Application of dipotassium glycyrrhizinate in preparation of preparation for resisting porcine Seneca virus

Abstract

The invention provides application of dipotassium glycyrrhizinate in preparation of a preparation for resisting porcine Seneca virus, and further provides a product for preventing and / or treating SVA infection. The invention provides the application of dipotassium glycyrrhizinate in preparation of the preparation for preventing and / or treating SVA infection, the dipotassium glycyrrhizinate has a very obvious anti-SVA infection effect, cell infection caused by SVA can be reduced, the adsorption, cell entry and assembly stages of SVA can be inhibited, and a scientific and reliable theoretical basis is provided for clinical treatment of the porcine Seneca virus disease.

Description

Technical Field

[0001] The present invention belongs to the technical field of the preparation of bioactive products, and particularly relates to the application of dipotassium glycyrrhizinate in the preparation of a preparation for preventing swine Seneca virus. Background Art

[0002] Senecavirus A (SVA), formerly known as Seneca valley virus (SVV), is the only member of the genus Senecavirus in the family Picornaviridae. Senecavirus is a positive single-stranded RNA virus without an envelope. It is a spherical virus particle with a diameter ranging from 26 to 30 nm and icosahedral symmetry. The main symptoms of swine Senecavirus disease caused by SVA are vesicular lesions. Blisters and ulcers appear on the skin or mucous membranes of the snout, muzzle, and coronary band of diseased pigs. In severe cases, it can cause the acute death of newborn piglets. Clinically, this disease is difficult to distinguish from swine foot-and-mouth disease, vesicular stomatitis, swine infectious vesicular disease, etc., and can only be identified by laboratory means, which easily causes panic among pig breeding enterprises. This virus has spread widely worldwide, affecting major pig breeding countries such as the United States, Canada, and Thailand. SVA was first introduced into Guangdong Province, China in 2015 and has since become widespread in many provinces and regions of China, causing serious economic losses to the pig farming industry in China. As of 2019, SVA has been prevalent in at least 16 provinces, municipalities, and autonomous regions in China, causing significant economic losses.

[0003] The prevention and control of newly emerging and sudden infectious diseases is a common problem faced worldwide. As a newly emerging swine disease caused by SVA, there are no effective prevention and control technical means. Among them, commercial vaccines and antibodies are still in the development stage, and few research teams have reported on drug research and development. In addition, SVA has been evolving continuously in recent years, and its strains frequently show genomic variation and recombination phenomena, further hindering the research and development process of effective vaccines. In the prevention and control of animal diseases, chemical drugs have the characteristics of easy use, low price, and obvious effects, and can be used in combination with vaccines to prevent the occurrence of diseases. Therefore, the timely research and development of drugs with SVA antagonistic activity is of great research significance for the prevention and treatment of SVA. Summary of the Invention

[0004] The purpose of the present invention is to provide the application of dipotassium glycyrrhizinate in the preparation of a preparation for preventing swine Seneca virus, thereby providing a new use of dipotassium glycyrrhizinate and being able to effectively prevent and treat SVA disease.

[0005] The present invention first provides a use of dipotassium glycyrrhizinate for the preparation of a product for preventing and / or treating swine Senecavirus SVA infection; In another aspect, the present invention also provides a product for preventing and / or treating SVA infection, and the product contains dipotassium glycyrrhizinate at a pharmacologically effective concentration; Preferably, the preparation is a liquid preparation; Furthermore, the liquid solvent in the liquid preparation is selected from PBS buffer or DMSO.

[0006] Preferably, the concentration of the PBS buffer is 0.05 - 0.15 mol / L.

[0007] Preferably, the concentration of the PBS buffer is 0.08 - 0.12 mol / L.

[0008] As specifically recorded in some embodiments, the pharmacologically effective concentration is 10 - 100 μmol / L.

[0009] Preferably, the concentration of dipotassium glycyrrhizinate in the preparation is 20 - 80 μmol / L.

[0010] Preferably, the concentration of dipotassium glycyrrhizinate in the preparation is 40 - 60 μmol / L.

[0011] The present invention provides the application of dipotassium glycyrrhizinate in the preparation of a preparation for preventing and / or treating SVA infection. The anti - SVA infection effect of dipotassium glycyrrhizinate is very significant, which can reduce the cell infection caused by SVA, and inhibit the adsorption, entry into cells, and assembly stages of SVA, providing a scientific and reliable theoretical basis for the clinical treatment of porcine Seneca virus disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 It is a photograph for observing the influence of dipotassium glycyrrhizinate on the infection efficiency of SVA - infected BSR cells under a fluorescence microscope; Figure 2 It is a diagram of the influence of dipotassium glycyrrhizinate on SVA infection on BSR cells; among them, A is the influence of dipotassium glycyrrhizinate on SVA infection on BSR cells measured by Western blot; B is the influence of dipotassium glycyrrhizinate on SVA infection on BSR cells measured by TCID50; C is the influence of dipotassium glycyrrhizinate on SVA infection on BSR cells measured by fluorescence quantitative RT - PCR; Figure 3 It is a diagram of the influence of dipotassium glycyrrhizinate on SVA adsorption on BSR cells measured by fluorescence quantitative RT - PCR; Figure 4 It is a diagram of the influence of dipotassium glycyrrhizinate on SVA entry into cells on BSR cells; among them, A is the influence of dipotassium glycyrrhizinate on SVA entry into cells on BSR cells measured by Western blot; B is the influence of dipotassium glycyrrhizinate on SVA entry into cells on BSR cells measured by fluorescence quantitative RT - PCR; Figure 5 Effect of dipotassium glycyrrhizinate on SVA replication in BSR cells; in which, A shows the effect of dipotassium glycyrrhizinate on SVA replication in BSR cells determined by Western blot; B shows the effect of dipotassium glycyrrhizinate on SVA replication in BSR cells determined by TCID50; C shows the effect of dipotassium glycyrrhizinate on SVA replication in BSR cells determined by fluorescence quantitative RT-PCR. Figure 6 Effect of dipotassium glycyrrhizinate on the assembly and release of SVA in BSR cells; in which, A shows the effect of dipotassium glycyrrhizinate on SVA assembly in BSR cells determined by fluorescence quantitative RT-PCR, and B shows the effect of dipotassium glycyrrhizinate on the release of SVA determined by TCID50. Detailed implementation mode

[0013] The dipotassium glycyrrhizinate used in the present invention is a natural compound extracted from licorice roots. Dipotassium glycyrrhizinate is commonly used in traditional Chinese medicine preparations, and has the advantages of wide drug sources, easy availability of raw materials, and low cost. It is derived from plants, and after being metabolized by the animal body, it has little environmental pollution and no toxic and side effects on animals.

[0014] The present invention has no special requirements for the source of the dipotassium glycyrrhizinate used, and conventional commercially available products or self-prepared products in the art can be used.

[0015] The present invention also provides a preparation for preventing and / or treating SVA infection. The concentration of dipotassium glycyrrhizinate in the preparation is 10-100 μmol / L, preferably 20-80 μmol / L, more preferably 40-60 μmol / L, and most preferably 50 μmol / L. In the present invention, the drug is preferably a liquid preparation, and the solvent of the drug is preferably PBS buffer or DMSO; when the solvent is PBS buffer, the concentration of the PBS buffer is preferably 0.05-0.15 mol / L, more preferably 0.08-0.12 mol / L, and most preferably 0.1 mol / L.

[0016] In the present invention, the drug is preferably obtained by dissolving the dipotassium glycyrrhizinate in a solvent.

[0017] The technical solutions provided by the present invention will be described in detail below in conjunction with the examples.

[0018] Example 1 In this example, two kinds of dipotassium glycyrrhizinate preparations are prepared. One of the preparations is obtained by dissolving dipotassium glycyrrhizinate in 0.1 mol / L PBS buffer, and the concentration of dipotassium glycyrrhizinate is 10 mmol / L.

[0019] Another preparation is obtained by dissolving dipotassium glycyrrhizinate in DMSO, and the concentration of dipotassium glycyrrhizinate is 10 mmol / L.

[0020] To verify the effect of dipotassium glycyrrhizinate on the infection efficiency caused by SVA, the specific experimental method is as follows: The trypsin-digested BSR cells were diluted and counted with a nutrient solution containing 10% fetal bovine serum, and plated into a six-well plate at a concentration of 5×10 5 cells / well, and placed in an incubator at 37°C containing 5% CO 2 After the cells grew to a density of 80-90% (about 24 h), the cells were washed 3 times with PBS solution, pretreated with empty DMEM and PBS solutions of dipotassium glycyrrhizinate at different concentrations (10 μM, 25 μM, 50 μM) for 1 h, and then infected with the SVA strain (MOI = 1). After 1 h, the medium was changed. After 24 h of infection and the drug was present all the time, the infection situation of the cells was observed under a fluorescence microscope.

[0021] According to Figure 1 the results shown, dipotassium glycyrrhizinate can reduce the green fluorescence produced by SVA, indicating that dipotassium glycyrrhizinate may reduce the infection of SVA.

[0022] Example 2 To verify the effect of dipotassium glycyrrhizinate on inhibiting its infection activity (Western blot, fluorescence quantitative PCR and TCID50 experiments) during the whole infection cycle of SVA, the specific steps are as follows: 1) Western blot was used to determine the activity of dipotassium glycyrrhizinate in inhibiting SVA infection on BSR cells The digested BSR cells were diluted with DMEM nutrient solution containing 10% FBS by volume, and added dropwise to a 6-well plate at a concentration of 5×10 5 / well, and placed in an incubator at 37°C with 5% CO 2 After the cells adhered to form a monolayer (about 24 h), the cells were washed three times with PBS solution. After sucking out the residual PBS, dipotassium glycyrrhizinate (50 μM) diluted to the corresponding concentration with 1 mL of serum-free DMEM was added, and incubated with BSR cells at 37°C for 1 h. Then, the cells were infected with SVA (MOI = 1) in the presence of dipotassium glycyrrhizinate at the corresponding concentration (50 μM), and placed in an incubator at 37°C with 5% CO 2 After incubating for 1 h, it was replaced with 2 mL of DMEM nutrient solution containing 2% FBS and maintained in the presence of dipotassium glycyrrhizinate at the corresponding concentration (50 μM), and placed in an incubator at 37°C with 5% CO 2Cultured in an incubator, at 8 h, 12 h, 24 h, and 36 h after infection respectively, collect the cell supernatant (1 mL is stored at -70 °C for preparation of the later TCID50 experiment), wash the cells three times with PBS and then aspirate all the residual liquid. Lyse the cells with a lysis buffer containing protease inhibitors. After measuring the concentration of the lysis buffer, add 5× protein loading buffer to collect the cell samples, boil them in a metal bath at 96 °C for 15 min, and then perform Western blot detection. It is found that dipotassium glycyrrhizinate reduces the expression of the VP3 protein of SVA, confirming that dipotassium glycyrrhizinate reduces the infection of SVA ( Figure 2 A).

[0023] 2) Determine the activity of dipotassium glycyrrhizinate in inhibiting SVA infection on BSR cells by TCID50 Digest BSR cells and dilute them with DMEM nutrient solution containing 10% FBS by volume. Drop them into a 96-well plate at a concentration of 2×10 4 / well, and place it in an incubator at 37 °C with 5% CO 2 After the cells adhere to form a monolayer in the incubator, wash them three times with PBS, aspirate all the residual liquid, and then add the virus supernatant collected in the previous experiment diluted with serum-free DMEM. Do 8 replicates for each concentration. After 1.5 h of infection, change to DMEM containing 2% FBS for maintenance. Observe the cell infection situation after 72 h of infection and observe until 120 h after infection. It is found that dipotassium glycyrrhizinate reduces the virus titer in the SVA-infected supernatant ( Figure 2 B), confirming that dipotassium glycyrrhizinate reduces the infection of SVA.

[0024] 3) Determine the activity of dipotassium glycyrrhizinate in inhibiting SVA infection on BSR cells by fluorescence quantitative RT-PCR Digest BSR cells and dilute them with DMEM nutrient solution containing 10% FBS by volume. Drop them into a 6-well plate at a concentration of 5×10 5 / well, and place it in an incubator at 37 °C with 5% CO 2 After the cells adhere to form a monolayer in the incubator (about 24 h), wash the cells three times with PBS solution, aspirate all the residual PBS, and then add dipotassium glycyrrhizinate (10 μM) diluted to the corresponding concentration with 1 mL of serum-free DMEM. Incubate with BSR cells at 37 °C for 1 h, then infect the cells with SVA in the presence of dipotassium glycyrrhizinate (10 μM), and place it in an incubator at 37 °C with 5% CO 2 After incubating in the incubator for 1 h, change to 2 mL of DMEM nutrient solution containing 2% FBS for maintenance and in the presence of the corresponding concentration of dipotassium glycyrrhizinate (10 μM), and place it in an incubator at 37 °C with 5% CO 2 Cultivate in the incubator. After 24 h of infection, directly freeze and store it in a -70 °C refrigerator. After repeated freezing and thawing 3 times, extract the viral RNA for detection by real-time fluorescence quantitative RT-PCR method. The sequences of the primers and probes used for fluorescence quantitative RT-PCR are as follows: SVA-F CTGCGCTGGGACCGTATCTCA、 SVA-R CGCCGCGCCACCTCATT、 SVA-P TCGCCGTAAGCGTGCACCGAGACAG。

[0025] The 20 μL reaction system used contains 4 μL of 5×One Step U ＋ Mix, 1 μL of One Step U ＋ Mix, 0.4 μL each of the forward and reverse primers, 0.2 μL of the probe, 14.0 μL of RNase-free water, and 5 μL of the template. The amplification program is reverse transcription at 55 °C for 15 min, pre-denaturation at 95 °C for 2 min 30 s, and the PCR reaction is denaturation at 95 °C for 8 s, annealing at 60 °C for 16 s, for a total of 45 cycles, and fluorescence is read at 60 °C. The results are as Figure 2 shown in C below. Dipotassium glycyrrhizinate can reduce the SVA nucleic acid copy number, confirming that dipotassium glycyrrhizinate reduces SVA infection.

[0026] Example 3 Verification of the effect of dipotassium glycyrrhizinate on SVA adsorption After digestion, BSR cells were diluted with DMEM nutrient solution containing 10% FBS and added dropwise to a 6-well plate at a concentration of 5×10 5 / well, and placed in an incubator at 37 °C and 5% CO 2 2. After the cells adhered to form a monolayer (about 24 h), the cells were washed three times with PBS solution. After sucking out the residual PBS, dipotassium glycyrrhizinate diluted to the corresponding concentration (10 μM, 25 μM, 50 μM) with 1 mL of serum-free DMEM was added. After incubating with BSR cells at 37 °C for 1 h, it was replaced with cold serum-free DMEM, and SVA was infected at 4 °C in the presence of dipotassium glycyrrhizinate at the corresponding concentration (10 μM, 25 μM, 50 μM). After incubating for 1 h, it was washed three times with cold PBS, 1 mL of cold serum-free DMEM was added, and it was frozen in a -70 °C refrigerator and repeatedly frozen and thawed three times to extract viral RNA for fluorescence quantitative RT-PCR determination. The results are as Figure 3 shown below, and it was found that dipotassium glycyrrhizinate reduced the SVA nucleic acid copy number, confirming that dipotassium glycyrrhizinate reduced the adsorption of SVA to the target cells.

[0027] Example 4: Effect of dipotassium glycyrrhizinate on SVA entry into cells (Western blot and fluorescence quantitative RT-PCR) After digestion, BSR cells were diluted to an appropriate density with DMEM nutrient solution containing 10% FBS and added dropwise to a 6-well plate at a concentration of 5×10 5 / well, and placed in an incubator at 37 °C and 5% CO 2After the cells adhered to the monolayer in the incubator (about 24 h), the cells were washed 3 times with PBS. After sucking out the residual PBS, 1 mL of serum-free cold DMEM was added and the cells were infected with SVA (MOI = 10). After incubation at 4 °C for 1 h, the cells were washed three times with cold PBS and the residual liquid was sucked out completely. 1 mL of cold DMEM containing 2% FBS and dipotassium glycyrrhizinate at corresponding concentrations (0 μM, 10 μM, 25 μM and 50 μM) was added. After incubation at 37 °C for 1 h, the cells were washed three times with citric acid and then three times with PBS, and the residual liquid was sucked out. Then it was replaced with 2 mL of DMEM nutrient solution containing 2% FBS for maintenance, and placed in an incubator at 37 °C, 5% CO 2 The cells were cultured in the incubator. After 18 h of infection, cell samples were collected for Western blot and fluorescence quantitative RT-PCR detection. The results are as Figure 4 shown. Dipotassium glycyrrhizinate reduced the expression of SVA VP3 protein entering the cells and also reduced the amount of SVA nucleic acid entering the cells, confirming that dipotassium glycyrrhizinate decreased the entry level of SVA into cells.

[0028] Example 5: To verify the effect of dipotassium glycyrrhizinate on SVA replication (Western blot, TCID50, fluorescence quantitative RT-PCR) BSR cells were digested and diluted to an appropriate density with DMEM nutrient solution containing 10% FBS, and dropped into a 6-well plate at a concentration of 5×10 5 / well, and placed in an incubator at 37 °C, 5% CO 2 After the cells adhered to the monolayer in the incubator (about 24 h). The cells were washed three times with PBS solution. After sucking out the residual PBS, 1 ml of empty DMEM containing SVA virus (MOI = 1) was added. After incubation at 37 °C for 1 h, the cells were washed three times with PBS. 2 ml of DMEM (containing 2% serum) containing 10 μmol / L, 25 μmol / L and 50 μmol / L dipotassium glycyrrhizinate was added to the cells. After incubation at 37 °C for 12 h, Western blot, TCID50 and fluorescence quantitative RT-PCR detections were performed respectively. The results are as Figure 5 shown. It was found that dipotassium glycyrrhizinate did not reduce the expression of SVA VP3 protein, did not reduce the SVA nucleic acid copy number and virus titer, confirming that dipotassium glycyrrhizinate could not inhibit SVA replication.

[0029] Example 6: To verify the effect of dipotassium glycyrrhizinate on SVA assembly and release (Western blot, TCID50, fluorescence quantitative RT-PCR) BSR cells were cultured to confluence in different cell plates. After infecting BSR cells with SVA (MOI = 1) at 37 °C for 1 h, the cells were washed 3 times with PBS and the residual liquid was blotted dry. 2% DMEM medium containing 0 μmol / L, 10 μmol / L, 25 μmol / L, and 50 μmol / L reboxetine mesylate was co-incubated with the cells for 12 h, approximately one viral replication cycle. The supernatant was taken for standby, and the cells were collected after being repeatedly frozen and thawed 3 times with 1 mL PBS. During one replication cycle, when the viral assembly and release mechanisms are normal, the viral titers and nucleic acid ratios in the supernatant and cells should be basically constant. The ratio of the SVA viral titer in the supernatant to that in the cells was detected by TCID50, and the ratio of the SVA nucleic acid copy numbers in the supernatant and cells was detected by fluorescence quantitative RT-PCR. The results are as Figure 6 shown in A. Dipotassium glycyrrhizinate can reduce the SVA nucleic acid ratio outside and inside the cells, proving that dipotassium glycyrrhizinate can inhibit the SVA assembly process, Figure 6 as shown in B. Dipotassium glycyrrhizinate did not reduce the SVA titer ratio outside and inside the cells, confirming that dipotassium glycyrrhizinate cannot inhibit the release of SVA.

Claims

1. A use of dipotassium glycyrrhizinate, characterized in that, The use is in the preparation of products for preventing and / or treating type A Seneca virus infection.

2. The use according to claim 1, characterized in that The product contains dipotassium glycyrrhizinate in a pharmacologically effective concentration.

3. The use according to claim 2, characterized in that The pharmacologically effective concentration is a concentration that can prevent type A Seneca virus from infecting cells.

4. The use according to claim 2, characterized in that The pharmacologically effective concentration is 10 to 100 μmol / L in the liquid preparation.

5. The use according to claim 4, characterized in that The pharmacologically effective concentration is 20 to 80 μmol / L in the liquid preparation.

6. The use according to claim 4, characterized in that The pharmacologically effective concentration is 40 to 60 μmol / L in the liquid preparation.

7. The use according to claim 4, characterized in that The liquid preparation is PBS buffer or DMSO.

8. A product for preventing and / or treating Seneca virus type A infection, characterized in that: The product contains dipotassium glycyrrhizinate in a pharmacologically effective concentration.

9. The article according to claim 8, characterized in that The product is a liquid preparation containing dipotassium glycyrrhizinate in a pharmacologically effective concentration.

10. The article according to claim 9, characterized in that The concentration of dipotassium glycyrrhizinate in the liquid preparation is 10-100 μmol / L.

Images