etc. A promoter is a DNA sequence that RNA polymerase recognizes, binds to, and starts transcription. It contains conserved sequences required for specific binding of RNA polymerase and transcription initiation, and most are located upstream of the coding region of the structural gene; the promoter and transcription factors together constitute the switch of gene expression and determine the activity of the gene. Compared with the high conservation of codons and terminators, each gene in eukaryotes has a specific promoter to regulate gene expression, and the activities of the same promoter in different cells vary greatly. To achieve the high-efficiency expression of a target gene in a specific cell line, it is necessary to use the promoter sequence supported by this cell line. Currently, the OpIE2 promoter and the AcIE1 hr5 promoter are commonly used promoters in insect expression vectors, but the limited promoter resources are difficult to meet the need of simultaneously expressing multiple genes in Plutella xylostella.
[0005] Therefore, this study developed an endogenous promoter that supports the efficient driving of exogenous gene expression in Plutella xylostella cells, solving the problem of the lack of an efficient promoter when expressing exogenous genes in Plutella xylostella cells. Summary of the Invention
[0006] Aiming at the technical problems in the prior art, the present invention provides a Plutella xylostella endogenous promoter and its application. The Plutella xylostella endogenous EF1α promoter provided by the present invention can efficiently drive the expression of exogenous genes, construct a stable expression system for Plutella xylostella, and provide a basis for carrying out research on gene function, insect pathology, physiology, and drug screening.
[0007] In the first aspect of the present invention, a Plutella xylostella endogenous EF1α promoter is provided, and the Plutella xylostella endogenous EF1α promoter is any one of the following a1)-a3):
[0008] a1) A promoter with a nucleotide sequence as shown in SEQ ID No.1;
[0009] a2) A promoter with the same biological function obtained by substituting and / or deleting and / or adding some bases to the promoter sequence as shown in SEQ ID No.1;
[0010] a3) A promoter with 80% or more homology to the promoter sequence as shown in SEQ ID No.1, derived from Plutella xylostella and having the same biological function.
[0011] In the second aspect of the present invention, a preparation method of the above Plutella xylostella endogenous EF1α promoter is provided, including the following steps:
[0012] Extract the total DNA of Plutella xylostella and amplify it using a primer set;
[0013] Among them, the primer set includes an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is as shown in SEQ ID No.4, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.5.
[0014] In the third aspect of the present invention, a Plutella xylostella expression vector is provided. The expression vector is obtained by replacing the CMV promoter on the pEGFP-N1 vector with the above Plutella xylostella endogenous EF1α promoter, and its nucleotide sequence is as shown in SEQ ID No.2. The CMV promoter on the pEGFP-N1 mammalian expression plasmid (Sangon Biotech) was replaced with the EF1α promoter sequence to construct an insect expression plasmid (pEF1α-EGFP-N1) that can express GFP protein in insect cells.
[0015] In the fourth aspect of the present invention, there is thus provided a Plutella xylostella expression plasmid, wherein the CMV promoter on the pEGFP-N1 vector is replaced with the above-mentioned endogenous Plutella xylostella EF1α promoter, and the Kir2A coding gene is inserted downstream of the EF1α promoter, and its nucleotide sequence is as shown in SEQ ID No.3; its encoded amino acid sequence is as shown in SEQ ID No.8.
[0016] In the fifth aspect of the present invention, there is provided the application of the above-mentioned endogenous Plutella xylostella EF1α promoter in expressing foreign genes in Plutella xylostella cells or tissues to construct a stable expression system.
[0017] In the sixth aspect of the present invention, there is provided the application of the above-mentioned endogenous Plutella xylostella EF1α promoter in the electrophysiological detection of the Plutella xylostella Kir2A coding gene. The coding sequence of the Plutella xylostella inward rectifier potassium channel 2A (Kir2A) gene was integrated on the pEF1α-EGFP-N1 vector, and a functional Kir2A channel was successfully expressed in Plutella xylostella cells by using this vector, solving the problem that it is difficult to measure the Kir2A channel by electrophysiology in current insects.
[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0019] 1. In the present invention, the EF1α promoter sequence was inserted into the pGL3-Basic vector (Promega), and it was found by dual luciferase activity assay that the activity of this promoter in Plutella xylostella cells is relatively high, and it is comparable to the AcIE1 hr5 promoter.
[0020] 2. Based on the pEGFP-N1 expression vector, the present invention obtained the insect expression vector pEF1α-EGFP-N1 that can express fluorescent protein in Plutella xylostella cells by replacing the CMV promoter with the EF1α promoter.
[0021] 3. In the present invention, the Plutella xylostella Kir2A coding gene was inserted downstream of the EF1α promoter to construct the pEF1α-PxKir2A insect expression plasmid. By transfecting Plutella xylostella cells, the channel current of Plutella xylostella Kir2A was successfully recorded by electrophysiological techniques. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 It is a schematic diagram of the Plutella xylostella EF1α promoter and the activity analysis of different length truncations.
[0023] Among them, A is a schematic diagram of the candidate sequence of the PxEF1α promoter; B is the 5' truncation of the PxEF1α promoter; C is the transcriptional activity of the 3' truncation of the PxEF1α promoter in Px cells.
[0024] Note 1: The transcription start site (TSS) is marked as "+1", the bases upstream are marked as "-", and the bases downstream are marked as "+". The numbers with arrows specify the 5' and 3' positions of the corresponding nucleotides.
[0025] Note 2: Schematic diagrams of luciferase expression constructs with different fragments of the PxEF1α gene promoter region are shown on the left, and the relative driving activities based on dual-luciferase activity assays are shown on the right. The normalized values are expressed as mean ± standard deviation (SD). The significance of multiple comparisons is identified by lowercase letters, and the difference between two groups of data is determined by the student's t-test, **p < 0.01; ***p < 0.001. n ≥ 3.
[0026] Figure 2 Comparison of the transcriptional activities of the PxEF1α promoter with the BmA3, AcIE1 hr5 and OpIE2 promoters in various insect cell lines.
[0027] The promoter was ligated to the luciferase reporter gene, and the plasmid vector was transfected into different insect cell lines. After 48 hours of transfection, the luciferase activity was measured. Among them, A represents the Px cell line; B represents the Sf9 cell line; C represents the Sf9 cell line; D represents the Ha cell line.
[0028] Note 3: The normalized values are expressed as mean ± standard deviation (SD). ***p < 0.001; n.s., not significant. n ≥ 3.
[0029] Figure 3 Expression of the diamondback moth EF1α promoter-driven green fluorescent protein (GFP) in different insect cells. Among them, the scale bar length is 200 μm.
[0030] Figure 4 Effect of PxKir2A expression on the mRNA levels of other Kir subunits and the electrophysiological properties of the PxKir2A channel in Px cells.
[0031] Among them, A is the relative expression levels of PxKir1, PxKir2A, PxKir3A, PxKir3B, and PxKir2B in Px cells, and the data were normalized using endogenous EF1α as an internal reference. The difference between the data was determined by the student's t-test, ***p < 0.001; B represents the current recorded from Px cells expressing the PxKir2A channel; C is the 2+ Effect on the current-voltage curve of PxKir2-expressing cells (n = 6 - 10), Control is the current-voltage curve in cells not transfected with the PxKir2 expression vector; D represents the concentration-inhibition response curve of VU625 and VU590 obtained from the patch clamp experiment (n = 6 - 10). Detailed implementation manners
[0032] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.
[0033] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the technologies or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified. Unless otherwise specified, the primer sequences used in the following embodiments are all synthesized by Shanghai Bioengineering Company.
[0034] Example 1 Expression of GFP driven by EF1α promoter in different insect cell lines
[0035] 1.1 Plutella xylostella cell line
[0036] The Plutella xylostella was derived from the Plutella xylostella for bioassay purchased from Keyun Biology in 2017. Referring to the method described by Professor Chen Quhou of Central China Normal University (Chen Quhou, Mccarthy, Ignofo. Establishment of a cell line of the diamondback moth (Plutella xylostella) in the family Plutellidae [J]. Journal of Central China Normal University (Natural Science Edition), 1983, (03): 102-110. DOI: 10.19603 / j.cnki.1000-1190.1983.03.014.), Plutella xylostella embryonic cells were isolated from Plutella xylostella eggs. After one year of culture, a Plutella xylostella cell line (Px) was successfully established. The ovarian cell line of Spodoptera frugiperda (Sf9) was purchased from Zhongqiao Xinzhou Company. The ovarian cell lines of Trichoplusia ni (Tn5B1-4, Hi5) and the embryonic cell line of Helicoverpa armigera (QB-Ha-E5, Ha) were kindly provided by Professor Hong Huazhu of Central China Normal University and were cultured and passaged in the laboratory. The above cells were all cultured in a constant temperature incubator at 28°C. Among them, Px, Sf9 and Hi5 cells were cultured in TNM-FH insect medium (T1032, Sigma-Aldrich) supplemented with 10% fetal bovine serum, and Ha cells were cultured in Sf-900 TM II SFM medium (10902088, Thermo Fisher Scientific).
[0037] 1.2 Construction of pEF1α-EGFP expression vector
[0038] Five 3rd instar larvae of Plutella xylostella that are 2 days old were taken, and the total DNA of the samples was extracted using the DNAiso reagent (solution type, catalog number: 9770A) from TaKaRa as a template. Using PhantaMax Ultra-Fidelity DNA Polymerase, the upstream primer PxEF1a_pF (5'-3'): TCTGACTCGCTTCTCTCTCGCT (SEQ ID No.4) and the downstream primer PxEF1a_pR (5'-3'): TCGAGATCTTGGATTATCTAGAACAATGCA (containing BglII cleavage site) (SEQ ID No.5), the EF1α promoter sequence of Plutella xylostella (SEQ ID No.1) was amplified. Subsequently, the CMV promoter sequence on the pEGFP-N1 vector was replaced with the EF1α promoter sequence by methods such as homologous recombination or double digestion (AseI / BglII). The obtained expression vector was named pEF1α-EGFP-N1 (SEQ ID No.2).
[0039] 1.3 Transfer the recombinant plasmid into insect cells
[0040] Insect cells were seeded in 24-well plates at a density of 1.5×10 5 cells / well one day in advance and cultured overnight for plasmid transfection. During transfection, 0.6 μg of pEF1α-EGFP-N1 and 2 μL of Lipofectamine 2000 (Thermo Fisher Scientific) were diluted separately with 50 μL of Grace medium without additives (Thermo Fisher Scientific), and left standing at room temperature for 5 minutes. Then the two were mixed evenly, and after standing at room temperature for 25 min, they were slowly dropped into the well plates after changing the medium to Grace medium without additives. Three replicates were set for each type of cell. After culturing at 28 °C for 4 hours, Px, Sf9, and Hi5 cells were cultured in TNM-FH insect medium supplemented with 10% fetal bovine serum for 36 hours, and Ha cells were cultured in Sf-900 TM II SFM medium containing 7% fetal bovine serum for 36 hours.
[0041] 1.4 Fluorescence observation
[0042] The insect cells after 36 hours of culture were taken out, and the expression of EGFP driven by EF1α was observed under a fluorescence microscope and photographed. An inverted fluorescence microscope was used to capture images to ensure the consistency of the exposure time and excitation light intensity throughout the imaging process. The results are as Figure 3 , the PxEF1α promoter can produce strong fluorescence signals in Px cells and weak fluorescence signals in Sf9, Hi5, and Ha cells. It shows that the PxEF1α promoter has certain activity in all four tested cell types, but has the highest activity in Px cells.
[0043] Example 2: Study on the Electrophysiological Characteristics of the Kir2A Channel in Plutella xylostella
[0044] 2.1 The Plutella xylostella cells are the same as described in 1.1
[0045] 2.2 Construction of the Kir2A Expression Plasmid
[0046] Take the head samples of 5 adult Plutella xylostella, extract the total RNA using the Novoprotein RNA simple isolation reagent, reverse transcribe it into cDNA using the HiScript IV First Strand cDNA Synthesis Kit (+gDNAwiper), use the cDNA as a template, and use the Phanta Max Super-Fidelity DNA Polymerase with the upstream primer PxKir2A_F (5'-3'): CCGGGATCCGCCACCATGAATGAGATCAACTCTAC (containing BamHI cleavage site) (SEQ ID No.6) and the downstream primer PxKir2A_R (5'-3'): GTCGCGGCCGCTTATAAGGTGACAGTGAAGTC (containing NotI cleavage site) (SEQ ID No.7) to amplify the coding sequence of Kir2A in Plutella xylostella. Then, through the method of homologous recombination or enzymatic digestion (BamHI / NotI), the CDS region of Kir2A is integrated onto the expression plasmid pEF1α-EGFP-N1 vector, and the new plasmid obtained is named pEF1α-PxKir2A plasmid (the gene and encoded amino acid sequence are shown in SEQ ID No.3). To avoid the influence of EGFP co-expression on the function of PxKir2A, the coding sequence of EGFP was deleted when constructing the recombinant vector.
[0047] 2.3 Plasmid Transfection
[0048] As described in 1.3, mix the pEF1α-PxKir2A and pIE2-EGFP-N1 plasmids (containing 0.4 μg pEF1α-PxKir2A and 0.2 μg pIE2-EGFP-N1) and transfect the Plutella xylostella cells. After the transfection is completed, passage the Plutella xylostella cells into a 12-well plate containing a coverslip. Let the cells adhere and grow on the coverslip, continue to culture for 24 hours, and take out the coverslip with adhered cells for electrophysiological testing.
[0049] 2.4 Electrode Preparation and Buffer Solution Preparation
[0050] A glass electrode was pulled from a borosilicate glass capillary (BF150 - 86 - 10, Sutter) using a PC - 10 puller (NARISHIGE). Then the electrode tip was heat - polished with a MICRO FORGE MF - 900 (NARISHIGE). For convenience in subsequent operations, the electrode resistance was controlled between 2.5 and 4.5 MΩ. The intracellular solution was prepared (in mM): 140 KCl, 4 NaCl, 10 HEPES, 0.15 CaCl 2 , 2 MgCl 2 , 2 Na - ATP, and the pH was adjusted to 7.3 with KOH and the osmotic pressure was adjusted to 318 mOsm / kg with sucrose. The composition of the cell bath solution (in mM): 135 NaCl, 5 KCl, 1 CaCl 2 , 1 MgCl 2 , 10 glucose, 10 HEPES, 0.33 NaH 2 PO4, 2 sodium pyruvate, and the pH was adjusted to 7.3 with NaOH and the osmotic pressure was adjusted to 320 mOsm / kg with sucrose.
[0051] 2.5 Whole - cell patch - clamp recording
[0052] An Axon MultiClamp 700B patch - clamp amplifier from Molecular Devices, USA, an AxonDigidata 1500B analog - to - digital converter, and Clampfit 10.6 software were used for whole - cell patch - clamp recording and analysis. The cells were held at a holding potential of - 20 mV and stepped from - 120 mV to + 20 mV in 20 - mV increments within 120 ms. The recordings were sampled at 10 kHz, filtered at 2 kHz, and transmitted to a computer for processing, with about 75% series resistance compensation. The recordings were made at room temperature (25 °C). First, under a fluorescence microscope, cells with green fluorescence were selected for measurement. After recording stable whole - cell currents, known blockers barium ions, TEA, and 4 - AP were used to characterize the electrophysiological properties of PxKir2A, and the inhibitory effects of the Aedes aegypti Kir1 channel inhibitors VU590 and VU625 on the PxKir2A channel were tested.
[0053] 2.6 Data analysis
[0054] The collected data were processed and curve-fitted using Clamfit 10.6 and Origin 2018 software, and the data were plotted as mean ± standard error. Student's t-test or one-way ANOVA was used to determine the significance of differences between the experimental group and the control group. The results showed that the expression level of the PxKir2A gene in Px cells increased by approximately 196-fold compared with pEF1α-EGFP transfection, while the mRNA levels of PxKir1, PxKir2B, PxKir3A, and PxKir3B were not significantly different from those of the control group ( Figure 4 A). The PxKir2A channel could be activated at a membrane potential of -120 mV. During depolarizing voltage steps, the inward current gradually decreased, while no obvious inward current was observed in untransfected Px4-2 cells ( Figure 4 B). The non-specific inhibitor of Kir channels, Ba 2 +, almost completely inhibited the current of the PxKir2A channel at a final concentration of 5 mM ( Figure 4 C). The Aedes aegypti Kir1 inhibitors VU625 and VU590 could efficiently inhibit the PxKir2A channel. The half-maximal inhibitory concentration (IC 50 ) of VU625 was 0.1511 μM (R 2 = 0.9539), while the IC50 of VU590 was 0.6336 μM (R 2 = 0.9555) ( Figure 4 D).
[0055] As described above, only the preferred specific embodiments of the present invention are provided, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention, according to the technical solution and inventive concept of the present invention, makes equivalent substitutions or changes, and should be covered by the protection scope of the present invention.
Claims
1. A diamondback moth endogenous EF1α promoter, characterized in that: The endogenous EF1α promoter of Plutella xylostella is any one of the following a1)-a3): a1) a promoter with a nucleotide sequence as shown in SEQ ID No.1; a2) a promoter having the same biological function obtained by substituting and / or deleting and / or adding some bases of the promoter sequence shown in SEQ ID No. 1; a3) A promoter having 80% or more homology with the promoter sequence shown in SEQ ID No. 1, which is derived from Plutella xylostella and has the same biological function.
2. A method for preparing the endogenous EF1α promoter of Plutella xylostella as claimed in claim 1, characterized in that: The steps include: The total DNA of Plutella xylostella was extracted and amplified using the primer set; The primer set includes an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID No.4, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.
5.
3. A diamondback moth expression vector, characterized in that: The expression vector is obtained by replacing the CMV promoter on the pEGFP-N1 vector with the endogenous EF1α promoter of Plutella xylostella as shown in claim 1, and the nucleotide sequence thereof is shown in SEQ ID No.
2.
4. A diamondback moth expression plasmid, characterized in that: The expression plasmid is obtained by replacing the CMV promoter on the pEGFP-N1 vector with the endogenous EF1α promoter of Plutella xylostella as shown in claim 1, and inserting the Kir2A coding gene downstream of the EF1α promoter. The nucleotide sequence of the plasmid is shown in SEQ ID No.
3.
5. The diamondback moth expression plasmid according to claim 4, characterized in that The encoded amino acid sequence is shown in SEQ ID No.
8.
6. Use of the endogenous EF1α promoter of Plutella xylostella as claimed in claim 1 in expressing foreign genes in Plutella xylostella cells or Plutella xylostella tissues to construct a stable expression system.
7. Use of the endogenous EF1α promoter of Plutella xylostella as claimed in claim 1 in electrophysiological detection of the gene encoding Kir2A of Plutella xylostella.