A rt-mira-lfd kit for detecting pedv

Abstract

The application discloses a RT-MIRA-LFD kit for detecting PEDV and belongs to the technical field of molecular biology. The application firstly provides a RT-MIRA-LFD primer probe combination for rapidly detecting porcine epidemic diarrhea virus, which comprises an upstream primer shown as SEQ ID NO. 5, a downstream primer shown as SEQ ID NO. 7 and a probe shown as SEQ ID NO. 9; secondly, the application provides a kit and a detection method for rapidly detecting porcine epidemic diarrhea virus. The application designs the primer and the probe for detecting porcine epidemic diarrhea virus based on the RT-MIRA-LFD technology, and designs the RT-MIRA-LFD detection method. The detection method has the advantages of high sensitivity and high specificity, short detection time and visual results, and provides a new experience method for rapid detection of porcine epidemic diarrhea virus.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology, and particularly relates to an RT-MIRA-LFD kit for detecting PEDV. BACKGROUND

[0002] Porcine ePidemic diarrhea (PED) is a highly contagious intestinal disease characterized by vomiting, dehydration and diarrhea caused by porcine epidemic diarrhea virus (PEDV) infection. Porcine epidemic diarrhea virus belongs to the family of Coronaviridae, and is a linear, positive-strand, single-strand RNA virus with a total genome of about 280000 bp. Lactating piglets, pigs on the shelf and fattening pigs are all susceptible to porcine epidemic diarrhea, and the incidence rate is 100%. Especially lactating piglets are most severely affected, and 1-week-old lactating piglets die of dehydration after 3-4 days of persistent diarrhea, with an average mortality rate of 50%, and sometimes as high as 90%. Porcine epidemic diarrhea is an independent acute contact intestinal infectious disease of pigs, and sick pigs and virus-carrying pigs are the main sources of infection. Under natural conditions, feces or contaminants discharged by infected pigs are infected through the oral route, and lactating piglets, weaned piglets and fattening pigs are more susceptible, with an incidence rate of 100%, and these pig groups will carry the virus persistently.

[0003] At present, traditional methods such as virus isolation, HA / HI, ELISA and PCR technology are used for detecting PEDV, and the PCR technology has better specificity and sensitivity, and is more reliable in clinical sample detection, and is more favored by the testers. However, the PCR technology is difficult to popularize due to its dependence on precise and expensive instruments, long detection time, high cost and the need for professional operation, and has certain limitations in clinical application, and it is difficult to meet the needs of basic detection. In addition, pathogen isolation and serological methods cannot make a definite diagnosis. Therefore, it is urgent to provide a method with faster detection speed, higher sensitivity and more simple detection process to improve the detection efficiency and diagnostic accuracy of PEDV. SUMMARY

[0004] The present application provides an RT-MIRA-LFD kit for detecting PEDV to solve the problems existing in the prior art. The present application designs primers and probes for detecting porcine epidemic diarrhea virus based on RT-MIRA-LFD technology, and an RT-MIRA-LFD detection method, which has the advantages of high sensitivity and high specificity, short detection time and visual results, and provides a new experience method for rapid detection of porcine epidemic diarrhea virus.

[0005] To achieve the above-mentioned purpose, the present application provides the following solutions.

[0006] The application provides an RT-MIRA-LFD primer probe combination for rapidly detecting porcine epidemic diarrhea virus, which comprises an upstream primer shown as SEQ ID NO. 5, a downstream primer shown as SEQ ID NO. 7 and a probe shown as SEQ ID NO. 9.

[0007] Further, the 5' end of the downstream primer is labeled with biotin; the 5' end of the probe is labeled with a FAM group, the 3' end is modified with a C3-spacer, and the 31st base from the 5' end is replaced with a dSpacer label.

[0008] The application also provides an application of the RT-MIRA-LFD primer probe combination in the preparation of a reagent or kit for rapidly detecting porcine epidemic diarrhea virus.

[0009] The application also provides an RT-MIRA-LFD kit for rapidly detecting porcine epidemic diarrhea virus, which comprises the RT-MIRA-LFD primer probe combination.

[0010] Optionally, the RT-MIRA-LFD kit further comprises a lateral flow chromatographic test strip.

[0011] The application also provides a non-diagnostic porcine epidemic diarrhea virus detection method, which comprises reverse transcription of an RNA sample to be detected to obtain a nucleic acid sample.

[0012] The nucleic acid sample is used as a template to perform MIRA amplification by using the RT-MIRA-LFD kit.

[0013] The lateral flow chromatographic test strip is used to detect the MIRA amplification product to perform result interpretation.

[0014] Further, the reaction system of the MIRA amplification is 29.4 muL of A Buffer, 2 muL of 10 muM upstream primer, 2 muL of 10 muM downstream primer, 0.6 muL of 10 muM probe, 5 muL of template, 2.5 muL of B Buffer and 8.5 muL of RNase-free Water.

[0015] Further, the reaction temperature of the MIRA amplification is 36-41 DEG C, and the reaction time is 15-20 min.

[0016] Further, the result interpretation method is that when the quality control line and the detection line develop color, it indicates that the sample to be detected contains porcine epidemic diarrhea virus; when the quality control line develops color but the detection line does not develop color, it indicates that the sample to be detected does not contain porcine epidemic diarrhea virus; and when neither the quality control line nor the detection line develops color, it indicates that the lateral flow chromatographic test strip is invalid and needs to be re-detected.

[0017] The present invention discloses the following technical effects:

[0018] (1) This invention is the first to use RT-MIRA nucleic acid test strip detection technology to establish a rapid detection method for porcine epidemic diarrhea virus. This method has the advantages of high sensitivity, specificity and repeatability.

[0019] (2) This invention designs multiple primer pairs for screening porcine epidemic diarrhea virus, and finally obtains primers and probes with good specificity and high amplification efficiency, while having no cross-reaction with various viruses such as TGEV, HCoV-OC43, and VSV.

[0020] (3) Compared with conventional PCR, the RT-MIRA-LFD of this invention can obtain detection results within 30 minutes, does not require expensive thermal cycling equipment, and uses test strips to detect amplification products, with results available in 2-5 minutes. The sensitivity is 10 times higher than that of conventional PCR technology. 2 The copy number has been increased to 10. 0 The high copy number significantly improves detection sensitivity, making it particularly suitable for grassroots laboratories and on-site testing. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 The images show the screening results for MIRA primers; where A represents the electrophoresis results of the reaction products from primer combinations F1 / R1, F1 / R2, F1 / R3, F2 / R1, F2 / R2, and F2 / R3; B represents the electrophoresis results of the reaction products from primer combinations F3 / R1 and F3 / R2; and C represents the electrophoresis results of the reaction products from primer combination F3 / R3.

[0023] Figure 2 The figure shows the optimization results of the optimal reaction temperature for the RT-MIRA-LFD reaction system; N is the negative control at 40℃.

[0024] Figure 3 The figure shows the optimization results of the optimal probe addition amount for the RT-MIRA-LFD reaction system; N is the negative control after adding 0.6 μL of probe.

[0025] Figure 4 The figure shows the optimization results of the RT-MIRA-LFD reaction system for the optimal reaction time; N is the negative control with a reaction time of 20 min.

[0026] Figure 5 Figure 8 is a result chart of sensitivity analysis of the RT-MIRA-LFD detection system; the test strips No. 1-12 represent 1.67 x 10 10 -1.67 x 10 -1 copies / μL of positive standard sample; N is the negative control;

[0027] Figure 6 Figure 9 is a result chart of specificity analysis of the RT-MIRA-LFD detection system; the test strips No. 1-4 represent the detection results of PEDV, TGEV, HCoV-OC43, and VSV nucleic acid samples; P is 1 x 10 5 copies / μL of positive standard pUC19-PEDV-N; N is the negative control. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present application will now be described in detail, which should be considered to be illustrative of certain aspects, features and embodiments of the present application, but not a limitation thereof.

[0029] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of a parameter, unless otherwise stated, each intervening value of the parameter is also specifically included within the scope of the present application. The intervening values of the parameter are combined with a stated value of the parameter in range form. These are only examples of the various values that can be used, and equivalents thereof, which are within the scope of the present application. Other examples of the various values that can be used are within the scope of the present application. Still other examples of the various values that can be used are within the scope of the present application.

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference is not an admission that it is prior art with respect to the present application.

[0031] Many modifications and variations of this application can be made without departing from its spirit or scope, which will be apparent to those skilled in the art. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. For example, the specification can be used to design other devices, systems, and methods with features that are not specifically mentioned herein. The specification and examples given herein are exemplary only. It is to be understood that features of the foregoing preferred embodiments can be combined with each other, unless otherwise contraindicated by context.

[0032] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed material or list of materials.

[0033] The reaction principle of the RT-MIRA-LFD of the present application is as follows: according to the synergistic effect of various functional proteins (helicase, recombinase, single-strand binding protein, DNA polymerase, etc.), the recombinase and the primer form a complex Rec / SsDNA of protein / single-strand nucleotide, find the homologous sequence on the template DNA, position and bind to initiate the strand displacement reaction, the primer binds to the corresponding template, and under the action of the DNA polymerase, the extension is carried out, and the nucleic acid rapid amplification is realized at room temperature. The amplification product is labeled with biotin and carboxyfluorescein (FITC), and is added dropwise on the colloidal gold type test strip, the biotin is combined with the colloidal gold labeled streptomycin to form a ternary complex, which is diffused through the chromatography membrane and is captured by the anti-FITC antibody to form a colored detection line.

[0034] Example 1

[0035] I. Experimental design

[0036] The upstream and downstream primers are manually designed by using the SnapGene software, and the primers are screened by using the biological software Oligo7.0 to ensure that the probability of dimerization between the primers is low. Then, the RT-MIRA amplification is carried out on the positive standard by using the screened primers, and the amplification result is purified and subjected to 1% agarose gel electrophoresis to screen the primers with the best amplification effect. The probe is designed according to the screened primers, and the purpose is to further increase the amplification specificity. All the primers and probes are synthesized by Beijing Ruibo Xingke Biotechnology Co., Ltd. The RT-MIRA detection system is established by using the designed primers and probes, and the reaction conditions are optimized. Finally, the sensitivity and specificity of the optimized RT-MIRA detection system are analyzed.

[0037] II. Experimental methods

[0038] 1. Strains, cells and clinical samples

[0039] The porcine epidemic diarrhea virus used in the present application is isolated by the Veterinary Public Health Laboratory of the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences, using Vero-E6 cells. The Vero-E6 cells are preserved by the Veterinary Public Health Laboratory and are cultured in DMEM containing 10% serum at 37°C under 5% CO2 conditions. Other strains: TGEV, HCoV-OC43, VSV, are preserved by the Veterinary Public Health Laboratory.

[0040] 2. Preparation of viral nucleic acid samples

[0041] The porcine epidemic diarrhea virus was inoculated into Vero-E6 cells, and after three repeated freeze-thawing, 200 μL of supernatant was taken, and the virus RNA genome was extracted using TIANamp Virus RNA Kit according to the instructions, and finally eluted with 40 μL Buffer TE (nuclease-free). The extracted RNA was used One-Step gDNA Removal and cDNA Synthesis Super Mix for reverse transcription to obtain a viral nucleic acid sample.

[0042] 3. Preparation of positive standard

[0043] (1) The N gene sequence of the PEDV classical strain CV777 (accession number: KT323979.1) was used as the reference sequence to design PEDV N gene full-length amplification primers, and the viral nucleic acid sample prepared in step 2 was used as the template. PowerPol2x PCR Mix was selected to amplify the PEDV genome;

[0044] The PEDV-N gene amplification primers are as follows:

[0045] Upstream primer: 5'-aaaacgacggccagtgaattcATGGCTTCTGTCAGCTTTCAGG-3' (SEQ ID NO. 1);

[0046] Downstream primer: 5'-caggtcgactctagaggatccTTAATTTCCTGTGTCGAAGATCTCG-3' (SEQ ID NO. 2);

[0047] (2) The amplification product was recovered and purified using Universal DNA Purification Kit according to the instructions;

[0048] (3) The Ⅱ One Step Cloning Kit was selected to connect the target fragment to the pUC19 vector, which was transformed into 5α competent cells, and after plating culture, 6 sample bacteria were picked and shaken.

[0049] (4) Bacterial liquid PCR was performed using 1% agarose gel electrophoresis to identify positive clones, and bacterial liquid was sent to GeneOrbit for sequencing, and the remaining bacterial liquid was stored at 4°C.

[0050] (5) Select the bacterial culture that has successfully identified positive clones and inoculate it into LB medium (Amp+) at a volume ratio of 1:100. After shaking for 12 hours, extract the plasmid using the Tiangen Biotech endotoxin-free plasmid large-scale extraction kit to obtain the pUC19-PEDV-N positive standard. Measure the plasmid concentration and calculate the plasmid copy number.

[0051] 4. MIRA amplification primer design and screening

[0052] Amplification was performed using the extracted plasmid as a template. Nine primer combinations were created from the primers listed in Table 1: F1 / R1, F1 / R2, F1 / R3, F2 / R1, F2 / R2, F2 / R3, F3 / R1, F3 / R2, and F3 / R3. The reaction system consisted of 8.5 μL of RNase-free water, 29.4 μL of A buffer, 2 μL of upstream primer (10 μM), 2 μL of downstream primer (10 μM), 0.6 μL of probe (10 μM), 5 μL of template, and 2.5 μL of B buffer. The reaction was carried out at 39℃ for 20 min. The reaction products were subjected to 1% agarose gel electrophoresis. The primer that produced the earliest amplified band without any impurities was considered the most effective. The experimental results are as follows: Figure 1 As shown, primer pairs F1 / R3 and F3 / R2 showed the best amplification effect. Considering the need to increase the selectivity of the designed probe, primer pair F3 / R2, which has a longer amplification fragment, was selected for subsequent experiments.

[0053] Table 1 Primer and probe sequence information

[0054] Name Sequence (5'-3') MIRA-F1 TAACAACAGAGGCAACAACCAGTCCCGTGG (SEQ ID NO. 3) MIRA-F2 CCAGTCCCGTGGTAATTCACAGAATCGTGG (SEQ ID NO. 4) MIRA-F3 ACAGAATCGTGGAAATAACCAGGGTCGTGG (SEQ ID NO. 5) MIRA-R1 GCTTATGCCTGTCAGGATTTTCTCCAATAC (SEQ ID NO. 6) MIRA-R2 TCTCCAATACCCAAAGATTTAAGGGCATCC (SEQ ID NO. 7) MIRA-R3 GATTTAAGGGCATCCTTGACAGCAGCCACC (SEQ ID NO. 8)

[0055] 5. Establishment of the PEDVRT-MIRA-LFD reaction system

[0056] (1) Probe design: Based on the target fragment amplified by the upstream and downstream primers selected, a 46bp probe is designed. The 5' end of the probe is labeled with the FAM group, the middle dSpacer replaces G or C, and the 3' end is modified with C3-spacer. Dimer formation of the probe, the probe itself, and the selected primers should be avoided as much as possible.

[0057] The designed probe sequence is as follows:

[0058] [FAM]CAATAACAAGTCTCGTAACCAGTCCAAGAA[dSpacer]CAGGAACCAGTCAAA[C3spacer] (SEQ ID NO. 9).

[0059] (2) In the selected optimal primer pair, the 5' end of the downstream primer is labeled with biotin.

[0060] (3) Preliminary establishment of RT-MIRA-LFD reaction system:

[0061] The RNA constant temperature rapid amplification kit (colloidal gold test strip type) and HybriDetect colloidal gold test strip were purchased from Amp Future (Changzhou) Biotechnology Co., Ltd. 8.5 μL of RNase-free water, 29.4 μL of A Buffer, 2 μL of upstream primer (10 μM) and downstream primer (10 μM), 0.6 μL of probe (10 μM), and 5 μL of template were sequentially added to an eight-tube pipe containing a freeze-dried powder. 2.5 μL of B Buffer was added to the reaction tube cover, and after instantaneous centrifugation, it was mixed by shaking and then centrifuged. The constant temperature reaction was carried out in a water bath at a temperature of 36-41℃ for 5-20 min. The negative control was ddH2O.

[0062] (4) 1 μL of the reaction product was diluted with buffer at a ratio of 1:10000, and nucleic acid test strips (purchased from Amp Future (Changzhou) Biotechnology Co., Ltd.) were used for detection. The results could be observed after 2-5 min.

[0063] (5) Result interpretation:

[0064] ① Negative: both the quality control line (C line) and the detection line (T line) developed color, indicating that the reaction tube had undergone amplification, and the detection sample contained the nucleic acid to be tested;

[0065] ② Positive: C line developed color and T line did not develop color, indicating that the detection sample did not contain the nucleic acid to be tested;

[0066] ③ Invalid: T line did not develop color, and whether C line developed color or not indicated that the detection test strip was invalid, and a new detection test strip needed to be replaced for detection.

[0067] 6. Optimization of RT-MIRA-LFD reaction conditions

[0068] (1) Optimization of the optimal reaction temperature: 1 × 10 5 copies / μL of positive standard pUC19-PEDV-N was used as the template, and different reaction temperatures of 36℃, 37℃, 38℃, 39℃, 40℃, and 41℃ were set. The incubation time was set to 15 min. The reaction product was detected by nucleic acid test strips, and the test strip results are shown in Figure 2 The reaction product can be detected at a temperature of 36℃-41℃, but the 40℃ band is the clearest, indicating that the amplification efficiency is higher at a temperature of 40℃. Considering the simplicity of clinical detection and the optimal reaction temperature of the enzyme, all subsequent incubation temperatures were 40℃.

[0069] (2) Optimization of the optimal probe addition amount: 1 × 10 5copies / μL of positive standard pUC19-PEDV-N as the template, 0.4 μL, 0.6 μL, 0.8 μL of probe was added to the reaction system, and the incubation time was set to 15 min. The reaction product was detected by nucleic acid test strip, and the test strip results are shown in Figure 3 As shown in Fig. 6, when the amount of probe added was 0.6 μL, the detection line band was the strongest, so the optimal amount of probe added to the RT-MIRA-LFD method was determined to be 0.6 μL. In subsequent experiments, all the amounts of probe added were 0.6 μL.

[0070] (3) Optimization of the optimal reaction time: 1 × 10 5 copies / μL of positive standard pUC19-PEDV-N as the template, the incubation time of the system was set to 10 min, 15 min, and 20 min, and the reaction was performed at 40°C. The reaction product was detected by nucleic acid test strip, and the test strip results are shown in Figure 4 As shown in Fig. 7, when the reaction time was 10 min, the detection line did not develop color, when the reaction time was 15 min, the detection line developed color, and when the reaction time was 20 min, the detection line band was the strongest, so the optimal reaction time of the RT-MIRA-LFD method was determined to be 20 min, that is, the optimal incubation time was 20 min.

[0071] 7. Sensitivity analysis of the RT-MIRA-LFD detection system

[0072] Using the RT-MIRA-LFD reaction system constructed above, the sensitivity of the RT-MIRA-LFD detection system was detected. The template used was the positive standard pUC19-PEDV-N, which was diluted by 10 times successively, and the copy numbers of the dilutions were 1.67 × 10 10 , 1.67 × 10 9 , 1.67 × 10 8 , 1.67 × 10 7 , 1.67 × 10 6 , 1.67 × 10 5 , 1.67 × 10 4 , 1.67 × 10 3 , 1.67 × 10 2 , 1.67 × 10 1 , 1.67 × 10 0 , 1.67 × 10 -1 , respectively. The samples with concentration gradients were used as templates, and the reaction was performed at 40°C for 20 min, and the test strip results are shown in Figure 5 As shown in Fig. 8, when the concentration was 10 0At this time, the reaction product can be detected. The minimum detection limit of the RT-MIRA-LFD detection system is 1.67 copies / μL, and the detection range is wide, 1.67-1.67*10 10 The copy number range can be detected, and compared with ordinary PCR, the detection sensitivity is improved by 2 orders of magnitude.

[0073] 8, specificity analysis of the RT-MIRA-LFD detection system

[0074] The specificity of the RT-MIRA-LFD detection system is detected by using the RT-MIRA-LFD reaction system constructed above. The positive samples of PEDV, TGEV, HCoV-OC43 and VSV are detected, the virus genome is extracted according to the method of step 2, the nucleic acid sample is prepared, the DNA or cDNA is used as a template, the RT-MIRA reaction is carried out, and the test strip result is as shown in Figure 6 It can be seen that only the PEDV amplification can see the positive detection line, and the amplification of other viruses cannot be seen, which shows that the method has good specificity and does not have cross amplification reaction with other viruses.

[0075] In summary, the present application designs two primers and one probe, constructs the detection method of RT-MIRA for PEDV, the method is simple, rapid and effective, reduces the detection cost, improves the efficiency, and is more suitable for primary laboratories and on-site detection.

[0076] The above-described embodiments are only preferred modes of the present application, and do not limit the scope of the present application, and various modifications and improvements of the technical solutions of the present application made by those skilled in the art without departing from the design spirit of the present application shall fall within the protection scope of the present application determined by the claims.

Claims

1. A RT-MIRA-LFD kit for rapid detection of porcine epidemic diarrhea virus, characterized in that, The kit comprises an RT-MIRA-LFD primer probe combination and a lateral flow chromatographic test strip; The RT-MIRA-LFD primer probe combination comprises an upstream primer shown as SEQ ID NO. 5, a downstream primer shown as SEQ ID NO. 7 and a probe shown as SEQ ID NO.

9. The 5' end of the downstream primer is labeled with biotin; the 5' end of the probe is labeled with a FAM group, the 3' end is modified with a C3-spacer, and the 31st base from the 5' end is replaced with a dSpacer label.

2. A method for detecting porcine epidemic diarrhea virus for non-diagnostic purposes, characterized by, The RNA of the sample to be tested is reversely transcribed to obtain a nucleic acid sample; The nucleic acid sample is used as a template for MIRA amplification using the RT-MIRA-LFD kit of claim 1; The MIRA amplification product is detected using a lateral flow chromatographic test strip, and the results are interpreted. The method for interpreting the results is as follows: when the quality control line and the detection line develop color, it indicates that the sample to be tested contains porcine epidemic diarrhea virus; when the quality control line develops color but the detection line does not, it indicates that the sample to be tested does not contain porcine epidemic diarrhea virus; and when neither the quality control line nor the detection line develops color, it indicates that the lateral flow chromatographic test strip is invalid and needs to be retested.

3. The detection method according to claim 2, characterized in that, The reaction system for MIRA amplification is 29.4 μL of A Buffer, 2 μL of 10 μM upstream primer, 2 μL of 10 μM downstream primer, 0.6 μL of 10 μM probe, 5 μL of template, 2.5 μL of B Buffer and 8.5 μL of RNase-free Water.

4. The detection method according to claim 2, characterized in that, The reaction temperature for MIRA amplification is 36-41℃, and the reaction time is 15-20 min.

Images