Use of BpLUS1 gene in regulating birch branch number and / or lupinol content

Abstract

The present application relates to the field of plant transgenic technology, and particularly relates to application of BpLUS1 gene in regulating branch number and / or lupine alcohol content of white birch. Overexpression of the BpLUS1 gene can increase the branch number and the lupine alcohol content of the plant. The results of the specific embodiments of the present application show that: by regulating the expression amount of the BpLUS1 gene through genetic engineering, the branch number of the plant can be significantly increased, so as to improve the overall biomass of the plant; by regulating the expression amount of the BpLUS1 gene through genetic engineering, the synthesis and accumulation of target metabolites (such as lupine alcohol) are improved, and the medicinal or commercial value of the plant is improved. Moreover, the BpLUS1 gene can simultaneously regulate multiple traits (branch development and metabolite synthesis) of the plant, so that the growth and development and production performance of the plant can be better optimized.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant transgenic technology, and particularly relates to application of BpLUS1 gene in regulating branch number and / or lupenol content of Betula platyphylla. BACKGROUND

[0002] Betula platyphylla Suk. (Latin name: Betula platyphylla Suk.), also known as birch, is a deciduous tree of Betulaceae and Betula, grows in the mountain slope or forest at an altitude of 400-4100m, has strong adaptability, and likes humid soil. The height of the Betula platyphylla Suk. can reach 27m; the bark is grayish white, layered and flaky; the branch is dark gray or dark brown, is hairless, has or has not resin glands, or has sparse or dense resin glands; the small branch is dark gray or brown, is hairless and has no resin glands, and is sometimes sparsely covered with hair and sparsely covered with resin glands. The fruiting sequence is single, is cylindrical or rectangular cylindrical, usually droops, is 2-5cm long, and is 6-14mm in diameter; the sequence stem is thin and slender, is 1-2.5cm long, is densely covered with short soft hair, is nearly hairless after maturation, and has or has not resin glands.

[0003] The branch number and metabolite content of plants have important influence on yield, quality and biological activity of crops. Although the traditional breeding method can improve the branch number and metabolite content of crops, the progress is slow and is limited by genetic background, environmental factors and the like. Especially in some economic crops and medicinal plants, the content of metabolites is crucial to the commercial value. Therefore, by using the transgenic technology, the specific gene is precisely regulated, which becomes an effective way to improve the branch number and metabolite content of plants. At present, the exploration of new genes for molecular regulation of the plant type and metabolites of Betula platyphylla Suk. is still in the blank. SUMMARY

[0004] The present application provides the application of BpLUS1 gene in regulating branch number and / or lupenol content of Betula platyphylla, so as to solve the problems in the prior art. Overexpression of the BpLUS1 gene can improve the branch number and increase the content of lupenol.

[0005] To achieve the above object, the present application provides the following scheme:

[0006] The present application provides the application of BpLUS1 gene in regulating branch number and / or lupenol content of Betula platyphylla, wherein the nucleotide sequence of the BpLUS1 gene is shown in SEQ ID NO. 1.

[0007] The present application provides a method for improving the branch number and / or increasing the content of lupenol of Betula platyphylla, which comprises the step of overexpressing BpLUS1 gene in Betula platyphylla; the nucleotide sequence of the BpLUS1 gene is shown in SEQ ID NO. 1.

[0008] The application provides application of a BpLUS1 gene in cultivating transgenic white birch with high branch number and / or high content of lupinol, wherein the nucleotide sequence of the BpLUS1 gene is shown as SEQ ID NO. 1.

[0009] The application provides a method for cultivating transgenic white birch with high branch number and / or high content of lupinol, comprising the following steps: overexpressing a BpLUS1 gene in white birch to obtain the transgenic white birch, wherein the nucleotide sequence of the BpLUS1 gene is shown as SEQ ID NO. 1.

[0010] The application provides application of a BpLUS1 gene in regulating the branch number and / or the content of lupinol of white birch, wherein the nucleotide sequence of the BpLUS1 gene is shown as SEQ ID NO. 1.

[0011] The application provides application of a BpLUS1 gene in cultivating transgenic white birch with high branch number and / or high content of lupinol, wherein the nucleotide sequence of the BpLUS1 gene is shown as SEQ ID NO. 1.

[0012] The application provides application of a BpLUS1 gene in regulating the height and / or the growth rate of the base stem of white birch, wherein the nucleotide sequence of the BpLUS1 gene is shown as SEQ ID NO. 1.

[0013] The application provides a method for reducing the height and / or the growth rate of the base stem of white birch, comprising the following step: overexpressing a BpLUS1 gene in white birch, wherein the nucleotide sequence of the BpLUS1 gene is shown as SEQ ID NO. 1.

[0014] The application provides application of a BpLUS1 gene in regulating the height and / or the growth rate of the base stem of white birch, wherein the nucleotide sequence of the BpLUS1 gene is shown as SEQ ID NO. 1.

[0015] Preferably, the biological material comprises a recombinant carrier and a recombinant bacterium.

[0016] The application discloses the following technical effects:

[0017] 1. Increase the branch number: by regulating the expression amount of the BpLUS1 gene through genetic engineering, the branch number of the plant can be significantly increased, so that the overall biomass of the plant is improved.

[0018] 2. Increase the content of metabolites: by regulating the expression amount of the BpLUS1 gene through genetic engineering, the synthesis and accumulation of target metabolites (such as lupinol) are improved, and the medicinal or commercial value of the plant is improved.

[0019] 3. Multi-target regulation: the BpLUS1 gene described in the present application can simultaneously regulate multiple traits of plants, such as branch development and metabolite synthesis, and can better optimize the growth and development and production performance of plants. BRIEF DESCRIPTION OF DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0021] Figure 1 GUS staining diagram of L14 and L21 plants under a stereomicroscope; wherein, A is the GUS staining diagram of L14 plant; B and C are the GUS staining diagrams of L21 plant; the scale of A and B is 2000 μm; the scale of C is 500 μm;

[0022] Figure 2 GFP fluorescence detection diagram of L14 and L21 plants; wherein, A is the GFP fluorescence detection diagram of L14 plant; B is the GFP fluorescence detection diagram of L21 plant; the scale is 2000 μm;

[0023] Figure 3 Statistical diagram of relative expression amount of genes of different plants; wherein, CK stem is a wild-type white birch plant obtained by seed germination; L14 stem and L21 stem are transgenic plants numbered as L14 stem and L21 stem obtained by taking stem as explant;

[0024] Figure 4 Liquid chromatogram of lupine alcohol in different plants; wherein, CK stem is a wild-type white birch plant obtained by seed germination; L14 stem is a transgenic plant numbered as L14 stem obtained by taking stem as explant;

[0025] Figure 5 Liquid chromatogram of lupine alcohol in different plants; wherein, CK leaf is a wild-type white birch plant obtained by seed germination; L11 leaf is a transgenic plant numbered as L11 leaf obtained by taking stem as explant;

[0026] Figure 6 Statistical diagram of lupine alcohol content in different plants; wherein, CK stem is a wild-type white birch plant obtained by seed germination; L14 stem is a transgenic plant numbered as L14 stem obtained by taking stem as explant;

[0027] Figure 7Figure 6 is a histogram of the content of lupeol in different plants; wherein CK leaf is wild type birch plant obtained from seed germination; L11 leaf is transgenic plant numbered as L11 leaf obtained by taking stem as explant;

[0028] Figure 8 Figure 7 is a histogram of the number of branches of different plants; wherein CK stem is wild type birch plant obtained from seed germination; L14 and L21 are transgenic plant numbered as L14 stem and transgenic plant numbered as L21 stem obtained by taking stem as explant;

[0029] Figure 9 Figure 8 is a histogram of the branch phenotype of different plants; wherein A is WT; B is L14; C is L21; WT is wild type birch plant obtained from seed germination; L14 stem and L21 stem are transgenic plant numbered as L14 stem and transgenic plant numbered as L21 stem obtained by taking stem as explant;

[0030] Figure 10 Figure 9 is a histogram of the growth rate of different plants; wherein WT is wild type birch plant obtained from seed germination; L14 and L21 are transgenic plant numbered as L14 stem and transgenic plant numbered as L21 stem obtained by taking stem as explant;

[0031] Figure 11 Figure 10 is a histogram of the basal stem growth of different plants; wherein WT is wild type birch plant obtained from seed germination; L14 and L21 are transgenic plant numbered as L14 stem and transgenic plant numbered as L21 stem obtained by taking stem as explant. DETAILED DESCRIPTION

[0032] The foregoing description of various example embodiments of the application has been presented for the purposes of illustration and description. It is not intended to be exhaustive or to limit the application to the precise form disclosed. Many modifications and variations are possible in light of this disclosure. It was chosen and described in order to provide the best illustration of the principles of the application and the practical application and to enable others skilled in the art to view the application

[0033] It is understood that the terms used in the present application merely describe a particular embodiment and are not intended to limit the present application. In addition, for numerical ranges in the present application, it is understood that each intermediate value between the upper limit and the lower limit of the range is specifically disclosed. Each intermediate value within any stated value or stated range, and any other stated value or intermediate value within the stated range is also included within the present application. The upper and lower limits of these smaller ranges can be independently included or excluded from the ranges.

[0034] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All patents, patent applications, publications, and descriptions mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the patents, patent applications, publications, and descriptions are cited.

[0035] Many modifications and variations of the present application described in the specification are possible without departing from the scope or spirit of the application. Other implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only.

[0036] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed material or step.

[0037]

[0038] Example 1

[0039] 1. Construction of transgenic recombinant vector and recombinant bacteria:

[0040] Clone BpLUS1 gene and connect with plant promoter, terminator and screening marker gene to construct transgenic recombinant vector; transform the vector to Agrobacterium to obtain recombinant bacteria.

[0041] The specific steps are as follows:

[0042] 1.1) Amplification of white birch BpLUS1 gene

[0043] According to the CDS sequence (SEQ ID NO. 1) of white birch BpLUS1 gene, primers (F: ATGTGGAAGTTGAAGATAGCGGAAGGAGG, SEQ ID NO. 2; R: TCATGCAAATAGAACTCGCCTCCGATATTCTC, SEQ ID NO. 3) are designed for amplification, and the amplification template is white birch wild type DNA. The PCR band is detected by 1% agarose gel electrophoresis to obtain the target fragment.

[0044] The PCR amplification reaction system is 50 μL reaction system: water 20 μL, upstream primer 2 μL, downstream primer 2 μL, template 1 μL, enzyme 25 μL. The PCR amplification reaction program is: 94℃ 5min; 94℃ 30sec, 58℃ 30sec, 72℃ 135sec, 30×; 72℃ 10min, 4℃ incubation. The cloning result shows that the white birch BpLUS1 gene is successfully cloned.

[0045] 1.2) Connection of white birch BpLUS1 gene and entry vector

[0046] TAKARA company pMD TM 18-T cloning vector, prepare the reaction liquid according to the following system: pMD TM 18-T 1 μL, BpLUS1 gene fragment 1 μL, ddH2O 1 μL, add 5 μL of Solution I; 16℃ reaction for 30min, obtain recombinant plasmid.

[0047] 1.3) Construction of BpLUS1 gene plant overexpression vector

[0048] Prepare the reaction liquid according to the following system to obtain EGFP-pCAMBIA1301-35SN linear vector:

[0049] EGFP-pCAMBIA1301-35SN 2 μg, Xba I 1 μL, Kpn I 1 μL, 10 x Buffer M 4 μL, ddH2O 32 μL, 7°C reaction for 5 h, 1% agarose gel recovery of large fragments, to obtain the recovery and purification of the vector EGFP-pCAMBIA1301-35SN; the recovery and purification of the target gene fragment and the recovery and purification of the vector EGFP-pCAMBIA1301-35SN are connected, and the connection product is named as the recombinant plasmid LUS1-EGFP-pCAMBIA1301-35SN. The connection system is as follows: T4 DNA Ligase 1 μL, 5 x T4 Buffer 2 μL, EGFP-pCAMBIA1301-35SN 1 μL, BpLUS1 gene fragment 6 μL, 22°C connection overnight, and the connection product is transformed into the E. coli competent cells, and the positive clones are picked and sent to the company for sequencing.

[0050] 1.4) Transformation into Agrobacterium

[0051] The recombinant plasmid LUS1-EGFP-pCAMBIA1301-35SN is introduced into the LBA4404 Agrobacterium competent cells by the freeze-thaw method. The solid LB medium containing kanamycin and rifampicin is coated. After 2 days, single colonies are picked for PCR detection, and the single colonies with positive detection are preserved as the engineering bacteria for plant infection.

[0052] 2, Material pre-culture:

[0053] Stems and leaves of two-month-old white birch seedlings were separated (try not to leave bud points) and placed in callus induction medium (induction medium: 2% sucrose, 0.8% agar powder, 0.8 mg / L 6-BA and 0.2 mg / L NAA were added to IS basic medium, pH 5.5-6.0; the components of IS basic medium were: 680.0 mg / L ammonium nitrate (NH4NO3), 0.8 mg / L potassium iodide (KI), 100.0 mg / L myo-inositol, 1.0 mg / L ascorbic acid (Vc), 10.0 mg / L tyrosine, 80.0 mg / L potassium dihydrogen phosphate (KH2PO4), 370.0 mg / L magnesium sulfate (MgSO4·7H2O), 8.0 mg / L manganese sulfate (MnSO4·4H2O), 0.025 mg / L copper sulfate (CuSO4·5H2O), 9.0 mg / L zinc sulfate (ZnSO4·7H2O), 27.8 mg / L ferrous sulfate (FeSO4·7H2O), 140.0 mg / L potassium chloride (KCl), 0.25 mg / L sodium molybdate (Na2MoSO4·2H2O), 10.0 mg / L urea, 3.2 mg / L boric acid (H3BO3), 710.0 mg / L calcium nitrate (Ca(NO3)2·4H2O), 170.0 mg / L potassium nitrate (KNO3), 0.8 mg / L nicotinic acid (VB3), 1.0 mg / L fumaric acid, 0.1 mg / L pyridoxine hydrochloride (VB6), 0.1 mg / L thiamine hydrochloride (VB1) and 37.3 mg / L disodium EDTA (EDTANa2)) for pre-culture, and the pre-culture condition parameters were: 25°C dark culture for 7-10 days, to obtain pre-cultured explants (pre-cultured stems and pre-cultured leaves).

[0054] 3. Preparation of infection liquid:

[0055] When the OD of the bacterial liquid of the engineering bacteria for infecting plants was 0.6, centrifugation was performed at 4000 rpm for 10 min, the supernatant was discarded, an equal volume of sterilized water was added, and 100 mg / L acetyl-syringone was added for induction culture for 30 min, to obtain the infection liquid.

[0056] 4. Transformation method:

[0057] After pre-cultured explants (pre-cultured stems and pre-cultured leaves) were placed in the infection liquid for 5-20 min (10 min in this example), they were placed in callus differentiation medium (differentiation medium: 2% sucrose, 0.8% agar powder, 0.5 mg / L 6-BA and 0.5 mg / L KT were added to IS basic medium, the components of IS basic medium were the same as above) for co-culture, dark culture for 48 h, 300 mg / L cefotaxime was added three times, and then light culture was performed, the temperature was 25°C, and the light cycle was 16 / 8 h (day / night).

[0058] 5. Rooting culture:

[0059] When the height of the shoots is 3-4 cm, the stem segments are cut and transferred to the rooting medium (rooting medium: 2% sucrose and 0.8% agar powder are added to the WPM basic medium, pH 6.0-6.5) for culture, the culture temperature is 25°C, and the light cycle is 16 / 8 h (day / night). Then, propagation is carried out, and after propagation, transgenic verification is carried out.

[0060] 6. Screening and verification:

[0061] The transgenic plants containing the target gene are screened from the transformed plants by antibiotic screening method and GUS staining method (the transgenic plant numbered L11 leaf is obtained by taking the leaf as an explant; the transgenic plants numbered L14 stem and L21 stem are obtained by taking the stem as an explant), and the expression of the target gene is verified by real-time fluorescent quantitative PCR. The reaction system and conditions are referred to the qPCR Super Mix kit instruction book of Qiagene Company, the internal reference gene is used as an internal standard, and the relative expression amount of the target gene is calculated by 2 -ΔΔCt .

[0062] The primers used for BpLUS1 gene quantification are as follows:

[0063] BpLUS1-F: CCACTGGCCTGGTGAATCTGCT, SEQ ID NO. 4;

[0064] BpLUS1-R: CCCAGCCTCCATCTTCGTTCTGAT, SEQ ID NO. 5;

[0065] The primers used for the internal reference are as follows:

[0066] Internal reference-F: GATTGAGGGGAGGGATGCTG, SEQ ID NO. 6;

[0067] Internal reference-R: GGAGGACAAGGTGGAGGGTG, SEQ ID NO. 7.

[0068] 7. Phenotype analysis and performance evaluation:

[0069] The number of branches of the transgenic plants is observed, and the branch characteristics of the transgenic plants and wild type plants are compared; at the same time, the content change of the target metabolite is analyzed, and the metabolite in the transgenic plants is analyzed by high performance liquid chromatography (HPLC).

[0070] 8. Investigation of plant height and basal stem growth rate:

[0071] Subsequently, in August of that year, the plant height and basal stem growth rate of wild-type birch plants and two transgenic plants (6 months old) were measured, with plant height measured every 7 days for a total of 5 measurements.

[0072] 9. Results and Analysis:

[0073] GUS staining diagram as follows Figure 1 As shown, the results indicate that Agrobacterium infection was successful.

[0074] GFP fluorescence detection diagram as shown Figure 2 As shown, the results indicate that Agrobacterium infection was successful.

[0075] The relative expression level of the BpLUS1 gene is as follows: Figure 3 As shown, the results indicate that the BpLUS1 gene was significantly higher in the transgenic plants with stem number L14 and stem number L21 than in the wild-type birch plant (CK stem).

[0076] The chromatogram of lupeol is as follows: Figure 4 and Figure 5 As shown, the results of the lupin alcohol content survey are as follows: Figure 6 and Figure 7 As shown in the figure. The results showed that the lupinol content in the transgenic plants was approximately 143% higher than that in the wild-type birch plants.

[0077] The branch count results are as follows: Figure 8 As shown, the branching phenotype is as follows Figure 9 As shown in the figure. The results indicate that the transgenic plants have a significantly increased number of branches compared to wild-type birch plants.

[0078] Statistical results of plant height and basal stem growth rate are as follows: Figure 10 and Figure 11 As shown in the figure. The results showed that the growth rate of the basal stem of wild-type birch plants was higher than that of the transgenic plants, which is presumably related to branching formation.

[0079] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for increasing the number of branches in birch trees, characterized in that, The method includes the step of overexpressing the BpLUS1 gene in birch; the nucleotide sequence of the BpLUS1 gene is shown in SEQ ID NO.

1.

2. A method for cultivating transgenic birch with many branches, characterized in that, The method includes the step of overexpressing the BpLUS1 gene in birch to obtain the transgenic birch; the nucleotide sequence of the BpLUS1 gene is shown in SEQ ID NO.

1.

3. The application of biomaterials containing the BpLUS1 gene in the cultivation of transgenic birch with many branches, characterized in that, The nucleotide sequence of the BpLUS1 gene is shown in SEQ ID NO.

1.

4. The application according to claim 3, characterized in that, The biomaterials include recombinant vectors and recombinant bacteria.

5. A method for reducing the height of birch trees and / or reducing the growth rate of birch basal stems, characterized in that, The method includes the step of overexpressing the BpLUS1 gene in birch; the nucleotide sequence of the BpLUS1 gene is shown in SEQ ID NO.1.

Images