Environmental DNA detection method based on benthonic animal primer optimization

Abstract

The invention discloses an environmental DNA detection method based on benthonic animal primer optimization, and belongs to the technical field of environmental damage investigation and identification, and the environmental DNA detection method comprises the following steps: determining a species directory of benthonic animals in a target area through literature retrieval and arrangement, searching and downloading corresponding species sequence information, collecting benthonic animal universal primers, and determining the species directory of the benthonic animals in the target area. The universal primers are compared with all species sequence information one by one, the matching rate of each primer to all known sequences of each species is calculated, and the two primers with the highest matching rate are designed and optimized to form a pair of optimized primers, namely COIAF: 5 '-CCTAYGGGRBGCASCAG-3'; mlCOIintR: 5 '-GGACTACNNGGGTATCTAAT-3', and mlCOIintR: 5 '- The method comprises the following steps: collecting a benthonic animal sample in a target area, respectively selecting two layers of test samples of a single species and a natural sample, extracting sample DNA, amplifying a target fragment DNA sequence by adopting a preferred primer, and carrying out quality verification on the preferred primer from two layers, and the preferred primer is applied to the amplification of benthonic animal environment DNA. The sensitivity of the environment DNA technology on the detection of the rare species of the benthonic animals can be improved.

Description

Technical Field

[0001] This application belongs to the technical field of environmental damage investigation and identification. Specifically, it relates to an environmental DNA detection method based on the optimization of benthic animal primers. Background Art

[0002] In the field of aquatic environment monitoring, environmental DNA technology plays a key role. Its main monitoring methods include environmental DNA metabarcoding detection and specific detection. Although environmental DNA metabarcoding can be used for biodiversity monitoring, by amplifying DNA with universal PCR primers and combining high-throughput sequencing technology to quickly identify the species groups of targets, there are many defects in universal primers, such as poor performance, low amplification efficiency, low species resolution, large errors, etc. This makes its accuracy greatly reduced when monitoring specific species. In contrast, specific detection has more advantages in accurately and efficiently monitoring specific species.

[0003] However, the current imperfection of the mitochondrial DNA database of aquatic organisms has led to the unclarity of specific primers for many indicator organisms. It is difficult to implement specific detection for many aquatic organisms to achieve accurate identification, and the detection sensitivity for rare species with low environmental DNA content is insufficient, seriously hindering the effective application of environmental DNA technology in the assessment of specific species in complex aquatic environments, especially in waters with damaged aquatic ecosystems. Summary of the Invention

[0004] To solve the above problems and technical deficiencies, the embodiments of this application adopt the following technical solutions. An environmental DNA detection method based on the optimization of benthic animal primers includes the following steps: Step 1: By means of literature retrieval, sort out and determine the species list of benthic animals in the target area. According to the determined species list, search and download the corresponding species sequence information on the public database website; Step 2: Obtain benthic animal universal primers through literature retrieval as alternative primer sequences. Compare all the obtained alternative primer sequences with all the species sequence information obtained in Step 1 one by one, calculate the matching rate of each alternative primer to each species sequence, and select the two primers with the highest matching rate; Step 3: According to the positional relationship of the two primers in the mitochondrial COI gene, optimize the primer direction to obtain a pair of optimized primers. The sequences of the obtained pair of optimized primers are as follows: COIAF: 5’-CCTAYGGGRBGCASCAG-3’; mlCOIintR: 5’-GGACTACNNGGGTATCTAAT-3’; Step 4: Conduct benthic animal sampling in the target area, collect benthic animal samples from multiple sampling points, select test samples at two levels of single species and natural samples respectively from the benthic animal samples, and then extract the test sample DNA for all test samples. Step 5: Use the preferred primers in Step 3 to amplify and test the target fragment DNA sequences of the test samples at the two levels in Step 4, and combine the detection results of the test samples at the two levels to test the quality and application effect of the preferred primers. Step 6: Apply the preferred primers that meet the quality requirements and application requirements to the amplification of environmental DNA of benthic animals, and conduct environmental DNA detection on the target area according to the target fragment DNA sequences of the amplified test samples, so as to realize the evaluation and identification of aquatic ecological damage and obtain the aquatic ecological damage evaluation results.

[0005] Preferably, the calculation process of the matching rate in Step 2 is as follows: Retrieve and determine the species sequence length of each test sample species. Compare each primer with the species sequences of each species one by one, and record the number of sequences successfully aligned between each primer and each species sequence. Record the percentage value of the number of successfully aligned sequences in the total length of the species sequence as the matching rate of the species sequence.

[0006] Preferably, the process of designing the preferred in Step 3 is as follows: Determine the positional relationship of the two primers in the mitochondrial COI gene to obtain the front-back and forward-backward relationships of the two primers. After reversing the two primers, replace each base with its corresponding base pair to obtain a pair of preferred primers corresponding to the target test sample.

[0007] Furthermore, when the test sample detected in Step 5 is a single species, first extract its test sample DNA, then use the preferred primers to amplify the target fragment DNA sequence, generate a PCR amplification result identification gel image and PCR products, evaluate the quality of the amplified sequence, and judge whether the PCR products meet the requirements of subsequent experiments.

[0008] Furthermore, when the test sample detected in Step 5 is a natural sample, first extract its test sample DNA, then use the preferred primers and universal primers to amplify the target fragment DNA sequence, generate a PCR amplification result identification gel image and PCR products, evaluate the quality of the amplified sequence, and judge whether the PCR products meet the requirements of subsequent experiments.

[0009] Compared with the prior art, the beneficial effects of the embodiments of the present application are as follows: This application deeply explores existing biological DNA databases to search for mitochondrial DNA sequences of key indicator species. For species with unknown sequences, their sequences are determined by DNA sequencing, continuously enriching the DNA database of aquatic biological species. By carefully screening species-specific primers, the matching degree with the DNA fragments of the target species is significantly improved, effectively reducing the cross-reaction between specific primers and non-target DNA fragments, thereby significantly reducing the risk of false positive detection results, greatly enhancing the sensitivity and accuracy of environmental DNA detection technology, achieving more efficient and accurate identification of species, and then constructing a technical system for designing species-specific primers of key indicator species, improving the sensitivity of detecting rare species with low environmental DNA content, providing strong support for the application of environmental DNA technology in specific aquatic biological monitoring. Undoubtedly, the optimized primers are a crucial link in this technical system and the key to enhancing the monitoring effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] In the drawings: Figure 1 is a schematic diagram of the method steps of an embodiment of this application; Figure 2 is the primer optimization and selection result of benthic animals in an embodiment of this application; Figure 3 is a schematic diagram of primer optimization and selection of benthic animals in an embodiment of this application; Figure 4 is the single species sample information table of an embodiment of this application; Figure 5 is the identification gel diagram of the PCR amplification result of the single species test sample of the optimized primer COIAF-mlCOIintR in an embodiment of this application; Figure 6 is the 2% agarose gel electrophoresis detection purified PCR product diagram of the single species test sample of the optimized primer COIAF-mlCOIintR in an embodiment of this application; Figure 7 is the PCR amplification result information table of the single species test sample of the optimized primer COIAF-mlCOIintR in an embodiment of this application; Figure 8 is the PCR amplification result information table of the optimized primer COIAF-mlCOIintR and the universal primer MlCOIintF-JgHCO2198 for field natural samples in an embodiment of this application; Figure 9 is the PCR product diagram of the optimized primer COIAF-mlCOIintR for field natural samples in an embodiment of this application; Figure 10 is the PCR product diagram of the universal primer MlCOIintF-jgHCO2198 for field natural samples in an embodiment of this application. Detailed implementation manners

[0011] To make the objectives, technical solutions and advantages of the embodiments of this application clearer, the following will clearly and completely describe the technical solutions in the embodiments of this application with reference to the accompanying drawings in the embodiments of this application. Apparently, the described embodiments are some but not all of the embodiments of this application. Generally, the components of the embodiments of this application described and illustrated in the accompanying drawings here can be arranged and designed in various different configurations.

[0012] Embodiment As Figure 1 shown, an environmental DNA detection method based on the optimization of benthic animal primers includes the following steps: By means of literature retrieval, sort out and determine the species list of benthic animals in the target area, and search and download the corresponding species sequence information on the public database website according to the determined species list.

[0013] Obtain the universal primers for benthic animals through literature retrieval as the alternative primer sequences. The calculation process of the matching rate is as follows: Retrieve and determine the species sequence length of each test sample species; Compare each primer with the species sequences of each species one by one, and record the number of sequences successfully aligned between each primer and each species sequence; Record the percentage value of the number of successfully aligned sequences in the total length of the species sequence as the matching rate of the species sequence.

[0014] Compare all the obtained alternative primer sequences with all the obtained species sequence information one by one, calculate the matching rate of each alternative primer for each species sequence, and select the two primers with the highest matching rate.

[0015] According to the positional relationship of the two primers in the mitochondrial COI gene, optimize the primer direction to obtain a pair of optimized primers. The optimization design process is as follows: Determine the positional relationship of the two primers in the mitochondrial COI gene to obtain the front-back and forward-backward relationships of the two primers; After reversing the order of the two primers, replace each base with its corresponding base pair to obtain a pair of optimized primers corresponding to the target test sample.

[0016] Collect benthic animal samples at the target area, collect benthic animal samples at multiple sampling points, extract the DNA of the samples. After collecting the benthic animal samples, it is necessary to select test samples at two levels of single species and natural samples from the benthic animal samples respectively, and then extract the DNA of the test samples for all the test samples.

[0017] Using optimized primers, amplify the target fragment DNA sequences of all samples, conduct high-throughput sequencing on the sequences, use public databases to perform species alignment on the sequencing results, test the quality and application effects of the optimized primers, and test the optimized primers on two levels of test samples respectively, and combine the detection results of the two levels of test samples; When the test sample for detection is a single species, first extract the DNA of the test sample, and then use the optimized primers to amplify the target fragment DNA sequence to generate a PCR amplification result identification gel image and PCR products, evaluate the quality of the amplified sequence, and determine whether the PCR products meet the requirements of subsequent experiments.

[0018] When the test sample for detection is a natural sample, first extract the DNA of the test sample, and then use the optimized primers and universal primers to amplify the target fragment DNA sequence to generate a PCR amplification result identification gel image and PCR products, evaluate the quality of the amplified sequence, and determine whether the PCR products meet the requirements of subsequent experiments.

[0019] For example, the universal primer pair for the mitochondrial COI gene of benthic animals (sequence 5'-3'): F1: GGTCAACAAATCATAAAGATATTGG, R1: CTTATRTTRTTTATICGIGGRAAIGC F2: CCIGAYATRGCITTYCCICG R2: GTRATIGCICCIGCIARIAC The primer pair for the mitochondrial COI gene of chironomid: LCO1490: GGTCAACAAATCATAAAGATATTGG COIA-R: CARAAWCTTATATTATTTATTCGDGG The primer pair for the mitochondrial COI gene of Ephemeroptera, Trichoptera, and Plecoptera: mlCOlintF: GGWACWGGWTGAACWGTWTAYCCYCC jgHCO2198: TANACYTCNGGRTGICCRAARAAYCA Select Hongze Lake as a typical area. Based on the species list of benthic animals in Hongze Lake obtained from traditional survey results, retrieve the relevant sequence information of all species in the ncbi database, and compare all the primer sequences found in the existing literature one by one. The comparison results are as Figure 2 shown.

[0020] It can be seen from the comparison results that among the existing primer sequences, the matching rates of paired primers are all relatively low, but there is one primer with a relatively high matching rate in both the forward primer and the reverse primer; According to the positional relationship of these two primers in the mitochondrial COI gene, the forward primer and the reverse primer were swapped, and a pair of better-performing universal primers for benthic animals were designed and optimized. The sequences of a pair of optimized primers obtained are as follows: COIAF: 5’-CCTAYGGGRBGCASCAG-3’; mlCOIintR: 5’-GGACTACNNGGGTATCTAAT-3’; The relative positions of this primer on the mitochondrial COI gene are as Figure 3 shown.

[0021] For this optimized primer, an amplification test experiment was carried out using specimens. The PCR amplification result identification gel map and the detection of the purified PCR product by 2% agarose gel electrophoresis are as Figure 5 and Figure 6 shown.

[0022] As Figure 7 shown, when the test sample for inspection is a single species, first extract the DNA of the test sample, then use the optimized primer to amplify the target fragment DNA sequence, and evaluate the quality of the amplified sequence. The results are 4 As and 1 B. The 4 As indicate that the size of the target band of the PCR product is correct and the concentration is appropriate, and subsequent experiments can be carried out. The 1 B indicates that the size of the target band of the PCR product is correct, but the concentration is low, and subsequent experiments can be attempted, and there may be a risk of re-testing.

[0023] As Figure 8 shown, when the test sample for inspection is a natural sample, first extract the DNA of the test sample, then use the optimized primer to amplify the target fragment DNA sequence, and evaluate the quality of the amplified sequence. The results of the universal primer are 7 As and 2 Cs, indicating that the target band of the PCR product is too weak or not detected, and subsequent experiments cannot be carried out, and a new sample needs to be provided. The results of the optimized primer are all 9 As, indicating that the size of the target band of the PCR product is correct and the concentration is appropriate, and subsequent experiments can be carried out.

[0024] Apply the optimized primer that meets the quality requirements and application requirements to the amplification of benthic animal environmental DNA. As Figure 9 and Figure 10 described, according to the target fragment DNA sequence of the amplified test sample, a water ecological damage assessment and identification was carried out to obtain the water ecological damage assessment result.

[0025] The above-described embodiments merely represent the preferred embodiments of the present application. The description is relatively specific and detailed, but it should not be construed as limiting the scope of the patent of the present application. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present application, several variations, improvements, and substitutions can be made, and these all fall within the protection scope of the present application.

Claims

1. A method for detecting environmental DNA based on benthic animal primer optimization, characterized in that: The following steps are involved: Step 1: Organize and determine the species list of benthic animals in the target area through literature retrieval, and search and download the corresponding species sequence information on the public database website based on the determined species list; Step 2: Obtain universal primers for benthic animals through literature retrieval as candidate primer sequences, compare all the candidate primer sequences obtained with all the species sequence information obtained in step 1 one by one, calculate the matching rate of each candidate primer to each species sequence, and select the two primers with the highest matching rate; Step 3: According to the positional relationship of the two primers in the mitochondrial COI gene, the primer directions are optimized to obtain a pair of preferred primers. The sequences of the obtained pair of preferred primers are as follows: COIAF: 5'-CCTAYGGGRBGCASCAG-3'; mlCOIintR:5'-GGACTACNNNGGGTATCTAAT-3'; Step 4: Sampling benthic animals in the target area, collecting benthic animal samples from multiple sampling points, selecting two levels of test samples from the benthic animal samples, namely single species and natural samples, and then extracting test sample DNA from all test samples Step 5: using the preferred primers in step 3, amplifying and testing the target fragment DNA sequences of the two-level test samples in step 4, and combining the test results of the two-level test samples to test the quality and application effect of the preferred primers; Step 6: Apply the preferred primers that meet the quality requirements and application requirements to the amplification of benthic animal environmental DNA, conduct environmental DNA detection on the target area based on the target fragment DNA sequence of the test sample after amplification, realize water ecological damage assessment and identification, and obtain water ecological damage assessment results.

2. The environmental DNA detection method based on benthic animal primer optimization according to claim 1, characterized in that: The calculation process of the matching rate in step 2 is as follows: Retrieve and determine the species sequence length of each test sample species; Compare each primer with the species sequence of each species one by one, and record the number of sequences that each primer successfully compares with each species sequence; The percentage of the number of successfully aligned sequences to the total length of the species sequence is recorded as the matching rate of the species sequence.

3. The environmental DNA detection method based on benthic animal primer optimization according to claim 1, characterized in that: The process of designing the optimization in step 3 is as follows: Determine the positional relationship of the two primers in the mitochondrial COI gene and obtain the front-to-back and forward-reverse relationship of the two primers; After the two primers are processed in reverse order, each base is replaced with its corresponding base pair to obtain a pair of preferred primers corresponding to the target test sample.

4. The environmental DNA detection method based on benthic animal primer optimization according to claim 1, characterized in that: When the test sample detected in step 5 is a single species, first extract the test sample DNA, then use the selected primers to amplify the target fragment DNA sequence, generate a PCR amplification result identification gel image and PCR product, evaluate the quality of the amplified sequence, and determine whether the PCR product meets the requirements of subsequent experiments.

5. The environmental DNA detection method based on benthic animal primer optimization according to claim 1, characterized in that: When the test sample detected in step 5 is a natural sample, first extract the test sample DNA, then use the selected primers and universal primers to amplify the target fragment DNA sequence, generate a PCR amplification result identification gel image and PCR product, evaluate the quality of the amplified sequence, and determine whether the PCR product meets the requirements of subsequent experiments.

Images