A pearl millet sterility-related rpl16 gene and its application

Abstract

The present invention belongs to the field of biotechnology and specifically relates to a rpl16 Gene and its application, specifically, the present invention protects rpl16 The application of the gene in cultivating sterile rice lines. rpl16 Overexpression of the gene in rice can cause rice pollen abortion, thereby achieving rice male sterility, shortening the breeding cycle, improving breeding efficiency, and providing theoretical guidance for the cultivation of new male sterile varieties.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and specifically relates to a rpl16 Genes and their applications. Background Art

[0002] Pennisetum glaucum (L.)R.Br is an annual herb of the genus Pennisetum in the Poaceae family. It is native to north-central Africa and is the sixth largest cereal crop in the world. The content of essential amino acids and unsaturated fats in pennisetum seeds is higher than that in corn and millet, and the stems have a high content of soluble sugar and good palatability. With the Royal Gu sterile lines 'Tift23A' and 'Tift23DA' as the female parents, there are only two intraspecific hybrids of the genus Pennisetum that have passed the national approval, namely 'Ningza No. 3' American Pennisetum and 'Ningza No. 4' American Pennisetum. With the Royal Gu sterile line 'Tift23A' as the female parent and Elephant Grass as the male parent, there are two three-line complementary interspecific hybrids: 'Hybrid Pennisetum' and 'Bonde No. 1' Hybrid Pennisetum. The above four three-line complementary intraspecific hybrids and interspecific hybrids of Pennisetum can be produced as commercial seeds, and all have obvious hybrid advantages. However, since the existing nationally approved three-line complementary hybrid seed production of Pennisetum varieties is mainly based on the introduced Royal Gu sterile lines, it has become a "bottleneck" problem in the hybrid breeding of Pennisetum.

[0003] Anthers are the male reproductive organs of plants, and their normal development is crucial for flowering and seed formation. Mitochondria are the energy factories of plant cells. Mitochondrial gene deletion, recombination, or rearrangement can cause cytoplasmic male sterility. Defects in mitochondrial functional genes usually affect plant respiratory metabolism, which in turn affects reactive oxygen metabolism. Excessive accumulation or reduction of reactive oxygen species can lead to abnormal programmed death of the anther tapetum, resulting in pollen abortion. Mitochondrial gene deletion, recombination, or rearrangement can all cause cytoplasmic male sterility. Therefore, the discovery of sterility genes is of great significance for the creation of sterile materials.

[0004] As a monocotyledonous model plant, rice boasts a highly efficient genetic transformation system. Transgenic rice can be obtained in just 2-3 months, and its genetic background is clear, eliminating interference from environmental or epigenetic factors. This allows for direct identification of gene function, improved experimental reproducibility, and convenient phenotypic observation and analysis. Therefore, prioritizing functional studies of sterility-related genes with rice as a model plant allows for rapid, cost-effective, and reliable analysis of gene function. Leveraging mature resources and platforms, this allows for rapid translation of theory into practice. Summary of the Invention

[0005] In view of the deficiencies in the prior art, the object of the present invention is to provide a method for rpl16(Ribosomal protein L16-like) gene and its application. rpl16 Overexpression of the gene in rice causes rice pollen abortion, thereby achieving rice male sterility, shortening the breeding cycle, and improving breeding efficiency. At the same time, it provides theoretical guidance for the cultivation of new male sterile germplasm of new Poaceae plants.

[0006] The present invention is achieved through the following technical solutions:

[0007] In the first aspect, the present invention first provides a method for rpl16 The purpose of genes.

[0008] In a specific embodiment, the present invention provides rpl16 The gene is used in any of the following (A1)-(A8):

[0009] (A1) Application in reducing plant pollen vigor;

[0010] (A2) Use in the preparation of products for reducing plant pollen viability;

[0011] (A3) Application in reducing the number of spikelets in plants;

[0012] (A4) Use in the preparation of a product for reducing the number of spikelets in plants;

[0013] (A5) Application in reducing the number of grains per spike in plants;

[0014] (A6) Use in the preparation of a product for reducing the number of grains per ear in a plant;

[0015] (A7) Application in breeding sterile plant lines;

[0016] (A8) Use in the preparation of products for cultivating sterile plant lines.

[0017] In a specific embodiment, the plant is a cereal crop.

[0018] In a more specific embodiment, the cereal crop is rice, Pennisetum plant, etc., more specifically rice, pearl millet, etc.

[0019] described rpl16 The gene is any of the following:

[0020] 1) The nucleotide sequence is the gene shown in SEQ ID No. 1;

[0021] 2) A gene having 75% or more identity with the nucleotide sequence defined in 1);

[0022] 3) A gene that hybridizes under stringent conditions to the nucleotide sequence defined in 1) or 2).

[0023] As used herein, the term "identity" refers to sequence similarity to a naturally occurring nucleic acid sequence. "Identity" includes nucleotide sequences that are 75% or greater, 85% or greater, 90% or greater, or 95% or greater identical to the nucleotide sequences of the present invention. Identity can be assessed visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to assess the identity between related sequences. The aforementioned 75% or greater identity may also be 80%, 85%, 90%, or 95% or greater identity.

[0024] The present invention overexpresses rpl16 By directly using the male sterile rice gene, the traditional hybrid breeding process of multi-generation self-pollination and backcrossing was avoided, which significantly shortened the breeding cycle and improved the breeding efficiency.

[0025] rpl16 Gene overexpression has successfully created new male sterile rice lines, enriched the types of rice male sterile lines, provided more options for hybrid rice breeding, and helped to cultivate new high-yield, high-quality rice varieties.

[0026] In a second aspect, the present invention further provides the use of the biomaterial related to the aforementioned gene in any one of the following (A1)-(A8):

[0027] (A1) Application in reducing plant pollen vigor;

[0028] (A2) Use in the preparation of products for reducing plant pollen viability;

[0029] (A3) Application in reducing the number of spikelets in plants;

[0030] (A4) Use in the preparation of a product for reducing the number of spikelets in plants;

[0031] (A5) Application in reducing the number of grains per spike in plants;

[0032] (A6) Use in the preparation of a product for reducing the number of grains per ear in a plant;

[0033] (A7) Application in breeding sterile plant lines;

[0034] (A8) Use in the preparation of products for cultivating sterile plant lines.

[0035] In a specific embodiment, the plant is a cereal crop.

[0036] In a more specific embodiment, the cereal crop is rice, Pennisetum plant, etc., more specifically rice, pearl millet, etc.

[0037] In a specific embodiment, the biological material is any one of the following:

[0038] (B1) proteins encoded by the genes mentioned above;

[0039] (B2) expression cassette containing the gene described above;

[0040] (B3) a recombinant vector containing the gene described above, or a recombinant vector containing the expression cassette described in (B2);

[0041] (B4) a recombinant microorganism containing the gene described above, or a recombinant microorganism containing the expression cassette described in (B2), or a recombinant microorganism containing the recombinant vector described above;

[0042] (B5) A transgenic plant cell line containing the gene described above, or a transgenic plant cell line containing the expression cassette described in (B2);

[0043] (B6) transgenic plant tissue containing the gene described above, or transgenic plant tissue containing the expression cassette described in (B2);

[0044] (B7) A transgenic plant organ containing the gene described above, or a transgenic plant organ containing the expression cassette described in (B2).

[0045] In a specific embodiment, the protein is any of the following proteins:

[0046] (C1) a protein having an amino acid sequence as shown in SEQ ID No. 2;

[0047] (C2) a fusion protein obtained by connecting a tag protein to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2;

[0048] (C3) a protein having the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No. 2;

[0049] (C4) A protein having 75% or more homology with the amino acid sequence shown in SEQ ID No. 2 and having the same function.

[0050] In order to facilitate purification or detection of the protein in (C1), a tag protein may be connected to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2.

[0051] In a specific embodiment, the tag protein includes but is not limited to: GST (glutathione sulfhydryl transferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, EGFP (enhanced green fluorescent protein), ECFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0052] In a more specific embodiment, the present invention uses EGFP as a tag protein.

[0053] In a specific embodiment, in (C3), the substitution and / or deletion and / or addition of one or several amino acid residues is the substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0054] In a specific embodiment, in (C3), the protein can be artificially synthesized, or its encoding gene can be synthesized first and then biologically expressed.

[0055] In a specific embodiment, in (C3), the protein coding gene can be obtained by deleting one or several amino acid residue codons in the DNA sequence shown in SEQ ID No. 1, and / or performing one or several base pair missense mutations, and / or linking the coding sequence of the tag protein shown above to its 5′ end and / or 3′ end.

[0056] In a specific embodiment, "homology" includes amino acid sequences having 75% or higher, or 80% or higher, or 85% or higher, or 90% or higher, or 95% or higher homology to the amino acid sequence shown in SEQ ID No. 2 of the present invention.

[0057] In a specific embodiment, the vector is well known to those skilled in the art and can be a plasmid, cosmid, phage or viral vector, etc. In the present invention, pEXT06 / g is used as the vector.

[0058] In a specific embodiment, the microorganism can be a fungus or a bacterium, such as Escherichia coli, Agrobacterium, etc., more specifically, Escherichia coli DH5α and Agrobacterium EHA105.

[0059] In a third aspect, the present invention provides a method for cultivating a sterile plant line by increasing the rpl16 The expression level of the gene is achieved, rpl16 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0060] In a fourth aspect, the present invention provides a method for reducing plant pollen vigor, wherein the method increases the vigor of pollen in the target plant. rpl16 The expression level of the gene is achieved, rpl16 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0061] In a fifth aspect, the present invention provides a method for reducing the number of spikelets in a plant, said method comprising increasing the number of spikelets in the target plant. rpl16 The expression level of the gene is achieved, rpl16 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0062] In a sixth aspect, the present invention provides a method for reducing the number of grains per ear in a plant, wherein the method comprises increasing the number of grains per ear in a target plant. rpl16 The expression level of the gene is achieved, rpl16 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0063] In a specific embodiment, the plant is a cereal crop.

[0064] In a more specific embodiment, the cereal crop is rice, Pennisetum plant, etc., more specifically rice, pearl millet, etc.

[0065] Beneficial effects

[0066] The invention provides a method for rpl16 Compared with existing technologies, the gene and its application have the following beneficial effects:

[0067] 1. Shorten the breeding cycle and improve breeding efficiency. rpl16 By directly obtaining male sterile rice lines, the traditional hybrid breeding process of self-pollination and backcrossing for many generations is avoided, which significantly shortens the breeding cycle and improves the breeding efficiency.

[0068] 2. Provide new genetic resources and enrich the types of sterile lines. rpl16 Gene overexpression has successfully created new male sterile rice lines, enriched the types of rice male sterile lines, provided more options for hybrid rice breeding, and helped to cultivate new high-yield, high-quality rice varieties.

[0069] 3. The identification method is simple and the results are stable and reliable. The male sterile rice identification method of the present invention detects the amplification and sequencing of the identification primers using positive plant sequences. It is simple to operate and produces stable and reliable results. It is suitable for large-scale application in laboratories and fields, ensuring the accuracy and success rate of breeding.

[0070] 4. The present invention can reduce the work of emasculation, lower the labor intensity, save human resources and time costs, and improve the economic benefits of breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] Figure 1 : rpl16 Schematic diagram of the overexpression vector.

[0072] Figure 2 :Rice overexpressing Miguel rpl16 Gene gel electrophoresis diagram, where ddH2O and wild type (WT) are negative controls, and M is a DNA marker.

[0073] Figure 3 :Transgenic rice line Zhongyugu rpl16 Gene expression detection.

[0074] Figure 4 :Rice overexpressing Miguel rpl16 Gene anther and anther vitality; among them, Figure 4 Figure A shows the anther of WT. Figure 4 Figure B shows the anther of transgenic rice; Figure 4 Figure C shows WT pollen. Figure 4 Figure D shows the pollen of transgenic rice.

[0075] Figure 5 :Rice overexpressing Miguel rpl16 Gene spikelet number and grain number per spike; Figure 5 Figure A shows the spikelet phenotypes of WT and OE. Figure 5 Figure B is a bar graph of the number of spikelets of WT and OE. Figure 5 Figure C shows the grain number per ear phenotype of WT and OE. Figure 5 Figure D is a bar chart of the number of grains per ear for WT and OE. DETAILED DESCRIPTION

[0076] The present invention is further described in detail below by way of examples, which are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The reagents or instruments used without manufacturer's indication are considered to be conventional products available on the market.

[0077] Escherichia coli DH5α competent cells, restriction endonuclease PstⅠ and other enzymes and pESI-blunt cloning vector were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.; the expression vector used was pEXT06 / g, and Agrobacterium tumefaciens EHA105 competent cells were purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd.

[0078] Example 1 Gene cloning and vector construction

[0079] The inflorescence of the sterile line '23A' of the royal millet was taken and the mitochondrial genome (mtDNA) of the royal millet was extracted using the bioolook plant mitochondrial DNA extraction kit. rpl16 Gene cloning template, based on the mitochondrial genome of the sterile line '23A' rpl16 Gene sequence, using Bio XM2.7 software to design primer sequences with restriction enzyme cutting sites (5'→3'):

[0080] rpl16-F:cctgttgtttggtgttacttctgcagATGTCAGTTCGTTATTACA, as shown in SEQ ID NO.3;

[0081] rpl16-R: tcctcgcccttgctcaccatacGGTTTTTAGTGGTATTCC, as shown in SEQ ID NO.4.

[0082] PCR amplification used 2× Hieff Canace® Advance Fast PCR Master Mix (With Dye) high-fidelity enzyme premix from Yisheng Company. The reaction conditions were as follows: 98°C for 30 s; 98°C for 10 s, 60°C for 5 s, and 72°C for 10 s; 35 cycles; and 72°C for 2 min. The reaction system is shown in Table 1.

[0083] Table 1 PCR reaction system

[0084]

[0085] Detect the PCR product by 1% agarose gel electrophoresis, cut out the band of the correct size, and use the OMEGA Gel Extraction Kit (Cat. No.: D2500-01) to recover the target fragment and linearize the expression vector pEXT06 / g. rpl16 The gene fragment was ligated to the Agrobacterium expression plasmid pEXT06 / g. The ligation product was transformed into DH5α competent cells and positive clones were identified by PCR. The pEXT06 / g universal primers were selected:

[0086] HYG-F1: CAAAGATCGTTATGTTTATCGGCACT, as shown in SEQ ID NO. 5;

[0087] HYG-R1:TTGGCGACCTCGTATTGGGAA, as shown in SEQ ID NO.6.

[0088] Ten monoclonal colonies were positively identified by PCR, and finally the positive recombinant plasmid pEXT06 / g- rpl16 ( Figure 1 Using the mtDNA of the yugu as a template, a fragment of about 600 bp was amplified and sequenced to obtain rpl16 sequence. rpl16 The gene is 558 bp in length (as shown in SEQ ID NO.1) and encodes 185 amino acids (as shown in SEQ ID NO.2). rpl16 Multiple sequence alignment and phylogenetic tree analysis showed that rpl16 It is most closely related to maize, Aegilops tauschii and wheat; analysis of its structural domain revealed that rpl16 The amino acid sequence includes a CRAL_TRIO_N domain and a FA domain. The CRAL-TRIO domain is present in GTPase-activating proteins (GAPs), guanine nucleotide exchange factors and a series of hydrophobic ligand-binding proteins.

[0089] Example 2 rpl16 gene-transformed rice and identification of positive seedlings

[0090] (1) Transform Agrobacterium with plasmid. rpl16 Transform the plasmid into competent Agrobacterium tumefaciens EHA105 cells according to the manufacturer's instructions. Add 1 mL of resistance-free LB liquid medium to the transformed cells, mix thoroughly, and incubate at 28°C in a shaker for 1-2 hours. Centrifuge to collect the precipitate, spread it evenly onto LB+Kan+Rif (rifampicin) culture plates, and incubate in a 28°C incubator for 2-3 days. Once the cells have grown, select a single colony and plate it onto LB+Kan+Rif (rifampicin) liquid medium, shake gently for 12 hours, and then run a PCR test. Transfer the cells containing the positive bands to a shaker and aliquot 0.5 mL of the culture medium into 0.5 mL of 50% glycerol and store at -80°C until needed. Ensure that all transformations and additions are performed aseptically.

[0091] (2) Rice genetic transformation. The rice genetic transformation system was carried out according to the method in the literature (Toki S, Hara N, Ono K, Onodera H, Tagiri A, Oka S, Tanaka H. Early infection of scutellum tissuewith Agrobacterium allows high-speed transformation of rice. The Plant Journal. 2006, 47(6):969-76). The culture medium formula is shown in Table 2. Healthy seeds of wild type rice (Nipponbare) were selected, the seed coat was removed, and they were soaked in 70% ethanol for 1 min, washed once with sterile deionized water, disinfected with 2.5% NaClO for 15 min, washed 3 times with sterile water, and dried with sterile filter paper. The seeds were inoculated on N6D solid culture medium and cultured at 27 °C under light. After the seeds grew callus tissue with a diameter of about 0.5 cm, Agrobacterium transformation was carried out. rpl16 Agrobacterium tumefaciens strain EHA105, carrying the plasmid, was shaken to an OD600 of 0.1 and centrifuged at 5000 rpm for 10 minutes. The cells were resuspended in LB + 20 mg / L AS suspension and the callus was soaked in the resuspended cells for 10 minutes. The liquid was then discarded and the surface liquid of the callus was blotted with sterile filter paper. The callus was then placed on 2N6-AS medium lined with sterile filter paper and co-cultured at 25°C in the dark for 3 days. The co-cultured seeds were washed six times with sterile deionized water and twice with 200 mg / L timentin sterile water. The surface water and Agrobacterium were blotted with sterile filter paper and the callus was placed on N6D-50 solid medium supplemented with hygromycin. The callus was cultured in the dark at 27°C for 10-15 days and the callus was selected. Positive calli were inoculated onto RE-III medium and cultured at 27°C for 20 days under light. After 2-5 cm shoots differentiated, they were inoculated onto HF medium for rooting. After rooting and seedling acclimatization for 2-3 days, they were transplanted to a sterilized nutrient soil (Pintholp, Denmark)-loess substrate for propagation. Only one regenerated seedling from each clump was selected as a line for subsequent propagation, ultimately yielding five resistant lines.

[0092] (3) Verification of transgenic positive seedlings. The CTAB method was used to extract gDNA from the leaves of the regenerated seedlings of rice lines. rpl16 Gene primers plus carrier primers are used as positive plant detection primers:

[0093] F: ACATCGCATCAACCTGGGAG, as shown in SEQ ID NO.7;

[0094] R: CTTGTAGTTGCCGTCGTCCT, as shown in SEQ ID NO. 8;

[0095] The amplified target band (528 bp) was sent to the company for sequencing verification.

[0096] Table 2 Rice transformation medium formula

[0097]

[0098] RNA was extracted from rice leaves using the Omega Plant RNA Extraction Kit R6827-01 for expression detection. Total RNA extraction and qRT-PCR were performed according to the literature (Zhang X, Xing R, Ding Y, Yu J, Wang R, Li X, Yang Z, Zhuang L. Overexpression of gibberellin 2-oxidase 4 The method was used in the experiment (from tall fescue affected plant height, tillering and drought tolerance in rice. Environmental and Experimental Botany. 2023, 205: 105118), and eEF-1α was selected as the internal reference gene of rice. Two technical replicates were performed for each biological replicate. The gene expression was calculated as follows: .

[0099] eEF-1α-Forward: TTTCACTCTTGGTGTGAAGCAGAT, as shown in SEQ ID NO. 9;

[0100] eEF-1α-Reverse: GACTTCCTTCACGATTTCATCGTAA, as shown in SEQ ID NO.10.

[0101] The results are as follows Figure 2 As shown, with the wild type (WT) and plasmid as controls, the five resistant strains were able to amplify the target band (528 bp), named OE1-OE5, respectively, while the WT did not amplify the target band. The amplified target band was sent to the company for sequencing verification, and five transgenic positive lines were obtained. Total RNA was extracted from rice leaves of WT and five transgenic lines for expression level detection. The results showed that the transgenic rice lines rpl16 The gene expression levels in OE1 were significantly higher than those in WT. rpl16 The gene expression level was 119.40 times higher than that of WT ( Figure 3 ).

[0102] Example 3 Analysis of transgenic anthers, pollen viability, and rice panicle morphology

[0103] The transgenic positive rice plants obtained and the wild-type rice plants (control group) were cultivated under the same conditions. After the positive plants completed heading, the number of tillers, plant height, number of spikelets, and number of grains per panicle were counted. The pollen viability was calculated using the iodine-potassium iodide staining method during the pollination period, and the anther development was observed under a microscope.

[0104] Iodine-potassium iodide staining: Two to three spikelets from each ear with fully developed pollen are placed in 70% alcohol. For observation, the anthers are removed with tweezers and placed on a glass slide. One to two drops of a 1% iodine-potassium iodide solution are added, the anthers are mixed and mashed, and a coverslip is placed. The anthers are then observed and counted under a microscope. Pollen grains that stain blue and are round are considered fertile, while those that stain lightly or are damaged and shrunken are considered sterile. Ten anthers are examined for each plant.

[0105] The anther and pollen viability tests of WT and OE1 showed that WT anthers were very plump and light yellow, while the anthers of the transgenic rice lines were whitish ( Figure 4 Figures A and B in the figure), WT pollen grains are round and plump, while OE pollen grains are small and irregular in shape ( Figure 4 Figures C and D of the figure); Pollen viability tests showed that OE pollen viability was significantly lower than WT during this period, with pollen viabilities of WT and OE being 40.19% and 7.69%, respectively. The two groups of rice plants were cultivated under the same conditions and their panicles were observed at the time of fruiting. The results showed that there was no significant difference in panicle shape between the two groups, but the number of spikelets and grains per panicle of OE plants was significantly lower than that of wild type, and the sterility rate reached 96.8%, indicating that the overexpression of Miguel rpl16 Genes causing rice sterility ( Figure 5 ).

[0106] In summary, this study cloned rpl16 Gene, rpl16 It belongs to the mitochondrial ribosomal protein gene, encoding the large subunit of ribosomal protein, with a total length of 558 bp and encoding 186 amino acids. rpl16 The amino acid sequence includes a CRAL_TRIO_N domain and a FA domain. rpl16 Overexpression of transgenic lines in rice; compared with WT, the anther and pollen morphology of transgenic lines is abnormal. rpl16 This resulted in a significant decrease in pollen viability of the transgenic strains, a significant reduction in the number of spikelets and grains per spike, and rice abortion.

[0107] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. rpl16 The gene is used in any of the following (A1)-(A2): (A1) Application in breeding sterile rice lines; (A2) Use in the preparation of products for breeding sterile rice lines; described rpl16 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that described rpl16 The gene comes from the corn.

3. As described in claim 1 rpl16 Gene-related biological materials used in any of the following (A1)-(A2): (A1) Application in breeding sterile rice lines; (A2) Use in the preparation of products for breeding sterile rice lines; in, The biological material is any one of the following: (B1) Containing the substance described in claim 1 rpl16 expression cassette of the gene; (B2) Containing the substance described in claim 1 rpl16 A recombinant vector of a gene, or a recombinant vector containing the expression cassette described in (B1); (B3) Containing the substance described in claim 1 rpl16 A recombinant microorganism containing a gene, or a recombinant microorganism containing the expression cassette of (B1), or a recombinant microorganism containing the recombinant vector, wherein the microorganism is Agrobacterium; described rpl16 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

4. The use according to claim 3, characterized in that In the figure (B2), the backbone vector of the recombinant vector is pEXT06 / g.

5. A method for cultivating a sterile rice line, characterized in that: The method improves the rpl16 The expression level of the gene is achieved, rpl16 The nucleotide sequence of the gene is shown in SEQ ID No.1.

Images