Application of MIF as target spot in preparation of medicine for monitoring or treating ischemic white matter injury
By designing reagents to regulate MIF expression, the problem of difficulty in effectively regulating MIF expression in the prior art is solved, effective monitoring and treatment of ischemic leukoplasmic injury is achieved, demyelination and chemotactic B cells are alleviated, and the clinical application value is good.
Patent Information
- Application Number
- CN202510480880.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-17
- Publication Date
- 2025-06-10
AI Technical Summary
The prior art is difficult to effectively regulate MIF expression and is used to monitor or treat ischemic leukoplasmic injury.
Reduce MIF expression or inhibit MIF gene expression by designing a reagent that regulates MIF or MIF genes, including MIF protein antibodies, recombinant adenoviruses that inhibit MIF gene expression, small molecule compounds, siRNAs and inhibitors.
Inhibition of MIF expression can alleviate the severity of demyelination and chemotactic B cells in ischemic cerebral white matter injury, thereby improving neuroinflammation, and has good clinical application value.
Smart Images

Figure CN120118993A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of drug treatment for white matter injury of the brain, and particularly to the use of MIF as a target in the preparation of a drug for monitoring or treating ischemic white matter injury. Background Art
[0002] Ischemic White Matter Injury refers to ischemic injury in the white matter region of the brain caused by reduced or interrupted cerebral blood flow. It is commonly seen in cerebrovascular diseases, chronic hypoperfusion states (such as hypertension, diabetes), and the aging process, and is an important pathological basis for Vascular Cognitive Impairment (VCI) and Vascular Dementia (VaD). There are research reports indicating that neuroinflammation plays an important role in the pathogenesis of ischemic white matter injury. The brain's response to vascular injury involves an acute and long-term inflammatory process, characterized by the rapid activation of microglia, the production of pro-inflammatory cytokines, and the entry of various types of white blood cells (including lymphocytes, neutrophils, monocytes) into the ischemic brain tissue. These mechanisms together lead to ischemic white matter injury. And B lymphocytes, as an important component of lymphocytes, have immunomodulatory functions and participate in regulating the functions of cells such as macrophages, dendritic cells, and natural killer cells by producing cytokines. In addition, B lymphocytes can differentiate into plasma cells under antigen stimulation and Th cell assistance to produce high-affinity antibodies and exercise humoral immune functions. After the primary immune response, some high-affinity cells differentiate into memory B cells and continuously participate in the body's immune process.
[0003] Macrophage migration inhibitory factor (MIF), as a cytokine secreted by T cells, participates in innate and adaptive immune responses. In addition to immune cells, MIF is secreted by a variety of non-immune cells, including hematopoietic cells, endothelial cells, and neurons. Notably, MIF participates in regulating the functions of various types of cells in the nervous system, such as neurons, glial cells, and endothelial cells. It induces neuroinflammation through chemokine-like effects and causes cell death with nuclease activity. However, in ischemic white matter injury, the specific roles and mechanisms of MIF as a target in regulating B lymphocytes and central neuroinflammation remain to be explored.
[0004] Currently, there is an urgent need to develop a reagent that regulates the expression of MIF for monitoring or treating ischemic white matter injury. Summary of the Invention
[0005] The object of the present invention is to overcome the deficiencies of the prior art and provide an application of MIF as a target in the preparation of drugs for monitoring or treating ischemic white matter injury. The present invention explores the specific role and mechanism of MIF in affecting B lymphocytes and central nerve inflammation in ischemic white matter injury by regulating the expression of MIF, and proves the efficacy of MIF as a potential therapeutic target in improving neuroinflammation mediated by ischemic white matter injury.
[0006] To achieve the above object, the technical solution designed by the present invention is as follows:
[0007] The present invention provides an application of MIF as a target in the preparation of drugs for monitoring or treating ischemic white matter injury and its related diseases.
[0008] Further, the related diseases are vascular cognitive impairment, vascular dementia, leukoaraiosis, cerebral small vessel disease, multiple sclerosis and stroke sequelae.
[0009] The present invention also provides an application of a reagent for regulating MIF or MIF gene in the preparation of drugs for monitoring or treating ischemic white matter injury and its related diseases.
[0010] Further, the reagent refers to a reagent that reduces the expression level of MIF or inhibits the expression of MIF gene.
[0011] Still further, the reagent is any one of an MIF protein antibody, a recombinant adenovirus that inhibits the expression of MIF gene, a small molecule compound, siRNA and an inhibitor.
[0012] The present invention also provides an siRNA (i.e., si-MIF) for knocking down MIF gene, and the siRNA has a nucleotide sequence complementary to the MIF gene
[0013] Still further, the siRNA is CGGACCAGCUCAUGACUUUTT, as shown in SEQ ID NO:1.
[0014] The present invention also provides a recombinant adenovirus AAV-MIF for knocking down the expression of MIF gene. The recombinant adenovirus AAV-MIF has a mir30 shRNA inserted into the genome of adenovirus AAV, and the nucleotide sequence of mir30 shRNA is ACCGGGTCTACATCAACTATT, as shown in SEQ ID NO:2.
[0015] The present invention also provides a drug for treating ischemic white matter injury, which is characterized in that: the active ingredient of the drug includes the siRNA described in claim 6 or the recombinant adenovirus AAV-MIF described in claim 8.
[0016] The present invention also provides an application of a kit for detecting MIF gene expression in the preparation of a product for assisting in monitoring or evaluating ischemic white matter injury.
[0017] Advantages of the present invention:
[0018] The present invention creatively discovers the application of MIF as a target in the preparation of drugs for monitoring or treating ischemic white matter injury. MIF is highly expressed in microglia in the demyelinated region of ischemic white matter injury and can be applied to the disease monitoring of ischemic white matter injury. Inhibiting the expression of MIF can alleviate the severity of demyelination and the chemotaxis of meningeal B cells in ischemic white matter injury, so it can be applied to the preparation of drugs for ischemic white matter injury and has good clinical application value. Description of the drawings
[0019] Figure 1 It is a diagram of the interaction relationship between brain microglia and meningeal B cells;
[0020] Figure 2 It is a statistical chart of the proportion of MIF+Iba-1+ microglia;
[0021] Figure 3 It is a diagram of the expression of MIF in microglia detected by q-PCR (left figure) and Elisa enzyme-linked immunosorbent assay (right figure);
[0022] Figure 4 It is a statistical chart of the white matter injury degree score of mice;
[0023] Figure 5 It is a correlation analysis diagram of the expression of MIF in microglia and the degree of myelin loss in white matter injury;
[0024] Figure 6 It is a statistical chart of the number of B cells;
[0025] Figure 7 It is a statistical chart of the learning and memory ability of mice;
[0026] Figure 8 It is a statistical chart of the changes in working memory and reference memory of mice;
[0027] In the figure, A is a statistical chart of the working memory errors of mice;
[0028] B is a statistical chart of the number of times mice enter different arms in the first 8 times;
[0029] C is a statistical chart of the reference memory errors of mice;
[0030] Figure 9 It is a statistical chart of the white matter injury degree score of mice;
[0031] Figure 10 It is a statistical chart of B cell chemotaxis index. Specific implementation manners
[0032] The present invention will be further described in detail below in conjunction with specific embodiments for those skilled in the art to understand.
[0033] Example 1 Interaction relationship between brain microglia and meningeal B cells
[0034] In this example, a mouse model of ischemic white matter injury was established by bilateral common carotid artery stenosis (BCAS) surgery. The specific steps are as follows:
[0035] After anesthetizing the mice with isoflurane, the skin was incised along the midline of the neck, the thyroid gland was dissected, and the trachea and bilateral common carotid arteries of the mice were exposed. A microspring with an inner diameter of 0.18 mm, a pitch of 0.50 mm, and a total length of 2.5 mm was wound around the bilateral common carotid arteries of the mice. The incision was closed, and the skin was sutured. Monitoring a 40% decrease in cerebral blood flow represented the successful establishment of the BCAS mouse model. 30 days was selected as the observation time point for ischemic white matter injury.
[0036] The brain tissue and meningeal tissue of mice 30 days after BCAS surgery were taken to prepare single-cell suspensions. For the prepared single-cell suspensions, flow cytometry was used to sort CD45-positive and Iba1-positive immune cells for single-cell sequencing. Based on the single-cell sequencing data, the Seurat package was used to perform clustering analysis on the cells to identify microglia in the brain tissue and B cells in the meningeal tissue. Previous studies have shown that meningeal B cells can affect cells in the brain tissue through multiple mechanisms, and chemotactic migration is an important way. Specifically, after chemokines bind to chemokine receptors on the surface of meningeal B cells, a series of intracellular signaling pathways will be activated, leading to cell migration. In this example, the CellChat package was used to analyze the interaction between meningeal B cells and brain microglia.
[0037] The results are as Figure 1 shown, the interaction between brain microglia and meningeal B cells is mediated by the MIF-CD74 ligand-receptor.
[0038] Example 2 Increased expression of MIF in microglia under ischemic white matter injury
[0039] Immunofluorescence staining (IF) is a technique that uses antibodies to specifically bind to target antigens and detects them through fluorescent markers. In this example, immunofluorescence staining was used to localize and quantitatively analyze the expression of MIF in microglia, as follows:
[0040] The frozen sections were rewarmed at room temperature, washed with phosphate buffer for 5 min, air-dried, and then incubated with immunofluorescence permeabilization solution and blocking solution at room temperature for 15 min successively. After washing with PBS, primary antibodies Anti-MIF antibody (purchased from Cell Signaling Technology, catalog number 75038T, host Rabbit, dilution ratio 1:100) and Anti-Iba1 antibody (purchased from abcam, catalog number ab5076, host Goat, dilution ratio 1:400) were added and incubated overnight at 4°C. After washing 3 times with phosphate buffer for 5 minutes each time, the corresponding secondary antibodies Donkey anti-rabbit Alexa Fluor 594 (purchased from Yeasen Biotech, dilution ratio 1:200) and Donkey anti-goat Alexa Fluor 488 (purchased from Yeasen Biotech, dilution ratio 1:200) were added and incubated in the dark at room temperature for 1 h. After washing with PBS and slightly air-drying, the slides were mounted with an anti-fluorescence quencher containing DAPI (DiamidinoPhenylindole). Observation was performed using a laser confocal microscope, and the images were analyzed with ImageJ software and further data statistics were conducted.
[0041] The results were as Figure 2 shown. Compared with the Sham group, the proportion of microglia that were double-positive for MIF and Iba-1 in the BCAS group was significantly increased.
[0042] In vitro simulation of the microenvironment after white matter injury is an important method for studying ischemic, inflammatory, or degenerative white matter lesions of the brain. In this example, an in vitro demyelination injury model was constructed by treating primary microglia with exogenous myelin, and the specific steps are as follows:
[0043] The brain tissues of neonatal rats were dissected, minced, digested, and cultured in an incubator at 37°C with 5% CO2 for 14 days, and primary microglia were collected. The primary microglia without any treatment were the Control group. The primary microglia were cultured in a low-glucose medium with 5 μg / ml of exogenous myelin in vitro for 4 h, 8 h, and 12 h, which were the 4 h group, 8 h group, and 12 h group, respectively, to simulate the environment of demyelination injury in vitro.
[0044] Then, the proteins and RNAs of microglia at 4 h, 8 h, and 2 h were extracted respectively, and the expression of MIF in microglia was detected using Elisa enzyme-linked immunosorbent assay (Mouse MIF DuoSet ELISA kit, catalog number DY1978) and q-PCR detection.
[0045] As Figure 3As shown, both protein level and transcriptional level results indicate that, compared with the Control group, the expression of MIF in microglia at 4 h, 8 h, and 12 h is significantly increased. Moreover, with the extension of time, the expression of MIF in microglia further increases, and the MIF expression in microglia reaches its peak at 12 h after myelin stimulation.
[0046] The above in vivo and in vitro results suggest that the expression of MIF in microglia is significantly increased under the background of white matter injury, indicating the potential significance of MIF as a monitoring and treatment target for ischemic cerebrovascular diseases.
[0047] Example 3 After ischemic white matter injury, the severity of myelin loss increases and is positively correlated with the expression of MIF in microglia.
[0048] In this example, Luxol Fast Blue (LFB) staining is used to evaluate the severity of myelin loss in white matter injury. LFB staining is a staining method that shows the morphological structure and pathological changes of nerve myelin, and can reflect the severity of white matter injury by evaluating the area of myelin loss in the corpus callosum. Mouse brain tissues are taken and sectioned for LFB staining. The specific steps are as follows:
[0049] After rewarming the frozen sections at room temperature, they are washed with phosphate buffer, tap water, and ultrapure water for 5 min each. Then, they are dehydrated in a gradient of 75% - 95% - 100% alcohol and placed in 0.1% LFB dye for staining at 60°C for 6 - 8 h. After staining, the sections are taken out and placed at room temperature. Then, they are repeatedly differentiated under a microscope with 0.05% lithium carbonate differentiating solution and 75% alcohol until the myelin is stained blue and the background is nearly colorless. At this time, the intact myelin fibers are stained blue, while the lost myelin fibers are colorless. According to previous research methods, the degree of myelin loss is scored and statistically analyzed according to grade 0: normal; grade 1: nerve fiber disorder; grade 2: visible vacuole formation; grade 3: disappearance of myelin fibers.
[0050] As Figure 4 The results show that, compared with the Sham group, the degree of myelin loss in the BCAS group is significantly increased, indicating that white matter injury is aggravated.
[0051] Next, a correlation analysis is performed between the expression of MIF in microglia and the degree of myelin loss in white matter injury.
[0052] The results are as Figure 5 shown. With the increase in the proportion of MIF and Iba-1 double-positive microglia in the brain, that is, the increase in the expression level of MIF in microglia, the degree of white matter injury is significantly aggravated (P = 0.0167). This further indicates the potential significance of MIF as a monitoring and treatment target for ischemic cerebrovascular diseases.
[0053] Example 4 Construction of recombinant adenovirus AAV-MIF for knocking down MIF expression
[0054] The recombinant adenovirus AAV-MIF for knocking down MIF expression is an adenovirus AAV genome inserted with mir30shRNA. Among them, the nucleotide sequence of mir30 shRNA is: ACCGGGTCTACATCAACTATT.
[0055] The construction method of the above recombinant adenovirus AAV-MIF is specifically as follows:
[0056] Step 1: Interference target design and sequence synthesis:
[0057] According to the general principles of mir30 shRNA design and the transcript of the MIF gene, design the target and synthesize the sequence mir30 shRNA, whose nucleotide sequence is: ACCGGGTCTACATCAACTATT.
[0058] Step 2: Preparation of linearized expression vector:
[0059] Use a restriction endonuclease to digest the expression vector pAAV-CBG-DIO-EGFP-miR30shRNA-WPRE. The obtained digestion product is detected by agarose gel electrophoresis for the digestion effect.
[0060] Step 3: Ligate the target fragment into the expression vector and perform transformation of DH5α competent cells.
[0061] Step 4: Pick the transformants grown on the plate and resuspend them in 10 μl of LB culture medium. Take 1 μl as a template for colony PCR identification.
[0062] Step 5: For the positive clones identified by colony identification, perform sequencing verification. For the correctly verified positive clones, perform high-purity plasmid miniprep to obtain the recombinant adenovirus AAV-MIF.
[0063] Example 5 Recombinant adenovirus AAV-MIF knocking down MIF expression alleviates the chemotaxis of meningeal B cells in ischemic white matter injury
[0064] The chemotaxis of meningeal B cells refers to the process by which these cells migrate from the meninges or other sites to specific regions of the central nervous system under the guidance of specific chemokines. Infiltrating meningeal B cells can differentiate into plasma cells, produce autoantibodies, or exacerbate the inflammatory response by secreting pro-inflammatory cytokines (such as IL-6, TNF-α), thereby leading to vascular damage and neurodegeneration.
[0065] Ten days before performing the BCAS surgery, in Cx3cr1CreERT2 AAV was injected into the bilateral corpus callosum of mice (coordinates: ±1.0 mm from the midline; 0.8 mm in front of the bregma; 2.2 mm deep). 0.2 μL of the virus solution was injected into each side of the corpus callosum at an injection rate of 0.04 μL / min, and the final injection volume of the virus was 1.7E+12 vg per mouse. The specific grouping is as follows:
[0066] Vehicle group: BCAS mice without any treatment;
[0067] AAV-NC group: BCAS mice were injected with the negative control AAV-NC;
[0068] AAV-MIF group: BCAS mice were injected with recombinant adenovirus AAV-MIF to knockdown the expression of MIF in mice;
[0069] Flow cytometry is a high-throughput, rapid, and accurate technique that can be used for immunophenotyping analysis, signal transduction analysis, and interpretation of cell population heterogeneity. The specific steps are as follows:
[0070] a. The meninges tissue was dissected from the mouse skull and placed in 1 ml of 1640 medium. 20 μl of 5% collagenase II and 10 μl of 10 mg / ml DNase were added, and it was incubated in an incubator at 37°C for 45 min, with pipetting every 15 min until the tissue was completely dissociated.
[0071] b. 1 ml of 1640 medium containing 20% serum was added to terminate the digestion. It was centrifuged at 500 g for 5 min, the supernatant was discarded, 100 μl of 1:1000 Fvs700 was added, and it was incubated at 4°C for 10 min. 1 ml of 2% FACS was added, and it was centrifuged at 500 g for 5 min, and the supernatant was discarded.
[0072] c. 100 μl of 1:100 Fc block was added to block for 10 min, and then mouse meningeal B cells were labeled using CD19-APC and B220-FITC double-label flow cytometry and incubated at 4°C for 30 minutes.
[0073] d. The obtained cell suspension was filtered through a 40-μm filter into a flow tube and prepared for analysis on the machine.
[0074] As Figure 6 shown: Compared with the Vehicle group, there was no significant change in the number of meningeal B cells in the AAV-NC group. However, compared with the other two groups, the number of meningeal B cells in the AAV-MIF group was significantly reduced. This suggests that knockdown of MIF expression in microglia helps to alleviate the chemotaxis of meningeal B cells caused by ischemic white matter injury.
[0075] Example 6 Recombinant adenovirus AAV-MIF knockdown of MIF expression alleviates cognitive dysfunction caused by ischemic white matter injury
[0076] (1) Recombinant adenovirus AAV-MIF knockdown of MIF expression improved the learning and memory ability of BCAS mice
[0077] The novel object recognition test is a behavioral experiment that utilizes the characteristics of mice's preference for exploring novel objects to detect their learning and memory abilities. The specific steps are as follows: Mice were treated and grouped as in Example 4 above
[0078] On the first day of the experiment, which was the adaptation day, the mice were placed in a 40×40×40 cm cube open field for 10 min to adapt
[0079] On the next day, which was the test day, two cubes were placed in a fixed area for the mice to become familiar with for 10 min. One hour later, one of the cubes was replaced with a sphere, and the exploration time of the mice for the novel object was observed. The learning and memory ability of the mice was evaluated according to the novel object exploration index (novel object head exploration time / novel object head exploration time + old object head exploration time)
[0080] As Figure 7 The results showed that there was no significant difference in the novel object exploration index between the Vehicle group and the AAV-NC group. However, the mice in the AAV-MIF group had a longer exploration time for the novel object compared to the mice in the Vehicle group and the AAV-NC group, indicating that the learning and memory abilities of BCAS mice were improved after knockdown of MIF expression
[0081] (2) Recombinant adenovirus AAV-MIF knockdown of MIF expression improved the working memory of BCAS mice
[0082] The eight-arm maze consists of eight identical arms arranged radially at equal angles and a common platform in the middle. It is a behavioral device used to detect the cognitive function of mice and is usually used to evaluate changes in cognitive function in mice under the influence of drugs or brain injury. The specific steps are as follows: Mice were treated and grouped as in the above method
[0083] Before the experiment, the mice were fasted and water-deprived for 6 - 8 h to induce their foraging behavior during the experiment. Food was placed in the eight arms of the maze to drive them to explore the maze. After each arm was numbered and food was placed in it, the mice were placed in the middle of the platform and the timing started. The number of each arm entered was recorded, and the experiment ended after each arm had been entered. After 7 days of training, the records of the first eight times the mice entered the arms and the number of times the mice repeatedly visited the arms during the entire experiment were working memory errors. In the following three days, food was only placed in the fixed arms 2, 4, 6, and 8. The mice were placed in, and the number of repeated visits during the process of the mice eating the food in the four arms was recorded. This was repeated three times a day for a total of 9 times, which was recorded as reference memory errors
[0084] As Figure 8A-B display: The number of revisit errors in the AAV-MIF group of mice was significantly lower than that in the Vehicle group and the AAV-NC group of mice, and they were more inclined to choose food from different arms in the first eight times, indicating that the working memory of BCAS mice with knocked-down MIF expression was improved. At this time, there was no statistical significance in the results of the reference memory test among the three groups of mice ( Figure 8 C), which indicated that ischemic white matter injury mainly impaired the working memory of mice, and there was no obvious change in reference memory. This indicated that the working memory of BCAS mice was improved after knocking down MIF expression.
[0085] In summary, the above results showed that knocking down MIF expression could improve the learning and memory ability and working memory of mice with ischemic white matter injury, thereby improving cognitive dysfunction.
[0086] Example 7 Recombinant adenovirus AAV-MIF knocking down MIF expression alleviates demyelination caused by ischemic white matter injury
[0087] Mice were treated and grouped in the above-mentioned manner. Then, Luxol Fast Blue (LFB) staining was used to evaluate the severity of white matter injury.
[0088] As Figure 9 The results showed that there was no obvious change in the degree of white matter injury between the Vehicle group and the AAV-NC group. Notably, compared with the other two groups, the white matter injury score in the AAV-MIF group was significantly lower. This suggested that knocking down MIF expression helped alleviate the severity of demyelination caused by ischemic white matter injury.
[0089] From Examples 5-6 above, it can be seen that recombinant adenovirus AAV-MIF can be used as a drug for the preparation of treating ischemic white matter injury.
[0090] Example 8 After knocking down MIF expression in vitro, the chemotaxis of B cells was reduced
[0091] The chemotaxis of B cells refers to the process by which B cells migrate to specific tissues (such as cerebral blood vessels or brain parenchyma) under the guidance of chemokines. In vascular cognitive impairment, the blood-brain barrier is damaged, and the expression of chemokines (such as CXCL12, CXCL13) increases, attracting B cells to migrate from the periphery to the brain. Infiltrating B cells can differentiate into plasma cells, produce autoantibodies, or exacerbate the inflammatory response by secreting pro-inflammatory cytokines (such as IL-6, TNF-α), thereby leading to vascular damage and neurodegeneration. In this example, mouse B cells were extracted and cultured in vitro, and the specific steps were as follows:
[0092] Under sterile conditions, the spleens of 8-week-old normal mice were taken and placed in a six-well plate containing an appropriate amount of cell culture medium. The tissues were ground into a single-cell suspension, and the cell suspension was treated with erythrocyte lysate. After terminating the erythrocyte lysis, the supernatant was removed by centrifugation, leaving the leukocyte layer. The cells were washed with PBS to remove residual lysate and debris. The cell pellet was collected by centrifugation and then resuspended in an appropriate amount of culture medium.
[0093] Furthermore, murine primary B cells were obtained by magnetic bead sorting and then cultured. At the same time, cytokines were used to activate B cells. The specific steps were to treat B cells with anti-CD40 (10 μg / ml), anti-IgM (10 μg / ml), and R848 (0.05 μM) simultaneously and culture the B cells to a good state.
[0094] Small interfering RNA (siRNA) is a double-stranded RNA with a length between 20 and 25 nucleotides. It has many biological applications and is currently mainly used to interfere with RNA to achieve the purpose of regulating gene expression (knockdown). Its essence is that siRNA specifically binds to and degrades the corresponding mRNA, thereby achieving the purpose of blocking the continued translation of mRNA.
[0095] Thus, the nucleotide sequence of the designed small interfering RNA (i.e., si-MIF) is CGGACCAGCUCAUGACUUUTT. The following is the specific method for using this small interfering RNA to knockdown the expression of MIF:
[0096] Step 1: Prepare Reagent 1: It was prepared by mixing 3.75 μL of transfection reagent lipo3000 and 121.25 μL of medium opti-men. After mixing, it was incubated at room temperature for 5 minutes to obtain Reagent 1 (with a volume of 125 μL).
[0097] Step 2: Prepare Reagent 2: It was prepared by mixing 5 μL of si-MIF or si-NC (control RNA, Si-NC is a double-stranded small molecule RNA of 21 - 23 nt, and the product is a ready-to-use reagent in the form of a lyophilized powder. Purchased from General Biology (Anhui) Co., Ltd.) and 120 μL of medium opti-men. After mixing, it was incubated at room temperature for 5 minutes to obtain si-MIF reagent (with a volume of 125 μL) or si-NC reagent (with a volume of 125 μL) respectively.
[0098] Step 3: Prepare the transfection system (si-NC system or si-MIF system): Add Reagent 2 (si-MIF reagent or si-NC reagent) to Reagent 1 and mix well, and incubate at 37 °C for 15 minutes to obtain the si-NC system and the si-MIF system respectively.
[0099] Step 4. Transfection: si-NC group: Take out the well-cultured B cells (6-well plate), and add 250 μL of the negative control si-NC system and 1750 μL of 10% FBS high-glucose medium to each well;
[0100] si-MIF group: Take out the well-cultured B cells (6-well plate), and add 250 μL of the si-MIF system and 1750 μL of 10% FBS high-glucose medium;
[0101] cytokines+si-NC group: Take out the activated and well-cultured B cells (6-well plate), and add 250 μL of the negative control si-NC system and 1750 μL of 10% FBS high-glucose medium to each well;
[0102] cytokines+si-MIF group: Take out the activated and well-cultured B cells (6-well plate), and add 250 μL of the si-MIF system and 1750 μL of 10% FBS high-glucose medium to each well;
[0103] Then, select appropriate chemokines and create a concentration gradient in the culture plate. Collect B cells from each group for chemotaxis experiments to measure the number of migrated cells and calculate the chemotaxis index.
[0104] As Figure 10 The results showed that compared with the si-NC group, the chemotaxis index of B cells in the si-MIF group was significantly decreased; compared with the cytokines+si-NC group, the chemotaxis index of B cells in the cytokines+si-MIF group was significantly decreased. It is worth noting that there was no significant difference in the chemotaxis index of B cells between the si-NC group and the cytokines+si-NC group. This indicates that knocking down the expression of MIF in vitro alleviates the chemotaxis of B cells, and this alleviated chemotaxis is independent of the functional state of B cells, suggesting that MIF can be used as a potential therapeutic or monitoring target for regulating the chemotactic function of B cells.
[0105] Other parts not described in detail are prior arts. Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all belong to the protection scope of the present invention.
Claims
1. An application of MIF as a target in the preparation of drugs for monitoring or treating ischemic white matter damage and related diseases.
2. The use according to claim 1, characterized in that: The related diseases are vascular cognitive dysfunction, vascular dementia, leukoaraiosis, cerebral small vessel disease, multiple sclerosis and sequelae of stroke.
3. Use of a reagent for regulating MIF or MIF gene in the preparation of a drug for monitoring or treating ischemic white matter damage and related diseases.
4. The use according to claim 1, characterized in that: The reagent refers to a reagent that reduces the expression level of MIF or inhibits the expression of the MIF gene.
5. The use according to claim 3 or 4, characterized in that: The reagent is any one of a MIF protein antibody, a recombinant adenovirus for inhibiting the expression of the MIF gene, a small molecule compound, siRNA and an inhibitor.
6. A siRNA for knocking down the MIF gene, characterized in that: The siRNA has a nucleotide sequence complementary to the MIF gene.
7. The siRNA for knocking down the MIF gene according to claim 6, characterized in that: The siRNA is CGGACCAGCUCAUGACUUUTT.
8. A recombinant adenovirus AAV-MIF for knocking down the expression of MIF gene, characterized in that: The recombinant adenovirus AAV-MIF is a recombinant adenovirus AAV in which mir30 shRNA is inserted into the genome, wherein the nucleotide sequence of mir30 shRNA is ACCGGGTCTACATCAACTATT.
9. A drug for treating ischemic white matter damage, characterized in that: The active ingredient of the drug includes the siRNA described in claim 6 or the recombinant adenovirus AAV-MIF described in claim 8.
10. Use of a kit for detecting MIF gene expression in the preparation of a product for assisting in the detection or assessment of the severity of ischemic cerebral white matter damage.