Method for induction and regeneration of black hairy root callus into seedlings

Abstract

The present application belongs to the technical field of plant cultivation, in particular to a method for inducing and regenerating seedlings from Heige callus. The method comprises the following steps: callus induction on Heige, callus regeneration induction culture to obtain regenerated shoots, and further subculture and rooting culture to obtain seedlings. The method improves the callus regeneration induction rate.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of plant cultivation, in particular to a Hege callus induction and regeneration method. BACKGROUND

[0002] The description of the background of the present application belongs to the related technology related to the present application, and is only used to illustrate and facilitate the understanding of the invention content of the present application, and should not be understood as the applicant's explicit recognition or presumption that the applicant considers the prior art on the date of the first filing of the application.

[0003] Hege, also known as Xianghehuang, is one of the local broad-leaved timber forest tree species in Guangxi, and the economic value, ecological value and medicinal value of Xianghehuang are very worthy of people's attention. Xianghehuang is generally propagated by sowing, and there is a lack of mature and stable asexual tissue culture propagation technology, which limits the large-scale breeding of Hege excellent seedlings.

[0004] The transgenic and gene editing breeding of Hege has not been carried out, and the main bottleneck is the lack of genetic transformation technology. The present application further improves the existing technology to solve the existing problems. SUMMARY

[0005] The purpose of the present application is to provide a Hege callus induction and regeneration method to solve the problems in the prior art.

[0006] A Hege callus induction and regeneration method, comprising the following steps: callus induction of Hege, then callus induction culture to obtain regenerated buds, and further subculture and rooting culture to obtain seedlings.

[0007] Further, the callus induction uses callus induction medium, and the hypocotyl of the seedling obtained by sterile sowing of Hege is used as an explant.

[0008] Further, the explant is treated by the following steps:

[0009] The hypocotyl obtained after sterile sowing of Hege seeds is cut into 0.3-0.6cm segments, and the segments are cut longitudinally, and the cut surface is inoculated in the callus induction medium for callus induction;

[0010] The callus induction medium is prepared by the following ingredients by weight: potassium nitrate 383-565 parts, ammonium nitrate 302-430 parts, potassium dihydrogen phosphate 32-44 parts, magnesium sulfate heptahydrate 56-96 parts, calcium chloride dihydrate 49-147 parts, potassium iodide 0.05-0.25 parts, boric acid 0.74-2.21 parts, manganese sulfate tetrahydrate 3.68-6.38 parts, zinc sulfate heptahydrate 1.23-2.95 parts, copper sulfate pentahydrate 0.004-0.008 parts, disodium ethylenediaminetetraacetate 7.86-10.56 parts, ferrous sulfate heptahydrate 5.87-7.89 parts, inositol 12.27-31.91 parts, glycine 0.25-0.74 parts, thiamine hydrochloride 0.017-0.032 parts, nicotinic acid 0.025-0.049 parts, sucrose 6137-8592 parts, agar 1350-1841 parts, naphthalene acetic acid 0.001-0.006 parts, N6-furfuryl methyl adenine 0.01-0.05 parts, 6-benzylaminopurine 0.02-0.05 parts; the pH of the callus induction medium is 6.0-6.5; the callus induction culture condition is: culturing in dark environment for 7-10 days, the temperature is kept at 28±2℃.

[0011] Further, the callus regeneration induction culture uses a regeneration induction medium, which is prepared by the following ingredients by weight: potassium nitrate 383-565 parts, ammonium nitrate 302-430 parts, potassium dihydrogen phosphate 32-44 parts, magnesium sulfate heptahydrate 56-96 parts, calcium chloride dihydrate 49-147 parts, potassium iodide 0.05-0.25 parts, boric acid 0.74-2.21 parts, manganese sulfate tetrahydrate 3.68-6.38 parts, zinc sulfate heptahydrate 1.23-2.95 parts, copper sulfate pentahydrate 0.004-0.008 parts, disodium ethylenediaminetetraacetate 7.86-10.56 parts, ferrous sulfate heptahydrate 5.87-7.89 parts, inositol 12.27-31.91 parts, glycine 0.25-0.74 parts, thiamine hydrochloride 0.017-0.032 parts, nicotinic acid 0.025-0.049 parts, sucrose 6137-8592 parts, agar 1350-1841 parts, naphthalene acetic acid 0.01-0.04 parts, N6-furfuryl methyl adenine 0.001-0.006 parts, 6-benzylaminopurine 0.03-0.07 parts, indole acetic acid 0.01-0.04 parts; the pH of the regeneration induction medium is 6.2-6.4; the regeneration induction culture condition is: culturing in 8h light per day environment for 14-20 days, the temperature is 28±2℃, the light intensity is 1500-2000lx.

[0012] The regeneration induction specific treatment is: cutting the Hege callus into small pieces and then soaking in 0.5-2μg / μl DNA solution, vacuumizing for 10-15min, then taking out the callus small pieces, placing them on the regeneration induction medium with the cut surface downward.

[0013] Further, the DNA solution preparation method: based on pCAMBIA series or pBI121 plant expression vector, using 35S or other plant expression promoter driven sequence 1 to construct recombinant plasmid and import into E. coli, the overnight culture of strain in the super-clean table extracts plasmid; the obtained plasmid is quantified by nanodrop, and adjusted to 0.5-2 μg / μl concentration with sterile ultrapure water;

[0014] The sequence 1 is as shown in SEQ.NO1;

[0015] Further, the subculture of the regenerated sprout uses subculture medium; the subculture medium is prepared by the following components in weight parts: potassium nitrate 383-565 parts, ammonium nitrate 302-430 parts, potassium dihydrogen phosphate 32-44 parts, magnesium sulfate heptahydrate 56-96 parts, calcium chloride dihydrate 49-147 parts, potassium iodide 0.05-0.25 parts, boric acid 0.74-2.21 parts, manganese sulfate tetrahydrate 3.68-6.38 parts, zinc sulfate heptahydrate 1.23-2.95 parts, copper sulfate pentahydrate 0.004-0.008 parts, ethylenediaminetetraacetic acid disodium 7.86-10.56 parts, ferrous sulfate heptahydrate 5.87-7.89 parts, inositol 12.27-31.91 parts, glycine 0.25-0.74 parts, thiamine hydrochloride 0.017-0.032 parts, nicotinic acid 0.025-0.049 parts, sucrose 6137-8592 parts, agar 1350-1841 parts, naphthalene acetic acid 0.001-0.004 parts, 6-benzylaminopurine 0.05-0.1 parts, indole acetic acid 0.08-0.015 parts;

[0016] The pH of the subculture medium is 6.0-6.4.

[0017] The culture conditions: 20-30 days for a subculture cycle, the temperature is 28±2℃, and the first 5 days are cultured in the environment of 1000-1500lx weak light illumination for 12h, and then transferred to the environment of 1500-3000lx illumination for 12h.

[0018] Further, the rooting culture uses a rooting culture medium; the rooting culture medium is prepared by the following components in weight parts: potassium nitrate 89-148 parts, ammonium nitrate 69-78 parts, potassium dihydrogen phosphate 7-10 parts, magnesium sulfate heptahydrate 12-22 parts, calcium chloride dihydrate 12-31 parts, potassium iodide 0.05-0.23 parts, boric acid 0.7-2.1 parts, manganese sulfate tetrahydrate 3.5-6.06 parts, zinc sulfate heptahydrate 1.17-2.80 parts, disodium ethylenediaminetetraacetate 7.46-10.02 parts, ferrous sulfate heptahydrate 5.58-7.49 parts, myo-inositol 11.66-30.31 parts, glycine 0.23-0.7 parts, thiamine hydrochloride 0.016-0.03 parts, nicotinic acid 0.023-0.047 parts, sucrose 2798-6061 parts, agar 1399-1748 parts, indole-3-acetic acid 0.09-0.13 parts, indole-3-butyric acid 0.06-0.11 parts; the pH of the rooting culture medium is 5.8-6.2;

[0019] The culture condition is that the culture is carried out under the condition of 12h light per day, the light intensity is 1500-3000lx, and the temperature is 28±2℃.

[0020] The embodiment of the present application has the following beneficial effects:

[0021] The present application selects the hypocotyl with strong activity to induce and differentiate callus, realizes the plant regeneration of blackgum by adopting the method of blackgum callus regeneration induction, subculture and rooting, and the regeneration system established by the method of the present application lays a foundation for the genetic transformation of blackgum.

[0022] In order to improve the callus regeneration induction rate, the regeneration induction medium is optimized in the present application, the components of the regeneration induction medium are adjusted, and the amount of each component is adjusted, so that the regeneration induction medium can more effectively promote the regeneration induction of blackgum callus.

[0023] The sequence 1 is used in the regeneration induction in the present application, which is a transcription factor sequence found in the research of eucalyptus callus regeneration, and is promoted into the callus by a vacuum method and is transiently expressed, which promotes the expression of callus regeneration related genes, and further improves the callus regeneration induction rate.

[0024] The regenerated sprouts obtained by the regeneration induction of the present application can obtain a circulating propagation subculture system through subculture, and the rooting culture can obtain robust rooting seedlings with a rooting rate of more than 80%, which can be used for large-scale production of high-quality blackgum seedlings. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 The induced callus;

[0026] Figure 2regenerated shoots obtained from the callus induction;

[0027] Figure 3 clumps obtained from subculture of the regenerated shoots;

[0028] Figure 4 rooted seedlings. DETAILED DESCRIPTION

[0029] The application will be further described in conjunction with the following examples.

[0030] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, in the following description, different 'an embodiment' or 'embodiments' do not necessarily refer to the same embodiment. The embodiments can be replaced or combined, and other embodiments can be obtained by those skilled in the art without creative labor.

[0031] A method for callus induction and regeneration of seedlings of Heagle, comprising the following steps: callus induction of Heagle, then regenerated shoot induction culture of the callus to obtain regenerated shoots, and further subculture and rooting culture to obtain seedlings.

[0032] In some embodiments of the present application, the callus induction uses callus induction medium; and the hypocotyl of the seedling obtained by sterile sowing of Heagle is used as the explant.

[0033] In some embodiments of the present application, the explant is treated by the following steps:

[0034] The hypocotyl obtained after sterile sowing of Heagle seeds is cut into small pieces of 0.5 cm long, then longitudinally cut into two pieces, and the longitudinal cut surface is inoculated in the callus induction medium for callus induction;

[0035] The callus induction medium is prepared by the following components in parts by weight: potassium nitrate 396 parts, ammonium nitrate 412 parts, potassium dihydrogen phosphate 39 parts, magnesium sulfate heptahydrate 68 parts, calcium chloride dihydrate 103 parts, potassium iodide 0.1 part, boric acid 0.15 part, manganese sulfate tetrahydrate 4 parts, zinc sulfate heptahydrate 2 parts, copper sulfate pentahydrate 0.005 part, disodium ethylenediaminetetraacetate 9.5 parts, ferrous sulfate heptahydrate 7.1 parts, myo-inositol 14 parts, glycine 0.5 part, thiamine hydrochloride 0.02 part, nicotinic acid 0.03 part, sucrose 7000 parts, agar 1700 parts, naphthalene acetic acid 0.005 part, N6-furfuryl methyl adenine 0.04 part, and 6-benzylaminopurine 0.03 part; the pH of the induction differentiation medium is 6.3; and the callus induction culture condition is: culture in dark environment for 10 days, and the temperature is kept at 28±2℃ in the dark environment.

[0036] In some embodiments of the present application, the regeneration induction culture of the callus uses a regeneration induction medium, which is prepared by the following ingredients in parts by weight: potassium nitrate 396 parts, ammonium nitrate 412 parts, potassium dihydrogen phosphate 39 parts, magnesium sulfate heptahydrate 68 parts, calcium chloride dihydrate 103 parts, potassium iodide 0.1 part, boric acid 0.15 part, manganese sulfate tetrahydrate 4 parts, zinc sulfate heptahydrate 2 parts, copper sulfate pentahydrate 0.005 parts, disodium ethylenediaminetetraacetate 9.5 parts, ferrous sulfate heptahydrate 7.1 parts, myo-inositol 14 parts, glycine 0.5 parts, thiamine hydrochloride 0.02 parts, nicotinic acid 0.03 parts, sucrose 7000 parts, agar 1700 parts, naphthalene acetic acid 0.02 parts, N6-furfuryl adenine 0.003 parts, 6-benzylaminopurine 0.05 parts, indole acetic acid 0.02 parts; the pH of the regeneration induction medium is 6.4;

[0037] The regeneration induction specific treatment is: cutting the Hengge callus into small pieces of about 0.5 cm 3 , soaking in a DNA solution of 1.0 μg / μl, vacuum incubating for 15 min, taking out the callus pieces, placing them cut side down on the regeneration induction medium.

[0038] In some embodiments of the present application, the vacuum incubation is specifically operated as follows: in a clean bench, 10 mL of DNA solution is added to a sterile straight flask, the callus pieces are placed in it, and after sealing with a sterile sealing film, it is placed in a vacuum drying dish to vacuum for 15 min.

[0039] In some embodiments of the present application, the DNA solution preparation method is as follows: using pCAMBIA2300-35s plant expression vector as the basis, using 35S promoter driving sequence 1 to construct a recombinant plasmid and introduce it into E. coli, the strain overnight culture is used to extract the plasmid in a clean bench, the solutions used in the process are prepared under sterile conditions, and the consumables such as EP tubes and pipettes are sterilized. The obtained plasmid is quantified by nanodrop, and then adjusted to a concentration of 1.0 μg / μl with sterile ultrapure water.

[0040] The sequence 1 is shown in SEQ. No 1:

[0041]

[0042] Culture condition: culture for 20 days under 8h light per day, temperature 28±2℃, light intensity 1500-2000lx.

[0043] In some embodiments of the present application, the subculture of the regenerated sprout uses a subculture medium

[0044] In some embodiments of the present application, the subculture medium is prepared by the following ingredients in weight parts: potassium nitrate 396 parts, ammonium nitrate 412 parts, potassium dihydrogen phosphate 39 parts, magnesium sulfate heptahydrate 68 parts, calcium chloride dihydrate 103 parts, potassium iodide 0.1 part, boric acid 0.15 part, manganese sulfate tetrahydrate 4 parts, zinc sulfate heptahydrate 2 parts, copper sulfate pentahydrate 0.005 part, disodium ethylenediaminetetraacetate 9.5 parts, ferrous sulfate heptahydrate 7.1 parts, myo-inositol 14 parts, glycine 0.5 part, thiamine hydrochloride 0.02 part, nicotinic acid 0.03 part, sucrose 7000 parts, agar 1700 parts, naphthalene acetic acid 0.001 part, 6-benzylaminopurine 0.06 part, and indole acetic acid 0.01 part. As a further technical solution, the subculture is specifically processed as follows: the intact regenerated sprout is cut and inserted into the subculture medium with the cut surface downward. After one subculture cycle, the obtained clumps are divided into small clumps and transferred into the next cycle for continuous culture to obtain the subculture.

[0045] The pH of the subculture medium is 6.4.

[0046] Culture condition: 30 days for one subculture cycle, temperature 28±2℃, and the first 5 days are cultured under 1000-1500lx weak light for 12h per day, and then transferred to 1500-3000lx light for 12h per day.

[0047] In some embodiments of the present application, the rooting culture uses a rooting culture medium

[0048] As a further technical solution, the rooting culture medium is prepared by the following ingredients in weight parts: potassium nitrate 101 parts, ammonium nitrate 72 parts, potassium dihydrogen phosphate 8 parts, magnesium sulfate heptahydrate 19 parts, calcium chloride dihydrate 25 parts, potassium iodide 0.1 part, boric acid 1.5 parts, manganese sulfate tetrahydrate 4.2 parts, zinc sulfate heptahydrate 2.3 parts, copper sulfate pentahydrate 0.005 parts, disodium ethylenediaminetetraacetate 9.5 parts, ferrous sulfate heptahydrate 7.1 parts, myo-inositol 15 parts, glycine 0.5 part, thiamine hydrochloride 0.02 part, nicotinic acid 0.03 part, sucrose 3000 parts, agar 1650 parts, naphthalene acetic acid 0.1 part, and indole acetic acid 0.1 part.

[0049] In some embodiments of the present application, the rooting culture is specifically processed as follows: 1-3cm healthy single sprouts are cut from the subculture clumps and inserted into the rooting culture medium for culture for 20 days.

[0050] The pH of the rooting medium is 6.0.

[0051] Culture conditions: culture under the condition of 12h light per day, light intensity of 1500-3000lx, and temperature of 28±2℃.

[0052] (1) Obtaining of DNA sequence

[0053] Two eucalyptus clones with significant differences in callus regeneration rate were used as experimental materials, in which the high-regeneration eucalyptus clone 1 had a callus regeneration rate of 62%, and the difficult-regeneration eucalyptus clone 2 had a callus regeneration rate of 11%. The callus tissues of the two clones were inoculated in the same eucalyptus callus regeneration induction medium, and the regeneration induction culture was carried out in parallel under the same temperature and light conditions. After 20 days of culture, 90 callus tissues were collected from each clone, quickly frozen in liquid nitrogen, and transported to a biological sequencing company on dry ice for transcriptome sequencing. After filtering the transcriptome sequencing data, the assembled transcripts were compared and annotated using EuKaryotic Orthologous Groups (KOG), Swiss-Prot, NR, NT, Kyoto Encyclopedia of Genes and Genomes (KEGG), Pfam, and Gene Ontology (GO) databases. The gene expression amount of unigene sequence in each sample was obtained by using RSEM for comparison and calculation. Through analysis, the expression amount of unigene sequence in clone 1 and clone 2 was compared (part of the sequence expression amount is shown in Table 1), and sequences with specific high expression in clone 1 and significantly higher expression amount than in clone 2 were screened to obtain candidate DNA sequence a. Sequence a was analyzed, and the ORF fragment was selected and codon modified according to the soybean genome sequence to make it more suitable for expression in E. coli. After modification, DNA sequence 1 was obtained.

[0054] Table 1 Sequence expression amount analysis

[0055] Sequence Expression amount (FPKM) in clone 1 Expression amount (FPKM) in clone 2 Sequence a 562.71 111.16 Sequence b 1651.41 1741.55 Sequence c 2412.38 2384.28 Sequence d 529.8 558.2

[0056] (2) Preparation of DNA sequence 1 solution

[0057] The cloning vector with DNA sequence 1 is used as a template, and DNA sequence 1 is amplified using upstream and downstream primers F1 / R1, wherein the sequences of F1 and R1 are shown as SEQ. NO 2 and SEQ. NO 3, respectively. F1 contains a KpnI enzyme site sequence, and R1 contains a BamHI enzyme site sequence. The PCR amplification product is the complete DNA sequence 1 with a KpnI enzyme site and a BamHI enzyme site added at the beginning and end, respectively. After purification, the PCR product is digested with KpnI and BamHI enzymes, and the digested DNA fragment is ligated with a KpnI and BamHI enzyme-digested pCAMBIA2300-35S vector backbone using T4 ligase. The ligation product is transformed into JM109 competent cells, and then plated. Single colonies are selected and subjected to colony PCR using primers F1 / R1. The correct strain is verified by electrophoresis and PCR product sequencing. The correct strain is inoculated into LB liquid medium for overnight culture according to a conventional method. The plasmid is extracted from the overnight culture in a clean bench, and the solutions used in the process are prepared under sterile conditions. The EP tubes, pipettes, and other consumables used are sterilized. The obtained plasmid is quantified by nanodrop, and then adjusted to a concentration of 1.0 μg / μl with sterile ultrapure water.

[0058] SEQ. NO 2: ggtaccatggctaggcttgtgg

[0059] SEQ. NO 3: ggatccttacatgaggtgggcgt

[0060] (3) Effect of DNA sequence 1 on the improvement of callus regeneration rate

[0061] The Hege callus is subjected to no special treatment, vacuum incubation with different concentrations of DNA sequence 1 solution for 15 min, and vacuum incubation with different concentrations of pCAMBIA2300-35S plasmid solution for 15 min. The concentration parameters of each treatment are shown in Table 2. Each treatment is inoculated with 120 callus pieces into regeneration induction medium, and cultured for 20 days under the following conditions: 8 h of light per day, light intensity of 1500-2000 lx, and temperature of 28±2℃. The number of callus pieces that sprout regeneration shoots is counted, and the regeneration rate of each treatment is calculated according to the formula: regeneration induction rate = number of callus pieces that sprout regeneration shoots / number of inoculated callus pieces. The results are shown in Table 2. It can be seen from the results that incubation treatment with DNA sequence 1 solution at a concentration of 0.1 μg / μl or above can improve the regeneration rate of Hege callus, and incubation treatment with DNA sequence 1 solution at a concentration of 0.5 μg / μl or above can increase the regeneration rate of Hege callus to more than 55%. Incubation treatment with pCAMBIA2300-35S plasmid solution without DNA sequence 1 has no promoting effect on the regeneration of Hege callus.

[0062] Table 2: Comparison of regeneration test treatments and regeneration rates

[0063] Test treatment Callus regeneration rate (%) No special treatment 9.17 DNA sequence 1 solution concentration 0.01 μg / μl 8.89 DNA sequence 1 solution concentration 0.1 μg / μl 13.61 DNA sequence 1 solution concentration 0.5 μg / μl 53.89 DNA sequence 1 solution concentration 1.0 μg / μl 58.89 DNA sequence 1 solution concentration 2.0 μg / μl 55.56 DNA sequence 1 solution concentration 3.0 μg / μl 59.44 pCAMBIA2300-35S plasmid solution concentration 0.01 μg / μl 8.89 pCAMBIA2300-35S plasmid solution concentration 0.1 μg / μl 9.17 pCAMBIA2300-35S plasmid solution concentration 0.5 μg / μl 8.61 pCAMBIA2300-35S plasmid solution concentration 1.0 μg / μl 8.06 pCAMBIA2300-35S plasmid solution concentration 2.0 μg / μl 7.22 pCAMBIA2300-35S plasmid solution concentration 3.0 μg / μl 8.61

[0064] Figure 1 the callus induced is induced callus, the callus obtained is obtained callus, the callus is dedifferentiated from hypocotyl tissue through induction; Figure 2 the regenerated shoots obtained through callus induction are callus-induced regenerated shoots, the regenerated shoots obtained through callus regeneration are callus-regenerated regenerated shoots, and the regenerated shoots obtained through callus treatment according to the method of the present application can regenerate normal and robust regenerated shoots; Figure 3 the clumps obtained through subculture of the regenerated shoots are subcultured clumps, and the regenerated shoots obtained through callus regeneration are regenerated shoots that grow into robust clumps through subculture, and have good proliferation effects. Figure 4 the rooted seedlings are rooted seedlings, side-view photos of the rooted seedlings, and bottom-view photos, which mainly show that the seedlings can normally root, the roots are neat, and the root system is robust.

[0065] It should be noted that the above embodiments can be freely combined as needed. The above introduction is merely preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A method for induction and regeneration of shoots from black spruce callus, comprising the steps of, The method comprises the following steps: callus induction on the black gram, regeneration induction culture of the callus to obtain regenerated sprouts, and further subculture and rooting culture to obtain seedlings. The callus induction culture medium is used for callus induction; and the hypocotyl of the seedling obtained by sterile sowing of the black gram is used as the explant. The callus induction culture medium is prepared from the following components in parts by weight: potassium nitrate 383-565 parts, ammonium nitrate 302-430 parts, potassium dihydrogen phosphate 32-44 parts, magnesium sulfate heptahydrate 56-96 parts, calcium chloride dihydrate 49-147 parts, potassium iodide 0.05-0.25 parts, boric acid 0.74-2.21 parts, manganese sulfate tetrahydrate 3.68-6.38 parts, zinc sulfate heptahydrate 1.23-2.95 parts, copper sulfate pentahydrate 0.004-0.008 parts, disodium ethylenediaminetetraacetate 7.86-10.56 parts, ferrous sulfate heptahydrate 5.87-7.89 parts, myo-inositol 12.27-31.91 parts, glycine 0.25-0.74 parts, thiamine hydrochloride 0.017-0.032 parts, nicotinic acid 0.025-0.049 parts, sucrose 6137-8592 parts, agar 1350-1841 parts, naphthalene acetic acid 0.001-0.006 parts, N6-furfuryl methyl adenine 0.01-0.05 parts, and 6-benzylaminopurine 0.02-0.05 parts. The regeneration induction culture medium is used for regeneration induction culture of the callus, and is prepared from the following components in parts by weight: potassium nitrate 383-565 parts, ammonium nitrate 302-430 parts, potassium dihydrogen phosphate 32-44 parts, magnesium sulfate heptahydrate 56-96 parts, calcium chloride dihydrate 49-147 parts, potassium iodide 0.05-0.25 parts, boric acid 0.74-2.21 parts, manganese sulfate tetrahydrate 3.68-6.38 parts, zinc sulfate heptahydrate 1.23-2.95 parts, copper sulfate pentahydrate 0.004-0.008 parts, disodium ethylenediaminetetraacetate 7.86-10.56 parts, ferrous sulfate heptahydrate 5.87-7.89 parts, myo-inositol 12.27-31.91 parts, glycine 0.25-0.74 parts, thiamine hydrochloride 0.017-0.032 parts, nicotinic acid 0.025-0.049 parts, sucrose 6137-8592 parts, agar 1350-1841 parts, naphthalene acetic acid 0.01-0.04 parts, N6-furfuryl methyl adenine 0.001-0.006 parts, 6-benzylaminopurine 0.03-0.07 parts, and indole acetic acid 0.01-0.04 parts. The regeneration induction treatment specifically comprises the following steps: after the callus of the black gram is cut into small pieces, the small pieces are soaked in a DNA solution with a concentration of 0.5-2 μg / μl, the callus is taken out after vacuumizing for 10-15 min, and the cut surface is placed on the regeneration induction culture medium. DNA solution preparation method: based on pCAMBIA series or pBI121 plant expression vector, using 35S or other plant expression promoter sequence 1 to construct recombinant plasmid and import E. coli, strain overnight culture extract plasmid in super clean platform; the obtained plasmid is quantified by nanodrop, and then adjusted to 0.5-2 μg / μl concentration with sterile ultrapure water; The sequence 1 is shown as SEQ.NO1; The sequence 1 is shown as SEQ.NO1; The subculture medium for the regenerative bud subculture is prepared from the following ingredients by weight parts: potassium nitrate 383-565 parts, ammonium nitrate 302-430 parts, potassium dihydrogen phosphate 32-44 parts, magnesium sulfate heptahydrate 56-96 parts, calcium chloride dihydrate 49-147 parts, potassium iodide 0.05-0.25 parts, boric acid 0.74-2.21 parts, manganese sulfate tetrahydrate 3.68-6.38 parts, zinc sulfate heptahydrate 1.23-2.95 parts, copper sulfate pentahydrate 0.004-0.008 parts, disodium ethylenediaminetetraacetate 7.86-10.56 parts, ferrous sulfate heptahydrate 5.87-7.89 parts, myo-inositol 12.27-31.91 parts, glycine 0.25-0.74 parts, thiamine hydrochloride 0.017-0.032 parts, nicotinic acid 0.025-0.049 parts, sucrose 6137-8592 parts, agar 1350-1841 parts, naphthalene acetic acid 0.001-0.004 parts, 6-benzylaminopurine 0.05-0.1 parts, and indole-3-acetic acid 0.08-0.015 parts. The rooting culture uses a rooting culture medium; the rooting culture medium is prepared from the following components by weight parts: potassium nitrate 89-148 parts, ammonium nitrate 69-78 parts, potassium dihydrogen phosphate 7-10 parts, magnesium sulfate heptahydrate 12-22 parts, calcium chloride dihydrate 12-31 parts, potassium iodide 0.05-0.23 parts, boric acid 0.7-2.1 parts, manganese sulfate tetrahydrate 3.5-6.06 parts, zinc sulfate heptahydrate 1.17-2.80 parts, disodium ethylenediaminetetraacetate 7.46-10.02 parts, ferrous sulfate heptahydrate 5.58-7.49 parts, inositol 11.66-30.31 parts, glycine 0.23-0.7 parts, thiamine hydrochloride 0.016-0.03 parts, nicotinic acid 0.023-0.047 parts, sucrose 2798-6061 parts, agar 1399-1748 parts, indole acetic acid 0.09-0.13 parts, indole butyric acid 0.06-0.11 parts.

2. The method of claim 1, wherein the black spruce somatic tissue induction and plantlet regeneration method further comprises, The explants are treated by the following steps: The hypocotyls obtained after sterile sowing of Heag seeds are cut into small sections of 0.3-0.6 cm, the small sections are cut longitudinally, and the cut surfaces are inoculated in a callus induction medium for callus induction; the pH of the callus induction medium is 6.0-6.5; the callus induction culture conditions are: culturing in a dark environment for 7-10 days, and the temperature is maintained at 28±2℃ in the dark environment.

3. The Heag callus induction and regeneration method according to claim 2, characterized in that, The pH of the regeneration induction medium is 6.2-6.4; the regeneration induction culture conditions are: culturing in an environment with 8h light per day for 14-20 days, the temperature is 28±2℃, and the light intensity is 1500-2000lx.

4. The Heag callus induction and regeneration method according to claim 3, characterized in that, The pH of the subculture medium is 6.0-6.4; the culture conditions are: 20-30 days for one subculture cycle, the temperature is 28±2℃, and the first 5 days are cultured in an environment with 1000-1500lx weak light for 12h per day, and then transferred to an environment with 1500-3000lx light for 12h per day.

5. The method of claim 4, wherein the black spruce somatic tissue induction and plantlet regeneration method further comprises, The pH of the rooting culture medium is 5.8-6.2; the culture conditions are: culturing in an environment with 12h light per day and a light intensity of 1500-3000lx, and the temperature is 28±2℃.

Images