Application of cholesterol hydroxylase CH25H intervention polypeptide in preparation of osteoporosis and osteolysis treatment product

By designing an intervention polypeptide targeting CH25H to interfere with the interaction of CH25H and TRAF6, it inhibits the over-activation and differentiation of osteoclasts, and solves the problem that the existing technology is difficult to effectively prevent and treat osteoporosis and osteolysis, and achieves safer and more effective therapeutic effects.

CN120131906APending Publication Date: 2025-06-13SUZHOU INST OF SYST MEDICINE
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510559604.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-29
Publication Date
2025-06-13

AI Technical Summary

Technical Problem

The prior art is difficult to effectively prevent and treat skeletal degenerative diseases related to aging, such as osteoporosis and osteolysis, and existing therapeutic drugs have challenges in terms of safety and effectiveness.

Method used

By designing intervention polypeptides targeting cholesterol hydroxylase (CH25H) as a target, interfering with the interaction of CH25H and TRAF6, thereby inhibiting the over-activation and differentiation of osteoclasts (OCs), achieving the purpose of preventing and treating osteoporosis and osteolysis.

Benefits of technology

CH25H loss can effectively inhibit OC differentiation and function, relieve the symptoms of osteoporosis and osteolysis, and provide a new therapeutic target and strategy to improve the treatment effect and quality of life of patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120131906A_ABST
    Figure CN120131906A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of biotechnology and medicine, and discloses application of cholesterol hydroxylase CH25H intervention polypeptide in preparation of osteoporosis and osteolysis treatment products. The polypeptide fragment containing the TRAF6 binding site designed by the invention is specifically bound with CH25H so as to destroy the interaction between CH25H and TRAF6, thereby effectively inhibiting OC differentiation and bone resorption functions. Theoretical and technical bases are provided for developing novel treatment strategies for preventing and treating bone metabolic diseases such as osteoporosis (OP) and osteolysis (OL).
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the fields of biotechnology and medicine, and particularly relates to the application of a cholesterol hydroxylase CH25H interfering polypeptide in the preparation of products for treating osteoporosis and osteolysis. Background Art

[0002] Aging is a complex, multi-stage, and progressive process that occurs throughout life. One of the main characteristics of aging is systemic chronic inflammation, accompanied by cellular senescence, immunosenescence, organ dysfunction, and various age-related diseases [1] . As age increases, the incidence of aging-related diseases, especially skeletal degenerative diseases such as osteoporosis (OP) and osteolysis (OL), continues to increase. In the skeletal systems of the elderly or postmenopausal women, the function of osteoclasts (OC) is hyperactive. When bone resorption mediated by OC exceeds bone formation mediated by osteoblasts, bone metabolic imbalance leads to OP [2-3] . In addition, wear particles around artificial implants induce the proliferation and differentiation of OC, causing OL. The excessive proliferation, differentiation, and hyperfunction of OC are the main reasons for the aseptic loosening of artificial joints [4] . Currently, chronic inflammation has been considered an endogenous factor of aging, and the activation of OC is regulated by various inflammatory factors. Basic research on the regulation of OC differentiation and function, especially the research on negative regulatory signaling pathways and the development of drug action targets, can provide new targets and new strategies for the effective prevention and treatment of aging-related diseases OP and OL.

[0003] The process of OC generation is regulated by various cells and inflammatory factors such as RANKL (Receptor Activator of Nuclear Factor-κB Ligand), TNF-α (Tumor Necrosis Factor-α), and IL-1 (Interleukin-1). The above factors can all induce the activation of NF-κB (Nuclear Factor-κB), and NF-κB is crucial for OC formation and survival under physiological and pathological conditions [5]。The central role of NF-κB in OC physiology mainly includes RANKL, RANK, and TRAF6, among which TRAF6 has been shown to activate the transcription factor NF-κB through the IκB kinase (IKK) and activate AP-1 (Activator Protein-1) through MAPK (Mitogen-Activated Protein Kinase), ERK (Extracellular Signal-Regulated Kinase), and JNK (c-Jun NH 2 -terminal Kinase, c-Jun amino-terminal kinase). [6] 。In addition, the TRAF6 C-terminal deletion and truncated RANK (receptor activator for nuclear factor-κ, nuclear factor κB receptor activator) receptor retained their ability to stimulate JNK activity rather than NF-κB activity, indicating that the interaction between RANK and TRAF6 is necessary for NF-κB activation. [7] 。The importance of TRAF6 in maintaining normal bone structure has been demonstrated in TRAF6 knockout mice, which showed defects in NF-κB signaling and thus developed osteopetrosis. [8] 。Studies have shown that TRAF6 can function as an ubiquitin ligase to block the synthesis of K63 polyubiquitin chains, thereby preventing TRAF6 from activating IKK. [9] 。Therefore, effectively inhibiting NF-κB-mediated inflammation by targeting TRAF6 is a potential approach for treating aging- and inflammation-related skeletal degenerative diseases.

[0004] Cholesterol 25-hydroxylase (CH25H) is involved in the cholesterol biosynthesis pathway and cell membrane properties and plays multiple roles in regulating cholesterol homeostasis, inflammation, and immune responses.

[10] CH25H also plays an important role in antiviral immunity. It can restrict the fusion of viruses with cell membranes during the virus entry process and widely inhibit the infection of viruses such as VSV (Vesicular Stomatitis Virus), HIV-1 (Human Immunodeficiency Virus type 1), ZIKV (Zika Virus), MERS-CoV (Middle East Respiratory Syndrome Coronavirus), and SARS-CoV-2 (Severe Acute Respiratory Syndrome Coronavirus 2).

[11] The role of CH25H in the field of tumor immunotherapy is becoming increasingly evident. CH25H regulates tumor-associated macrophages through cholesterol metabolism reprogramming, and CH25H has great potential as a drug intervention target in tumor treatment.

[12] In addition, relevant studies have shown that the CH25H-CYP7B1-RORα axis (cholesterol 25-hydroxylase-cytochrome P450 7B1-retinol-related orphan receptor α axis) of cholesterol metabolism in chondrocytes is involved in the regulation of osteoarthritis, and CH25H plays an important role in the pathogenesis of osteoarthritis. However, whether CH25H can regulate OC differentiation and function and its molecular regulatory mechanism in a manner independent of enzyme activity is still unclear and requires further exploration.

[13] 。

[0005] There is still a lack of safe and effective therapeutic drugs for diseases such as OP and OL caused by overactivation of OC due to aging and chronic inflammation. There is an urgent need in this field to develop new approaches and new drugs targeting aging and chronic inflammation for the prevention and treatment of OP and OL. Currently, breakthrough progress has been made in the research and development of drugs for the treatment of OP and OL. However, challenges still remain in terms of safety and effectiveness. For example, some patients will experience a significant decrease in bone mass and an increased risk of rebound vertebral fractures after discontinuing the use of denosumab. On the other hand, the application of zoledronic acid has certain efficacy, but it will induce gastrointestinal adverse reactions in some patients. As for the failure and revision of prostheses after implantation, it is mainly attributed to factors such as prosthesis loosening, insufficient stability, and wear, which affect the service life of the prosthesis and will also exacerbate the OL process and bone mass loss. In view of this, in-depth exploration of the physiological and pathological mechanisms of OP and OL and the search for better therapeutic targets have profound clinical significance for improving the treatment effect and quality of life of patients.

[0006] CH25H plays an important role as a key target affecting the disease process in various diseases such as viral infections, inflammatory diseases, osteoarthritis, autoimmune diseases, and tumors. Changes in its expression level can regulate the occurrence and development of related diseases through signal transduction. For example, Patent Document 1 involves that in in vitro cell experiments, CH25H can inhibit the infection of SARS-CoV-2 and has good safety. For example, Patent Document 2 involves a method for enhancing the anti-tumor activity of CAR-T cells by co-expressing CH25H, and provides modified immune cells or their precursors (such as T cells) containing CAR and CH25H. CH25H plays an important role in the process of related diseases, but it does not involve the mechanism of action and application of CH25H in diseases such as OP and OL by regulating OC differentiation in a manner independent of enzyme activity. At the same time, there is no report on designing interfering polypeptides targeting CH25H.

[0007] Cited references:

[0008] Non-patent literature:

[0009] [1] Campisi J, Kapahi P, Lithgow GJ, Melov S, Newman JC, Verdin E. From discoveries in ageing research to therapeutics for healthy ageing. Nature. 2019 Jul;571(7764):183 - 192.

[0010] [2] Teitelbaum SL. Bone resorption by osteoclasts. Science. 2000 Sep 1;289(5484):1504 - 1508.

[0011] [3] Walker MD, Shane E. Postmenopausal Osteoporosis. N Engl J Med. 2023 Nov

[0012] 23;389(21):1979 - 1991.

[0013] [4] Gallo J, Goodman SB, Konttinen YT, Raska M. Particle disease: biologic mechanisms of periprosthetic osteolysis in total hip arthroplasty. Innate Immun. 2013;19(2):213 - 224.

[0014] [5] Guo Q, Jin Y, Chen X, Ye X, Shen X, Lin M, Zeng C, Zhou T, Zhang J. NF-κB in biology and targeted therapy: new insights and translational implications. Signal Transduct Target Ther. 2024 Mar 4; 9(1): 53.

[0015] [6] Xu J, Wu HF, Ang ES, Yip K, Woloszyn M, Zheng MH, Tan RX. NF-kappaB modulators in osteolytic bone diseases. Cytokine Growth Factor Rev. 2009 Feb; 20(1): 7 - 17.

[0016] [7] Darnay BG, Haridas V, Ni J, Moore PA, Aggarwal BB. Characterization of the intracellular domain of receptor activator of NF-kappaB (RANK). Interaction with tumor necrosis factor receptor-associated factors and activation of NF-kappaB and c-Jun N-terminal kinase. J Biol Chem. 1998 Aug

[0017] 7; 273(32): 20551 - 20555.

[0018] [8]Li S, Shu B, Zhang Y, Li J, Guo J, Wang Y, Ren F, Xiao G, Chang Z, Chen D. Carboxyl terminus of Hsp70-interacting protein regulation of osteoclast formation in mice through promotion of tumor necrosis factor receptor-associated factor 6 protein degradation. Arthritis Rheumatol. 2014 Jul;66(7):1854-1863.

[0019] [9]Zhang Y, Zhu Z, Cao Y, Xiong Z, Duan Y, Lin J, Zhang X, Jiang M, Liu Y, Man W, Jia T, Feng J, Chen Y, Li C, Guo B, Sun D. Rnd3 suppresses endothelial cell pyroptosis in atherosclerosis through regulation of ubiquitination of TRAF6. Clin Transl Med. 2023 Sep;13(9):e1406.

[0020]

[10] Zhao J, Chen J, Li M, Chen M, Sun C. Multifaceted Functions of CH25H and 25HC to Modulate the Lipid Metabolism, Immune Responses, and Broadly Antiviral Activities. Viruses. 2020 Jul 6;12(7):727.

[0021]

[11] Majdoul S, Compton AA. Lessons in self-defence: inhibition of virus entry by intrinsic immunity. Nat Rev Immunol. 2022 Jun;22(6):339-352.

[0022]

[12] Xiao J, Wang S, Chen L, Ding X, Dang Y, Han M, Zheng Y, Shen H, Wu S, Wang M, Yang D, Li N, Dong C, Hu M, Su C, Li W, Hui L, Ye Y, Tang H, Wei B, Wang H. 25-Hydroxycholesterol regulates lysosome AMP kinase activation and metabolic reprogramming to educate immunosuppressive macrophages. Immunity. 2024 May 14;57(5):1087-1104.

[0023]

[13] Choi WS, Lee G, Song WH, Koh JT, Yang J, Kwak JS, Kim HE, Kim SK, Son YO, Nam H, Jin I, Park ZY, Kim J, Park IY, Hong JI, Kim HA, Chun CH, Ryu JH, Chun JS. The CH25H-CYP7B1-RORα axis of cholesterol metabolism regulates osteoarthritis. Nature. 2019 Feb;566(7743):254-258.

[0024] Patent literature:

[0025] Patent literature 1: "Use of cholesterol-25-hydroxylase and its enzymatic product in the preparation of a drug for inhibiting novel coronavirus", publication number CN113018421B;

[0026] Patent literature 2: "METHODS FOR ENHANCING THE ANTI-TUMOR ACTIVITY OF CAR T CELLS BY CO-EXPRESSION OF CH25H", publication number WO2024036167A3. Summary of the invention

[0027] Problems to be Solved by the Invention

[0028] This application belongs to the fields of biotechnology and medicine. The purpose of the present invention is to provide a new approach for preventing and treating bone destruction diseases caused by over-activation of osteoclasts (OCs), that is, designing an interfering polypeptide (a 16aa TRAF6 polypeptide fragment) targeting CH25H, competing with TRAF6 for binding to CH25H, thereby disrupting the stabilizing effect of CH25H on TRAF6, and achieving the effect of preventing and treating osteoporosis (OP) and osteolysis (OL). The OC is the main functional cell that performs bone resorption and plays an important role in bone development, growth, repair, and reconstruction. Over-activation of OCs and enhanced bone resorption function will cause diseases such as OP and OL. Specifically, this application relates to the prevention and treatment effects, action mechanisms, implementation methods, and uses of CH25H interfering polypeptides in OP and OL.

[0029] Solutions for Solving the Problems

[0030] The present invention studied the mechanism of action and application of CH25H deficiency in OC differentiation and diseases such as OP and OL. First, the expression of CH25H in tissues of young and old mice and in OP patients was compared. The relevant results showed that CH25H was highly expressed in old mice. In addition, analysis of the GEO database found that the expression of CH25H was up-regulated in OP patients. Then, in vitro, the effects of CH25H deficiency on OC differentiation and function were evaluated by extracting primary macrophages BMMs. The relevant results showed that CH25H deficiency could inhibit OC differentiation. In addition, in vivo, by constructing an ovariectomized mouse-induced OP model and a titanium particle-induced OL model, the therapeutic effects of CH25H deficiency on the ovariectomized-induced OP model and the titanium particle-induced OL model were observed, and various indicators were analyzed. The relevant results showed that CH25H deficiency in vivo could alleviate the bone loss symptoms in the ovariectomized-induced OP model and the titanium particle-induced OL model. Next, relevant molecular mechanism exploration was carried out, and it was preliminarily explored that CH25H deficiency inhibited OC differentiation by reducing inflammation mediated by the CH25H-TRAF6 axis in a non-enzymatic activity-dependent manner. On the premise of ensuring the safety of the CH25H interfering polypeptide, competing with TRAF6 for binding to CH25H, reducing the stabilizing effect of CH25H on TRAF6, and accelerating TRAF6 degradation, thereby inhibiting OC differentiation and function, which proves that the interfering polypeptide targeting CH25H has the potential to prevent and / or treat diseases such as OP and OL.

[0031] The technical solution of the present invention is as follows:

[0032] [1]. Use of an interfering polypeptide in the preparation of a product for preventing and / or treating over-activation of osteoclasts and related diseases, characterized in that the interfering polypeptide contains a site that competitively binds to CH25H protein;

[0033] The site that competitively binds to CH25H protein is shown as positions 430-432 of SEQ ID NO.1;

[0034] The interfering polypeptide contains no less than 15 amino acid residues.

[0035] [2]. The use according to [1], wherein the interfering polypeptide contains no less than 16 amino acid residues;

[0036] Optionally, the interfering polypeptide contains at least 16 consecutive amino acid residues among positions 415 - 450 of the sequence shown in SEQ ID NO.1;

[0037] Optionally, the interfering polypeptide contains the amino acid residues at positions 420 - 435 of the sequence shown in SEQ ID NO.1;

[0038] Optionally, the interfering polypeptide contains the amino acid residues at positions 425 - 440 of the sequence shown in SEQ ID NO.1;

[0039] Optionally, the interfering polypeptide contains the amino acid residues at positions 430 - 445 of the sequence shown in SEQ ID NO.1.

[0040] [3]. The use according to [1] or [2], wherein the over - activation of osteoclasts and related diseases include osteoporosis, osteolysis, tumor bone metastasis, malignant bone tumors, and / or rheumatoid arthritis;

[0041] Preferably, the over - activation of osteoclasts and related diseases include osteoporosis and / or osteolysis.

[0042] [4]. The use according to [1], wherein the prevention and / or treatment of the over - activation of osteoclasts and related diseases include at least one of the following (i) - (vi):

[0043] (i) Inhibiting the excessive differentiation of osteoclasts in the body;

[0044] (ii) Reducing the bone resorption and bone erosion of osteoclasts in the body;

[0045] (iii) Increasing the bone volume fraction in the body;

[0046] (iv) Increasing the number and thickness of trabecular bone in the body;

[0047] (v) Reducing the trabecular bone separation, porosity, and pore number in the body;

[0048] (vi) Increasing the bone density in the body;

[0049] The body is an individual with a possibility of suffering from over - activation of osteoclasts and related diseases;

[0050] Optionally, the individual includes a mammal;

[0051] Optionally, the mammal includes a mouse, a rat, a guinea pig, a cow, a sheep, a cat, a dog, a horse, a rabbit, a pig, a monkey, and a human.

[0052] [5]. The use according to any one of [1]-[4], wherein the product for preventing and / or treating osteoclast over-activation and related diseases includes a drug and a pharmaceutical composition;

[0053] Optionally, the pharmaceutical composition further comprises one or more drugs for clinically treating bone destruction diseases and / or one or more pharmaceutically acceptable carriers.

[0054] [6]. The use according to any one of [1]-[5], wherein the pharmaceutically acceptable carrier includes one or a combination of two or more of a solvent, a solubilizer, a cosolvent, an emulsifier, a flavoring agent, an odorant, a coloring agent, a binder, a disintegrant, a filler, a lubricant, a wetting agent, an osmotic pressure regulator, a pH regulator, a stabilizer, a surfactant, and a preservative.

[0055] [7]. The use of an inhibitor targeting CH25H in the preparation of a product for preventing and / or treating osteoclast over-activation and related diseases, characterized in that the inhibitor targeting CH25H is selected from substances that reduce the transcriptional and translational expression levels of CH25H;

[0056] The inhibitor targeting CH25H includes at least one of a nucleic acid, a carrier containing the nucleic acid, a polypeptide, a carrier expressing the polypeptide, a ribonucleoprotein complex, and a small molecule inhibitor;

[0057] Optionally, the polypeptide includes at least one of an artificial zinc finger nuclease and a transcription activator-like effector nuclease;

[0058] Optionally, the nucleic acid includes at least one of an antisense RNA molecule, an RNA interference molecule, and an RNA aptamer;

[0059] Optionally, the ribonucleoprotein complex includes a CRISPR-Cas system.

[0060] [8]. The use according to [7], wherein the osteoclast over-activation and related diseases include osteoporosis, osteolysis, tumor bone metastasis, malignant bone tumor, and / or rheumatoid arthritis.

[0061] [9]. The use according to claim [7] or [8], wherein the osteoclast over-activation and related diseases include osteoporosis and / or osteolysis.

[0062]

[10] . Use according to any one of [7]-[9], wherein the prevention and / or treatment of osteoclast over-activation and related diseases for osteoclast over-activation and related diseases includes at least one of the following (i)-(vi):

[0063] (i) Inhibiting excessive differentiation of osteoclasts in the body;

[0064] (ii) Reducing bone resorption and bone erosion of osteoclasts in the body;

[0065] (iii) Increasing bone volume fraction in the body;

[0066] (iv) Increasing the number and thickness of trabecular bone in the body;

[0067] (v) Reducing trabecular bone separation, porosity and pore number in the body;

[0068] (vi) Increasing bone density in the body;

[0069] Optionally, the body is an individual with a possibility of suffering from osteoclast over-activation and related diseases;

[0070] Optionally, the individual includes mammals;

[0071] Optionally, the mammals include mice, rats, guinea pigs, cows, sheep, cats, dogs, horses, rabbits, pigs, monkeys and humans.

[0072] Effects of the Invention

[0073] The present invention first discovers that CH25H deficiency can effectively inhibit OC differentiation and function.

[0074] The present invention first discovers that CH25H deficiency can effectively relieve OP and OL symptoms.

[0075] The present invention first discovers that CH25H can promote OC differentiation by binding to TARF6 in a non-enzyme activity-dependent manner.

[0076] The present invention first discovers that the CH25H interfering polypeptide can effectively inhibit OC differentiation. Description of the Drawings

[0077] Figure 1 Shows high expression of CH25H in aged mice and OP patients, and shows the CH25H expression in different tissues of each experimental group and the expression of CH25H and OC-related genes in OP patients. Figure 1 A, Figure 1 B, Figure 1 C and Figure 1 D are respectively the relative mRNA expression of CH25H gene in tissues (bone, blood, lung, spleen) of young mice and aged mice detected by RT-qPCR.Figure 1 E shows representative images of HE staining and CH25H immunohistochemical staining in young and old mice. Figure 1 F shows the expression of CH25H and OC characteristic genes in postmenopausal normal and osteoporotic patients analyzed by the GEO database (GSE230665).

[0078] Figure 2 It shows that CH25H deficiency inhibits OC differentiation in vitro, and shows the results of TRAP staining of OC in each experimental group, the quantification of the number and area of OC per well on average, and the quantification results of OC bone plate resorption and bone erosion area.

[0079] Figure 2 A shows the general view of TRAP staining of OC in each experimental group. Figure 2 B shows representative images of TRAP staining of OC and bone plate resorption in each experimental group, and the scale bar length is 100 μm. Figure 2 C shows the number of OC per well on average in each experimental group, the results of OC area quantification in each experimental group, and the results of bone erosion area quantification in each experimental group.

[0080] Figure 3 It shows that CH25H deficiency can alleviate bone loss caused by ovariectomy-induced OP, and shows the bone loss situation of the femur of the OP model detected by Micro-CT in each experimental group.

[0081] Figure 3 A shows representative two-dimensional reconstruction images of Micro-CT scans of the femurs of mice in the ovariectomy-induced OP mouse model and each experimental group. Figure 3 B shows representative three-dimensional reconstruction images of Micro-CT scans of the femurs of mice in each experimental group. Figure 3 C shows the quantification results of Micro-CT-related parameters, including bone mineral density, bone volume fraction, trabecular thickness, trabecular number, and trabecular separation of the femurs of mice in each experimental group.

[0082] Figure 4 It shows that CH25H deficiency can alleviate bone loss caused by titanium particle-induced OL, and shows the degree of bone dissolution of the skull of the OL model detected by Micro-CT in each experimental group.

[0083] Figure 4 A shows representative three-dimensional reconstruction images of Micro-CT scans of the skulls of mice in the titanium particle-induced OL mouse model and each experimental group. Figure 4 B shows the quantification results of Micro-CT-related parameters, including bone volume fraction, trabecular thickness, trabecular number, trabecular separation, porosity, and pore number of the skulls of mice in each experimental group.

[0084] Figure 5It shows the interaction between CH25H and TRAF6, shows the differential band of silver staining analysis and the mass spectrometry peak map of TRAF6, and PLA and CO-IP are used to analyze the interaction between CH25H and TRAF6.

[0085] Figure 5 A shows the differential band of silver staining analysis. Figure 5 B shows the mass spectrometry peak map of TRAF6. Figure 5 C shows the interaction of endogenous CH25H-TRAF6 in WT and CH25H-deficient BMMs analyzed by PLA, and the scale bar length is 25 μm. Figure 5 D shows the quantitative analysis of the interaction of endogenous CH25H-TRAF6 in WT and CH25H-deficient BMMs. Figure 5 E shows the interaction of exogenous CH25H-TRAF6 analyzed by CO-IP. Figure 5 F shows the schematic diagram of TRAF6 and truncated mutants with domain deletions. Figure 5 G shows the interaction of CH25H with the key domain of TRAF6 analyzed by CO-IP.

[0086] Figure 6 It shows that the deletion of CH25H inhibits the activation of the TRAF6 downstream signaling pathway, shows the protein expression of the TRAF6 downstream signaling pathway, and PLA is used to analyze the interaction between p-p65 and p65.

[0087] Figure 6 A shows the protein expression of the TRAF6 downstream signaling pathway in WT and CH25H-deficient BMMs induced by RANKL for 5 min, 15 min, and 30 min, including p-JNK, JNK, p-ERK, ERK, p-p38, p38, p-p65, and p65. Figure 6 B shows the interaction of endogenous p-p65 and p65 in WT and CH25H-deficient BMMs analyzed by PLA, and the scale bar length is 25 μm. Figure 6 C shows the quantitative analysis of the interaction of endogenous p-p65 and p65 in WT and CH25H-deficient BMMs.

[0088] Figure 7 It shows that the CH25H interfering polypeptide inhibits the binding of CH25H and TRAF6 and OC differentiation, shows the overall structure diagram of the binding of CH25H and TRAF6, the TRAP staining of OC in each experimental group, and the expression of OC characteristic genes.

[0089] Figure 7 A shows the overall structure diagram of the binding of CH25H and TRAF6. Figure 7 B shows the electrostatic potential of CH25H and TRAF6. Figure 7C shows the gross view of TRAP staining of OCs in each experimental group under different interfering polypeptide treatments during the induction of OCs by BMMs. Figure 7 D shows the representative images of TRAP staining of OCs in each experimental group under different interfering polypeptide treatments during the induction of OCs by BMMs. The scale bar is 100 μm in length. Figure 7 E shows the relative mRNA expression of OC-specific genes in each experimental group detected by RT-qPCR, including Oscar, Dc-stamp, Acp5, Mmp9, and Ctsk, and normalized according to GAPDH expression, 3 days after different interfering polypeptide treatments during the induction of OCs by BMMs. Figure 7 F shows the interaction of endogenous CH25H-TRAF6 in each experimental group analyzed by PLA under different interfering polypeptide treatments during the induction of OCs by BMMs (blue indicates DAPI, and red indicates the signal generated by the interaction). The scale bar is 10 μm in length. Figure 7 G shows the quantitative analysis of the interaction of endogenous CH25H-TRAF6 in each experimental group under different interfering polypeptide treatments during the induction of OCs by BMMs. Detailed implementation manners

[0090] Various exemplary embodiments, features, and aspects of the present invention will be described in detail below. The special word "exemplary" here means "serving as an example, embodiment, or illustration". Any embodiment described as "exemplary" here does not have to be construed as superior to or better than other embodiments.

[0091] In addition, to better illustrate the present invention, numerous specific details are given in the following detailed implementation manners. Those skilled in the art should understand that the present invention can also be implemented without some specific details. In other instances, methods, means, equipment, and steps well-known to those skilled in the art are not described in detail in order to highlight the gist of the present invention.

[0092] Unless otherwise stated, the units used in this specification are all international standard units, and the numerical values and numerical ranges appearing in the present invention should be understood to include the inevitable systematic errors in industrial production.

[0093] All numerical ranges provided herein are intended to clearly include all numerical values falling between the range endpoints and the numerical ranges therebetween. The features mentioned in the present invention or the features mentioned in the embodiments can be combined. All features disclosed in this specification can be used in combination with any composition form. Each feature disclosed in the specification can be replaced by any alternative feature that provides the same, equivalent, or similar purpose. Therefore, unless otherwise specified, the disclosed features are only general examples of equivalent or similar features.

[0094] As used herein, "comprising", "having" or "including" includes "containing", "consisting essentially of", "consisting substantially of", and "consisting of"; "consisting essentially of", "consisting substantially of" and "consisting of" are sub-concepts of "comprising", "having" or "including".

[0095] In the present invention, the term "osteoclast overactivation and related disorders" refers to the abnormal enhancement of osteoclast function, which leads to an accelerated bone resorption process, disrupts the normal balance of bone tissue, and thus causes various disorders, manifested as bone loss, destruction of bone microstructure, including osteoporosis, osteolysis, bone metastasis of tumors, malignant bone tumors, rheumatoid arthritis, etc.

[0096] In the present invention, the term "osteoporosis" is a systemic bone disease characterized by low bone mass, damage to the microstructure of bone tissue, resulting in increased bone fragility and prone to fractures. The expression of CH25H in patients with osteoporosis is higher than that in the normal population. In some specific embodiments, a mouse model of osteoporosis induced by ovariectomy is constructed for research, and in this model, the bone density, bone volume fraction, trabecular number and thickness of the mice are all decreased. In addition, the trabecular separation is increased, and obvious bone loss occurs.

[0097] In the present invention, the term "osteolysis" refers to a bone disease in which one or more bones are spontaneously and progressively dissolved without new bone formation. In severe cases, it can affect the whole body bones. Common sites include the clavicle, scapula, humerus, rib, pelvis and jaw bone. A large number of capillaries or lymphatic vessels proliferate in the lesion area, forming a structure similar to a hemangioma, resulting in the replacement of bone mass by fibrous connective tissue. In some specific embodiments, a model of osteolysis of the skull induced by titanium particles is constructed for research. In some specific embodiments, the overactivation of osteoclasts refers to that the relative mRNA expression of osteoclast-related genes Oscar (Osteoclast Associated Ig-like Receptor), Dc-stamp (Dendritic Cell-Specific Transmembrane Protein), Acp5 (Acid Phosphatase 5), Mmp9 (Matrix Metalloprotein), Ctsk (Cathepsin K) is higher than the normal level, or the protein expression of osteoclast-related proteins MMP9, TRAP, OSCAR, NFATC1, ATP6V0D2 is higher than the normal level, or the number of OC cells in TRAP staining is higher than that in the control group.

[0098] In the present invention, the term "CH25H" refers to cholesterol hydroxylase, having its broad meaning, including the CH25H gene, the mRNA of CH25H, cDNA, the CH25H protein, its modified or cleaved products, or active fragments. CH25H can be derived from humans, non-human primates (such as orangutans, apes), rodents (such as rats, mice, guinea pigs), pets (such as cats, dogs), livestock (such as horses, cows, sheep, pigs, rabbits), etc. The sequence of CH25H can be, for example: corresponding to NCBI Gene ID 9023 in humans [Homo sapiens (human)]; corresponding to NCBI Gene ID: 12642 in mice [Mus musculus (house mouse)].

[0099] In the present invention, the term "TRAF6" refers to Tumor Necrosis Factor Receptor-Associated Factor 6 (GENE ID: 22034), which is an important signal transduction protein and belongs to the TRAF protein family. It plays a key role in the differentiation and function of osteoclasts. By binding to the RANKL receptor, it activates downstream signaling pathways, such as the NF-κB and MAPK signaling pathways, thereby promoting the differentiation and maturation of osteoclasts. In some specific embodiments, the binding of CH25H to TRAF6 can promote osteoclast activation. When CH25H is competitively bound by a polypeptide, the binding between CH25H and TRAF6 is weakened, thereby inhibiting osteoclast activation. In some specific embodiments, the deletion of CH25H inhibits the expression of TRAF6 downstream signaling pathway proteins, including p-JNK (Phosphorylated c-Jun NH 2-terminal Kinase, phosphorylated c-Jun N-terminal kinase), JNK, p-ERK (Phosphorylated Extracellular Signal-regulated Kinase), ERK, p-p38 (Phosphorylated p38 Mitogen-Activated Protein Kinase), p38 (p38 Mitogen-Activated Protein Kinase), p-p65 (Phosphorylated Nuclear Factor Kappa B Subunit p65), p65 (Nuclear Factor Kappa B Subunit p65), and GAPDH (Glyceraldehyde-3-Phosphate Dehydrogenase), and the interaction between p-p65 and p65 also decreased accordingly.

[0100] As used herein, the term "pharmaceutically / immunologically acceptable" component is a substance that is suitable for use in humans and / or animals without undue adverse reactions (such as toxicity, irritation, and allergic response), i.e., a substance having a reasonable benefit / risk ratio. In some alternative embodiments, the immunologically acceptable adjuvant is selected from: aluminum adjuvants, cholera toxin and its subunits, oligodeoxynucleotides, manganese ion adjuvants, colloidal manganese adjuvants, Freund's adjuvants, MF59 adjuvants, QS-21 adjuvants, Poly I:C, and other TLR ligands, GM-CSF, IL-2, IL-3, IL-7, IL-11, IL-12, IL-18, IL-21.

[0101] As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier for the administration of prophylactic and / or therapeutic agents, including various excipients and diluents. This term refers to those pharmaceutical carriers which are not themselves essential active ingredients and which are not unduly toxic when administered. Suitable carriers are well known to those of ordinary skill in the art, and a thorough discussion of pharmaceutically acceptable excipients can be found in Remington’s Pharmaceutical Sciences, Mack Pub. Co., N.J. 1991. In some alternative embodiments, the pharmaceutically acceptable carrier may contain a liquid, such as water, saline, glycerol, and ethanol. Additionally, auxiliary substances may be present in these carriers, such as fillers, disintegrants, lubricants, glidants, effervescent agents, wetting agents or emulsifiers, flavoring agents, pH buffering substances, etc. Generally, these substances can be formulated in a non-toxic, inert, and pharmaceutically acceptable aqueous carrier medium, where the pH is typically about 5 - 8, and preferably, the pH is about 6 - 8.

[0102] It should be understood that the effective dose of the drug used may vary with the severity of the subject to be administered or treated. The specific situation is determined according to the individual conditions of the subject (such as the subject's weight, age, physical condition, the effect to be achieved), which is within the scope that can be judged by a skilled physician.

[0103] In this specification, the term "BMD" means "bone mineral density", and its full name is "Bone Mineral Density (BMD)", which is an effective indicator for clinically evaluating bone loss and diagnosing osteoporosis.

[0104] In this specification, BV: Bone Volume represents bone volume, which refers to the volume defined as bone tissue within the region of interest, and the unit is usually mm 3 。

[0105] In this specification, TV: Total / Tissue Volume, total volume, refers to the total volume of the region of interest, and the unit is usually mm 3 。

[0106] In this specification, BV / TV: bone volume fraction, can directly reflect the change of bone mass, and the unit is %.

[0107] In this specification, Tb.Th: trabecular bone thickness, refers to the average thickness of trabecular bone, and the unit is mm.

[0108] In this specification, Tb.N: trabecular bone number, refers to the number of intersections of bone tissue and non-bone tissue within a given length, and the unit is 1 / mm.

[0109] In this specification, Tb.Sp: trabecular bone separation, refers to the average width of the medullary cavity between trabecular bones, with the unit of mm.

[0110] The following provides a detailed description of the technical solution of the present invention:

[0111] Through a large number of in vitro cell studies and in vivo animal model experiments, the applicant found that the deletion of CH25H regulates inflammation mediated by the CH25H-TRAF6 axis in an enzyme activity-independent manner, thereby inhibiting OC differentiation. In vivo, the deletion of CH25H can effectively relieve the symptoms of OP and OL bone loss and improve bone metabolism homeostasis. At the same time, the CH25H interfering polypeptide competes with TRAF6 for binding to CH25H and inhibits OC differentiation and function. On this basis, the applicant completed this application. Specifically, chronic inflammation has now been recognized as an endogenous factor of aging. Studying the mechanism of chronic inflammation and eliminating inflammation is an effective strategy for treating aging-related diseases. At the same time, basic research on the regulation of OC differentiation and function, especially the research on negative regulatory signaling pathways and the development of drug action targets, is a hot topic in the molecular biology and cell biology of the skeletal system. Using related interfering polypeptides to inhibit OC differentiation and applying them to the prevention and treatment of OP and OL, so it has broad application prospects in the prevention and treatment of OP and OL. The inventors found through research that the deletion of CH25H can effectively inhibit OC differentiation and function. At the molecular level, CH25H binds to TARF6 in an enzyme activity-independent manner and can promote OC differentiation. Through observation in ovariectomy-induced OP model and titanium particle-induced OL model mice in vivo, compared with wild-type mice, CH25H-deficient mice showed alleviated bone mass loss. At the same time, the CH25H interfering polypeptide competes with TRAF6 for binding to CH25H and inhibits OC differentiation and function, suggesting that the CH25H interfering polypeptide may have application prospects for treating bone mass loss diseases. Therefore, this application provides methods and strategies for using CH25H as a target and interfering polypeptides in the prevention and treatment of diseases such as OP and OL.

[0112] <Interfering polypeptide>

[0113] The present invention provides an interfering polypeptide, which comprises a site for competitively binding to CH25H, and the site for competitively binding to CH25H is shown as positions 430-432 of SEQ ID NO.1. The competitively binding to CH25H means that the interfering polypeptide binds to the same site of CH25H as TRAF6, resulting in competition between the interfering polypeptide and TRAF6, thereby inhibiting the binding of TRAF6 to CH25H.

[0114] In some embodiments, the interfering polypeptide comprises no less than 15 amino acid residues. In some alternative embodiments, the interfering polypeptide comprises no less than 16 amino acid residues; in some optional embodiments, the interfering polypeptide comprises at least 16 consecutive amino acid residues among positions 415 - 450 of the sequence shown in SEQ ID NO.1.

[0115] In some alternative embodiments, the sequence comprises the amino acid residues at positions 420 - 435 of the sequence shown in SEQ ID NO.1; in some alternative embodiments, the sequence comprises the amino acid residues at positions 425 - 440 of the sequence shown in SEQ ID NO.1; in some alternative embodiments, the sequence comprises the amino acid residues at positions 430 - 445 of the sequence shown in SEQ ID NO.1.

[0116] In some embodiments, the interfering polypeptide provided by the present invention can competitively bind to CH25H with TRAF6, hinder the interaction between CH25H and TRAF6, thereby inhibiting OC differentiation; the inhibition of OC differentiation is manifested as the relative mRNA expression of Oscar, Dc - stamp, Acp5, Mmp9, and Ctsk being lower than the normal level; or in the gross view of TRAP staining, the number and area of OCs are reduced.

[0117] <Use of the interfering polypeptide in the preparation of a medicament for preventing and / or treating OC over - activation and related diseases>

[0118] The present invention provides the use of the above - mentioned interfering polypeptide in the preparation of a medicament for preventing and / or treating OC over - activation and related diseases.

[0119] In some embodiments, the osteoclast over - activation and related diseases include osteoporosis, osteolysis, tumor bone metastasis, malignant bone tumors, and / or rheumatoid arthritis; in some preferred embodiments, the osteoclast over - activation and related diseases include osteoporosis and / or osteolysis.

[0120] In some embodiments, the inhibitor of the present invention can inhibit OC differentiation; the inhibition of OC differentiation is manifested as the relative mRNA expression of Oscar, Dc - stamp, Acp5, Mmp9, and Ctsk being lower than the normal level; or in the gross view of TRAP staining, the number and area of OCs are reduced.

[0121] In some embodiments, the prevention and / or treatment of osteoclast over - activation and related diseases includes at least one of the following (i) - (vi):

[0122] (i) Inhibiting excessive differentiation of osteoclasts in the body;

[0123] (ii) Reduce osteoclast bone resorption and bone erosion in the body;

[0124] (iii) Increase the bone volume fraction in the body;

[0125] (iv) Increase the number and thickness of trabecular bone in the body;

[0126] (v) Reduce the trabecular bone separation, porosity and pore number in the body;

[0127] (vi) Increase the bone mineral density in the body.

[0128] In some embodiments, the body is an individual at risk of osteoclast over-activation and related diseases; in some alternative experimental protocols, the individual includes mammals; further optionally, the mammals include mice, rats, guinea pigs, cows, sheep, cats, dogs, horses, rabbits, pigs, monkeys and humans.

[0129] In some experimental protocols, the product includes a drug and a pharmaceutical composition; in some alternative embodiments, the pharmaceutical composition further contains one or more drugs for clinically treating bone destruction diseases and / or one or more pharmaceutically acceptable carriers.

[0130] In some alternative embodiments, the drugs for clinically treating bone destruction diseases include one or a combination of two or more of denosumab, bisphosphonates, parathyroid hormone analogs, calcitonin drugs, selective estrogen receptor modulators, estrogen drugs, calcium agents and active vitamin D.

[0131] In some alternative embodiments, the pharmaceutically acceptable carriers include one or a combination of two or more of solvents, solubilizers, cosolvents, emulsifiers, flavoring agents, odor-correcting agents, coloring agents, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, pH regulators, stabilizers, surfactants and preservatives.

[0132] <Inhibitor targeting CH25H>

[0133] According to some embodiments of the present invention, there is provided an inhibitor targeting CH25H, and the inhibitor may include, but is not limited to: substances that reduce the transcriptional and translational expression levels of CH25H (for example, substances that knockdown or knockout CH25H expression).

[0134] (Inhibitor)

[0135] In some embodiments, the inhibitor targeting CH25H includes at least one of nucleic acids, carriers containing nucleic acids, polypeptides, carriers expressing polypeptides, ribonucleoprotein complexes and small molecule inhibitors.

[0136] (Nucleic acid)

[0137] The nucleic acid is selected from DNA, RNA, DNA / RNA. Further, the nucleic acid includes at least one of an antisense RNA molecule, an RNA interference molecule, and an RNA aptamer.

[0138] An "antisense RNA molecule" refers to an RNA molecule complementary to an mRNA transcript, regardless of length. An antisense RNA molecule is a single-stranded RNA molecule that can be introduced into a cell, tissue, or subject and causes a decrease in the expression of an endogenous target gene product through a mechanism that depends on the degradation of the target mRNA transcript mediated by RNase H rather than on an endogenous gene silencing pathway. In some embodiments, the antisense nucleic acid contains a modified backbone, such as phosphorothioate, dithiophosphate, or other backbones known in the art, or may contain non-natural internucleoside linkages. In some embodiments, the antisense nucleic acid may contain locked nucleic acid (LNA), antisense oligonucleotide (ASO).

[0139] An "RNA interference molecule" refers to an RNA polynucleotide that mediates a decrease in the expression of an endogenous target gene product by degrading the target mRNA through an endogenous gene silencing pathway (e.g., Dicer and RNA-induced silencing complex (RISC)). Exemplary RNA interference molecules include microRNA (miRNA), short hairpin RNA (shRNA), small interfering RNA (siRNA), PIWI-interacting RNA (piRNA).

[0140] The siRNA contains a sense strand and an antisense strand; wherein the sense strand and the antisense strand are complementary and together form an RNA dimer; and, the antisense strand can hybridize or be complementary to a target sequence in the CH25H gene or its expression product.

[0141] The shRNA is obtained by vector expression. For example, after cloning a DNA fragment that can transcribe the shRNA into a viral expression vector, it can be expressed. The shRNA includes a sense strand fragment and an antisense strand fragment, and a stem-loop structure connecting the sense strand fragment and the antisense strand fragment. The sequences of the sense strand fragment and the antisense strand fragment are complementary, and the sequence of the antisense strand is complementary or hybridizable to the transcript sequence of the target sequence in the CH25H gene. The shRNA can be cleaved by an enzyme to become siRNA, thereby specifically reducing the level or activity of the CH25H gene or its expression product.

[0142] Those skilled in the art should understand that when targeting the CH25H gene or its expression product as a target, effective siRNA or shRNA can be designed and prepared according to the principles of interfering RNA design well-known in the art.

[0143] (Polypeptide)

[0144] In some embodiments, the polypeptide includes a protein containing one or more zinc finger binding domains (Zinc Finger Protein, ZFP) and an enzyme domain (such as a nuclease) (e.g., a zinc finger system or artificial zinc finger nuclease (Zinc Finger Nucleases, ZFN)), or a protein containing a transcription activator-like effector (TALE) and an enzyme domain (e.g., an endonuclease) (e.g., transcription activator-like effector nuclease (TALENs)). The polypeptide inhibits OC differentiation and alleviates OL / OP symptoms by reducing or knocking out the CH25H expression level.

[0145] In some embodiments, in the zinc finger endonuclease (ZFNs) system, it includes a DNA recognition domain composed of a Fok I cleavage domain and repeated zinc finger structures. After the endonuclease Fok I forms a dimer, it can cut the DNA double strand to form a double-strand break, and the formed break can be used for site-directed knock-in or knockout through error-prone non-homologous end joining or conservative homologous repair.

[0146] In some embodiments, in the transcription activator-like effector nuclease (TALENs) system, it contains the transcription activator-like effector factor TALEs and the catalytic region of the endonuclease Fok I. The highly conserved 33-35 amino acid TALEs repeat module determines the DNA-binding recognition specificity of TALEs. TALENs are similar in nature to zinc finger endonucleases, recognize specific DNA sequences, cut them to form double-strand breaks, and cause gene insertion or deletion through homologous repair or non-homologous end joining repair.

[0147] Those of ordinary skill in the art can obtain an inhibitor targeting CH25H against the sequence of CH25H to inhibit the expression of CH25H, thereby producing the effects of preventing and / or treating OP and OL.

[0148] (ribonucleoprotein complex (RNP))

[0149] In some embodiments, the RNP is selected from: CRISPR-Cas systems. The CRISPR-Cas system comprises a nucleic acid molecule and an enzyme protein, wherein the nucleic acid molecule is a guide RNA (gRNA) molecule, and the enzyme protein is a Cas protein or a Cas ortholog; the enzyme protein is selected from Cas9, Cas12a, Cas12b, Cas13a, Cas13b, Cas13c, Cas13e, Cas13f or CasΦ protein or its ortholog.

[0150] In some embodiments, the CRISPR-Cas system comprises: a targeting domain sequence in a guide RNA (gRNA) targeting the CH25H gene complexed with a first endonuclease protein (Cas) to form a first ribonucleoprotein (RNP) complex.

[0151] One of ordinary skill in the art can design or obtain the corresponding sgRNA for the CH25H domain to produce a prophylactic and / or therapeutic effect on OP and OL by blocking or inhibiting the expression of CH25H.

[0152] (Small molecule inhibitor)

[0153] In some specific embodiments, the reagent targeting the CH25H gene or its expression product comprises a small molecule inhibitor, which can reduce or silence the level or activity of the CH25H gene or its expression product.

[0154] In the present invention, the term "small molecule" refers to a low molecular weight compound, which can be synthetically produced or obtained from natural sources and has a molecular weight of less than 2000 Daltons (Da), less than 1500 Da, less than 1000 Da, less than 900 Da, less than 800 Da, less than 700 Da, less than 600 Da or less than 500 Da.

[0155] In some embodiments, the small molecule inhibitor can be an organic compound, an inorganic compound, or a composition of organic and / or inorganic compounds. In some specific embodiments, the small molecule inhibitor is an active substance or compound prepared chemically. Generally, these compounds are synthesized in a classical manner through chemical reactions between different organic and / or inorganic compounds.

[0156] In some embodiments, the small molecule inhibitor can exert its activity in the form in which it is administered, or the small molecule inhibitor can be a prodrug. Thus, "small molecule inhibitor" encompasses both the active form and the prodrug.

[0157] The term "prodrug" refers to a compound or substance that is converted into a therapeutic agent under physiological conditions. In some embodiments, a prodrug is a compound or substance that, upon administration, is metabolized in the body of a subject into a pharmaceutically active form (e.g., by enzymatic activity in the body of the subject).

[0158] The term "small molecule inhibitor" also encompasses its pharmaceutically acceptable salts. The term "pharmaceutically acceptable salts" refers to any salt form of a small molecule inhibitor that is safe and effective for administration to a target subject and that has the desired biological activity, pharmaceutical activity, and / or therapeutic activity. Pharmaceutically acceptable salts include salts of acidic or basic groups. Pharmaceutically acceptable acid addition salts may include, but are not limited to, hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, mesylate, esylate, benzenesulfonate, tosylate, and pamoate (i.e., 1,1'-methylene-bis-(2-hydroxy-3-naphthoate)). Suitable base salts may include, but are not limited to, aluminum, calcium, lithium, magnesium, potassium, sodium, zinc, and diethanolamine salts.

[0159] Use of an inhibitor targeting CH25H in the preparation of a product for preventing and / or treating OC overactivation and related disorders

[0160] In some specific embodiments, the inhibitor targeting CH25H of the present invention can be used to prevent and / or treat OC overactivation or diseases and / or disorders associated therewith. For example, ovariectomy-induced OP and titanium particle-induced OL. Moreover, the inhibitor targeting CH25H of the present invention can be combined with other drugs and treatment means for the treatment of OP and OL.

[0161] Thus, according to some embodiments of the present invention, there is provided the use of an inhibitor targeting CH25H as described above in the preparation of a product for preventing and / or treating OC overactivation and related disorders.

[0162] The inhibitor targeting CH25H includes at least one of nucleic acid, a vector containing the nucleic acid, polypeptide, a vector expressing the polypeptide, ribonucleoprotein complex, and small molecule inhibitor; optionally, the nucleic acid includes at least one of an antisense RNA molecule, an RNA interference molecule, and an RNA aptamer; optionally, the polypeptide includes at least one of an antibody or its antigen-binding fragment, an artificial zinc finger nuclease, and a transcription activator-like effector nuclease; optionally, the ribonucleoprotein complex includes a CRISPR-Cas system.

[0163] In some embodiments, the overactivation of osteoclasts and related diseases include osteoporosis, osteolysis, tumor bone metastasis, malignant bone tumors, and / or rheumatoid arthritis; in some preferred experimental protocols, the overactivation of osteoclasts and related diseases include osteoporosis and / or osteolysis.

[0164] In some embodiments, the inhibitor of the present invention can inhibit OC differentiation; the inhibition of OC differentiation is manifested as the relative mRNA expression of Oscar, Dc-stamp, Acp5, Mmp9, and Ctsk being lower than the normal level; or in the gross view of TRAP staining, the number and area of OCs are reduced.

[0165] In some embodiments, the prevention and / or treatment of the overactivation of osteoclasts and related diseases include at least one of the following (i) to (vi):

[0166] (i) Inhibiting the over-differentiation of osteoclasts in the body;

[0167] (ii) Reducing the bone resorption and bone erosion of osteoclasts in the body;

[0168] (iii) Increasing the bone volume fraction in the body;

[0169] (iv) Increasing the number and thickness of trabecular bone in the body;

[0170] (v) Reducing the trabecular bone separation, porosity, and pore number in the body;

[0171] (vi) Increasing the bone density in the body.

[0172] In some embodiments, the body is an individual with the possibility of suffering from the overactivation of osteoclasts and related diseases;

[0173] In some alternative experimental protocols, the individual includes mammals; further optionally, the mammals include mice, rats, guinea pigs, cows, sheep, cats, dogs, horses, rabbits, pigs, monkeys, and humans.

[0174] Examples

[0175] The embodiments of the present invention will be described in detail below in conjunction with examples. However, those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. For those not specified in the examples, the operations are carried out under conventional conditions or conditions recommended by the manufacturer. Reagents or instruments not indicated by the manufacturer can all be obtained as conventional products through commercial purchase.

[0176] Example 1: Analyze the correlation between aging and CH25H expression

[0177] To explore the relationship between the expression of CH25H and age, five 8-week-old young C57 mice and five 18-month-old old C57 mice were ordered. Different tissues of young and old mice were isolated, and blood was taken from the orbital cavity. Trizol was used for lysis to extract and grind the total RNA of tissues and whole blood to detect the expression of CH25H gene. The RNA concentration was measured by Nanodrop, and 500 ng of RNA was reverse transcribed into cDNA using a reverse transcription kit. The reaction system for real-time fluorescence quantitative PCR was 1 μL of cDNA, 0.5 μL of each upstream and downstream primer (Ch25h, F: TGCTACAACGGTTCGGAGC, R: AGAAGCCCACGTAAGTGATGAT), 5 μL of SYBR Green qPCR Mix, and 3 μL of RNase-free H 2 O. The reaction was carried out using a real-time fluorescence quantitative PCR instrument, and the 2 -ΔΔct -ΔΔCt method was used to analyze the expression level of mRNA. The femurs of young and old mice were isolated, and then decalcified, embedded, and sectioned. The expression of CH25H in the bone tissues of young and old mice was detected by immunohistochemistry. At the same time, the expression of CH25H and OC characteristic genes in postmenopausal healthy women and OP patients was analyzed using GEO (GENE EXPRESSION OMNIBUS) data (accession no. GSE230665).

[0178] The results are as Figure 1 shown. Compared with young mice, the expression of CH25H in the bone, blood, lung, and spleen of old mice was significantly upregulated. HE staining showed that a large number of vacuolar tissues appeared in old mice, and the number of trabeculae decreased. At the same time, the immunohistochemical results of CH25H showed that the expression of CH25H in old mice was higher than that in young mice. In addition, the analysis results through the GEO database (GSE230665) showed that postmenopausal OP patients highly expressed CH25H and OC characteristic genes. In summary, CH25H is highly expressed in old mice and postmenopausal OP patients.

[0179] Example 2: CH25H deficiency inhibits OC differentiation and function in vitro

[0180] Using the method of induced differentiation culture of bone marrow cells, the femurs and tibias of 8-week-old littermate control wild-type (WT) and CH25H-deficient C57 mice were separated with surgical instruments (the construction method of CH25H-deficient mice was published in Bauman DR, et al. 25-Hydroxycholesterol secreted by macrophages in response to Toll-like receptor activation suppresses immunoglobulin A production. Proc Natl Acad Sci U SA. 2009 Sep 29;106(39):16764-9.). After completely removing soft tissues such as muscles, they were placed in PBS. The two ends of the bone shafts were cut off, and a 1 mL syringe needle was used to aspirate serum-free medium to repeatedly rinse the bone marrow cavity. The cell suspension was collected and centrifuged, and the cells were resuspended with complete medium and inoculated into a culture dish. The non-adherent cells were collected overnight, and M-CSF (macrophage colony-stimulating factor) (30 ng / mL) was added for purification for 3 days. The adherent BMMs were digested and replated as OC precursor cells. A control group and an RANKL (50 ng / mL) induction group were set up, with 3 replicates in each group. The medium was changed every 3 days. Qualitative detection was performed using a TRAP staining kit (Sigma - catalog number #387A). After washing with PBS, it was fixed with 4% paraformaldehyde for 30 min, then washed with PBS, and a TRAP (tartrate-resistant acid phosphatase) staining solution was prepared for staining. After the staining was completed, gross observation scanning and microscopic photography were performed, and finally the number and area percentage of OCs were quantitatively analyzed. The dissolution and absorption of bone tissue by OCs include the degradation of collagen and the dissolution of inorganic salts, forming absorption lacunae on bone slices. Using Osteo Assay Surface (catalog number #3987), an osteoassay surface, is an inorganic crystal coating that can create a surface mimicking in vivo bone-like for in vitro analysis of the function of OCs. BMMs were inoculated on the osteoassay surface. After 5 days of induced differentiation, the non-adherent cells were first washed with PBS, and then the adherent cells were washed with ultrasound. The bone resorption on the bone plate surface was observed with an optical microscope and the percentage of bone resorption area was quantitatively analyzed.

[0181] The results are as Figure 2 shown. The TRAP staining and quantitative results showed that after CH25H deficiency, the number and area of OCs both decreased, significantly inhibiting OC differentiation. The bone resorption and quantification results showed that CH25H deficiency effectively inhibited the bone resorption function of OCs.

[0182] Example 3: CH25H deficiency alleviates OP symptoms induced by ovariectomy

[0183] Eight-week-old littermate control wild-type (WT) and CH25H-deficient female mice were ovariectomized to establish an OP mouse model. The surgical procedure is briefly described as follows: After successful intraperitoneal anesthesia with pentobarbital sodium, the female mice were anesthetized and fixed supine on the operating table. The abdominal hair of the mice was shaved and prepared for skin disinfection, and then they were placed on a sterile drape. Entering the abdominal cavity with the iliac crest level and the midline as the center, the ovaries were exposed along the distal end of the fallopian tubes, the fallopian tubes were ligated, and after confirmation, both ovaries were completely excised. The tissues were replaced, sutured layer by layer, disinfected, and cultured separately in cages. Six weeks after modeling, the samples were collected by euthanasia for subsequent analysis. The femur microstructure was scanned by Micro-CT, two-dimensional and three-dimensional images were reconstructed, and the parameter indexes reflecting the bone microstructure were quantitatively analyzed.

[0184] The results are as Figure 3 shown. The two-dimensional and three-dimensional reconstruction images of Micro-CT showed that CH25H deficiency improved bone loss in the femurs of the OP mouse model. The quantification results of Micro-CT-related parameters showed that compared with the WT modeling group, the bone mineral density, bone volume fraction, trabecular number, and trabecular thickness of the mice in the CH25H-deficient modeling group were significantly increased. In addition, the trabecular separation was significantly decreased. Therefore, the research results showed that CH25H deficiency could effectively protect against bone loss caused by OP in mice.

[0185] Example 4: CH25H deficiency alleviates titanium particle-induced OL symptoms

[0186] Eight-week-old littermate control WT and CH25H-deficient male mice were used to establish a titanium particle-induced cranial OL model. The surgical procedure is briefly described as follows: After successful intraperitoneal anesthesia with pentobarbital sodium, the hair on the heads of the mice was shaved and prepared for skin disinfection, and then they were placed on a sterile drape. Connecting the bilateral external auditory canals of the mice, moving 1.0 cm posteriorly parallel to the posterior neck, an arc incision 1.5 cm long was made to cut through the skin and subcutaneous tissue to expose the top of the skull. In the area within 0.5 cm around the intersection of the sagittal line of the cranial top and the connection line of the bilateral external auditory canals of the mice, the periosteum was incised, and titanium particles were injected into the periosteal defect area. The layers were sutured, disinfected, and cultured separately in cages. Two weeks later, the samples were collected by euthanasia for subsequent analysis. The femur microstructure was scanned by Micro-CT, two-dimensional and three-dimensional images were reconstructed, and the parameter indexes reflecting the bone microstructure were quantitatively analyzed.

[0187] The results are as Figure 4 shown. The three-dimensional results of Micro-CT showed that there was less bone destruction distribution on the skulls of the CH25H-deficient modeling group. The quantification results of related parameters showed that compared with the titanium particle modeling group, the bone volume fraction, trabecular number, and trabecular thickness of the skulls of the mice in the CH25H-deficient modeling group were significantly increased. In addition, the trabecular separation, porosity, and pore number were significantly decreased. Therefore, the research results showed that CH25H deficiency inhibited titanium particle-induced OL symptoms.

[0188] Example 5: Interaction between CH25H and TRAF6

[0189] Plate HEK293T cells in a 6-cm cell culture dish and grow them to an appropriate density. Change the medium 1 h in advance and transfect the relevant plasmids (empty vector control, m-CH25H-Flag, and m-TRAF6-Myc); harvest the samples 24 h later. Wash the cells twice with pre-cooled PBS, centrifuge to collect the cells into an EP tube, add 400 μL of lysis buffer, and lyse the cells on ice for 30 min. Pre-cool a 4°C centrifuge in advance. After lysis, centrifuge at 14,000 rpm for 30 min; collect the supernatant after centrifugation. Pipette 60 μL as the Input sample, add 20 μL of 4× loading buffer, boil the sample for denaturation, and add the remaining supernatant to the washed corresponding magnetic beads (anti- M2 magnetic beads, Sigma, M8823), and rotate and bind overnight at 4°C; collect the magnetic beads by transient centrifugation, wash the magnetic beads four times, and finally add 80 μL of 1× loading buffer as the IP sample, boil the sample for denaturation, and perform Western blot to detect the interaction effect. Collect the empty vector control and CH25H overexpression samples for electrophoresis. After electrophoresis, cut off the excess gel, transfer the gel to a 6-cm culture dish, add the fixing solution (2 mL of ultrapure water + 0.5 mL of acetic acid + 2.5 mL of ethanol), and fix it on a shaker for 20 min; discard the fixing solution, wash with 30% ethanol for 10 min, and wash with ultrapure water for 10 min; after washing, add the sensitizer and incubate on a shaker for 10 min; wash the gel twice with ultrapure water for 10 min each time. After washing, add the silver staining reagent and incubate on a shaker for 10 min; wash the gel with ultrapure water for 1 min. After washing, add the developing solution until obvious bands appear, and add the terminating solution to terminate the development; wash the gel with ultrapure water for 10 min, take a picture of the gel, and cut off the obvious bands for subsequent mass spectrometry analysis.

[0190] Primary cells from WT and CH25H-deficient mice were taken and BMMs were purified. The purified BMMs were digested, and the cells were resuspended in complete medium and seeded into Confocal dishes. At the same time, 30 ng / mL M-CSF and 50 ng / mL RANKL were added for OC-induced differentiation for 6 days. After the induction ended, the medium was discarded, and the cells were washed twice with PBS on ice. 4% paraformaldehyde was added to fix the cells for 30 min; the cells were washed twice with PBS, and 0.1% Triton X-100 solution was added to permeabilize the cells for 10 min; the cells were washed twice with PBS, 2 drops of Blocking buffer were added for blocking, and the cells were incubated in an incubator at 37 °C for 1 h; primary antibodies (CH25H, Santa Cruz, sc-293256, 1:50 and TRAF6, Cell Signaling Technology, #67591, 1:50) prepared with antibody diluent were added, and the primary antibodies were incubated overnight at 4 °C; the cells were washed three times with Buffer A (Sigma, DUO82046), and secondary antibodies ( in situ probe anti-rabbit PLUS, Sigma, DUO92002, 1:5 and in situ probe anti-mouse MINUS, Sigma, DUO92004, 1:5) were added, and the cells were incubated in an incubator at 37 °C for 90 min; the cells were washed three times with Buffer A, ligation Mix was prepared, and the prepared ligation Mix was added, and the cells were incubated in the dark in an incubator at 37 °C for 30 min; the cells were washed twice with Buffer A, PCR system was prepared, and the prepared PCR system was added, and the cells were incubated in the dark in an incubator at 37 °C for 100 min; the cells were washed twice with Buffer B (Sigma, DUO82048), washed once with PBS, and the prepared DAPI solution was added to counterstain the cell nuclei, and the cells were incubated in the dark in an incubator at 37 °C for 10 min. The cells were washed twice with PBS, and photographed and analyzed with a laser confocal microscope.

[0191] In addition, by constructing truncated bodies with deletions of various domains of TRAF6 ( Figure 5 F), the key domains of the interaction between CH25H and TRAF6 were further explored according to the above method.

[0192] The results are as Figure 5As shown, after SDS-PAGE of the IP product overexpressing CH25H and silver staining for visualization, it was found that the interaction of CH25H with multiple proteins was enhanced. The differentially migrating bands were excised for mass spectrometry analysis, and the TRAF6 protein was identified through enrichment analysis and screening. Representative images of PLA and related quantification results showed a strong interaction between CH25H and TRAF6 in WT BMMs cells, while no interaction was observed in the absence of CH25H. The results of the CO-IP experiment indicated an interaction between CH25H and TRAF6. Meanwhile, truncated mutants with deletions of various domains of TRAF6 (GENE ID: 22034) were constructed (the domains were divided according to the Family & Domains section of TRAF6: P70196 on the UniProt website, where amino acids 70 - 109 form the RING domain; amino acids 150 - 259 form the Zinc finger domain; amino acids 299 - 356 form the TARF-N domain; amino acids 358 - 530 form the TARF-C domain). Through the CO-IP experiment, the relevant results showed that the C-terminal domain (amino acids 358 - 530) of TRAF6 is the key domain for interacting with CH25H.

[0193] TRAF6 (SEQ ID NO.1):

[0194] MSLLNCENSCGSSQSSSDCCAAMAASCSAAVKDDSVSGSASTGNLSSSFMEEIQGYDVEFDPPLESKYECPICLMALREAVQTPCGHRFCKACIIKSIRDAGHKCPVDNEILLENQLFPDNFAKREILSLTVKCPNKGCLQKMELRHLEDHQVHCEFALVNCPQCQRPFQKCQVNTHIIEDCPRRQVSCVNCAVSMAYEEKEIHDQSCPLANIICEYCGTILIREQMPNHYDLDCPTAPIPCTFSVFGCHEKMQRNHLARHLQENTQLHMRLLAQAVHNVNLALRPCDAASPSRGCRPEDPNYEETIKQLESRLVRQDHQIRELTAKMETQSMYVGELKRTIRTLEDKVAEMEAQQCNGIYIWKIGNFGMHLKSQEEERPVVIHSPGFYTGRPGYKLCMRLHLQLPTAQRCANYISLFVHTMQGEYDSHLPWPFQGTIRLTILDQSEALIRQNHEEVMDAKPELLAFQRPTIPRNPKGFGYVTFMHLEALRQGTFIKDDTLLVRCEVSTRFDMGGLRKEGFQPRSTDAGV

[0195] Example 6: Deletion of CH25H inhibits the activation of the TRAF6 downstream signaling pathway

[0196] The adherent digested littermate control WT and CH25H-deficient BMMs were replated as OC precursor cells, induced to the corresponding time points, washed with PBS, harvested, added with RIPA lysis buffer, lysed on ice for 30 min, centrifuged at 4°C and 12,000 g for 30 min, the supernatant was collected, and the protein concentration was quantified using the BCA method. 4×Loading Buffer was added in proportion, the protein was denatured in a 100°C metal bath for 10 min, the total amount of loaded protein was 30 μg, SDS-PAGE protein gel electrophoresis was performed, transferred to the membrane and blocked, incubated with primary and secondary antibodies (primary antibodies: p-JNK, CST, #4668; JNK, CST, #9252; p-ERK, CST, #4370; ERK, CST, #4695; p-p38, CST, #9215; p38, CST, #4668; p-p65, CST, #3033; p65, CST, #6956; GAPDH, CST, #5174; secondary antibodies: Anti-rabbit IgG, HRP-linked Antibody, CST, #7074; Anti-mouse IgG, HRP-linked Antibody, CST, #7076), chemiluminescence development. The protein indicators involved in this example include p-JNK, JNK, p-ERK, ERK, p-p38, p38, p-p65, p65 and GAPDH. At the same time, PLA was used to detect the endogenous interaction between p-p65 and p65 in BMMs cells.

[0197] The results are as Figure 6 shown. The WB results show that CH25H deficiency inhibits the TRAF6 downstream signaling pathway. Representative images of PLA and related quantification results show that strong interaction between p-p65 and p65 was observed in WT BMMs cells, and the interaction between p-p65 and p65 was weakened after CH25H deficiency.

[0198] Example 7: CH25H interfering polypeptide inhibits the binding of CH25H to TRAF6 and OC differentiation

[0199] Design related polypeptides by synthetic biology methods. According to the binding domain of CH25H and TRAF6 and the protein structure, design multiple TRAF6 polypeptide fragments containing 16 amino acids (aa) that can competitively bind to CH25H and thus interfere with the interaction between CH25H and TRAF6, and verify the ability to interfere with the binding of CH25H and TRAF6. According to the top 10 predicted key binding positions of multiple websites (ZDOCK, HDOCK, CoDockPP), it is concluded that the binding positions are at the 430th, 431st, and 432nd positions of the TRAF6 sequence. Therefore, synthesize 16-aa TRAF6 polypeptide fragments containing the binding sites (positions 420-435, 425-440, 430-445) and 2×Flag polypeptide fragments as a control for subsequent functional verification. To further understand the interaction between CH25H and TRAF6, perform molecular docking on the protein structures of TRAF6 and CH25H to visualize the overall structure and potential of the binding between TRAF6 and CH25H. Predict the specific binding region between TRAF6 and CH25H through a protein docking website, and synthesize 16-aa TRAF6 polypeptide fragments (positions 420-435, 425-440, 430-445) based on the relevant results. Use the synthesized CH25H interfering polypeptide (TRAF6 polypeptide fragment) to interfere with the osteoclast (OC) differentiation induced by bone marrow macrophages (BMMs), perform tartrate-resistant acid phosphatase (TRAP) staining, and simultaneously detect the expression of genes related to OC differentiation and function by reverse transcription quantitative polymerase chain reaction (RT-qPCR), including Oscar, Dc-stamp, Acp5, Mmp9, and Ctsk. At the same time, perform proximity ligation assay (PLA) to detect the endogenous CH25H-TRAF6 interaction in each experimental group under different interfering polypeptide treatments during the process of BMMs inducing OC differentiation.

[0200] The results are as Figure 7 shown. The molecular docking results show the overall structure and potential of the binding between TRAF6 and CH25H. The gross view and representative images of TRAP staining indicate that the number of OCs decreases after the intervention with the CH25H interfering polypeptide, significantly inhibiting the expression of TRAP and OC differentiation. The RT-qPCR results show that the CH25H interfering polypeptide inhibits the mRNA expression of OC-related characteristic genes Oscar, Dc-stamp, Acp5, Mmp9, and Ctsk. The representative images and related quantification results of PLA show that the interaction between CH25H and TRAF6 weakens after the intervention with the CH25H interfering polypeptide, indicating that the CH25H interfering polypeptide inhibits the binding ability of CH25H and TRAF6.

[0201] In addition, from the above description, those skilled in the art can clearly and easily understand the key features of the present invention from the present invention. Without departing from the spirit and scope of the present invention, many modifications can be made to the invention to adapt to various different usage purposes and conditions. Therefore, such modifications are also intended to fall within the scope of the appended claims.

Claims

1. Use of an intervention polypeptide in the preparation of a product for preventing and / or treating osteoclast hyperactivation and related disorders, characterized in that: The intervening polypeptide comprises a site that competitively binds to the CH25H protein; The competitive binding sites of CH25H protein are shown in positions 430 to 432 of SEQ ID NO.1; The intervening polypeptide comprises no less than 15 amino acid residues.

2. The use according to claim 1, characterized in that The intervening polypeptide comprises no less than 16 amino acid residues; Optionally, the intervening polypeptide comprises at least 16 consecutive amino acid residues from positions 415 to 450 of the sequence shown in SEQ ID NO.1; Optionally, the intervention polypeptide comprises amino acid residues 420-435 of the sequence shown in SEQ ID NO.1; Optionally, the intervention polypeptide comprises amino acid residues 425-440 of the sequence shown in SEQ ID NO.1; Optionally, the intervention polypeptide comprises amino acid residues 430-445 of the sequence shown in SEQ ID NO.

1.

3. The use according to claim 1 or 2, characterized in that: The osteoclast overactivation and related disorders include osteoporosis, osteolysis, tumor bone metastasis, malignant bone tumors and / or rheumatoid arthritis; Preferably, the osteoclast overactivation and related disorders include osteoporosis and / or osteolysis.

4. The use according to claim 1, characterized in that The prevention and / or treatment of osteoclast overactivation and related disorders include at least one of the following (i) to (vi): (i) Inhibit excessive differentiation of osteoclasts in the body; (ii) reduce bone resorption and bone erosion by osteoclasts in the body; (iii) increasing the bone volume fraction in the body; (iv) increase the number and thickness of trabecular bones in the body; (v) reduce the separation, porosity and number of pores in the body; (vi) improve the body's bone density; The subject is an individual who is likely to suffer from osteoclast hyperactivation and related disorders; Optionally, the individual comprises a mammal; Optionally, the mammals include mice, rats, guinea pigs, cows, sheep, cats, dogs, horses, rabbits, pigs, monkeys and humans.

5. The use according to any one of claims 1 to 4, characterized in that The products for preventing and / or treating osteoclast overactivation and related disorders include drugs and pharmaceutical compositions; Optionally, the pharmaceutical composition further comprises one or more drugs for clinically treating bone destructive diseases and / or one or more pharmaceutically acceptable carriers.

6. The use according to any one of claims 1 to 5, characterized in that The pharmaceutically acceptable carrier includes one or a combination of two or more of solvents, solubilizers, cosolvents, emulsifiers, flavoring agents, olfactory agents, colorants, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, pH regulators, stabilizers, surfactants and preservatives.

7. Use of an inhibitor targeting CH25H in the preparation of a product for preventing and / or treating osteoclast hyperactivation and related disorders, characterized in that: The inhibitor targeting CH25H is selected from substances that reduce the transcription and translation expression level of CH25H; The inhibitor targeting CH25H comprises at least one of a nucleic acid, a vector comprising a nucleic acid, a polypeptide, a vector expressing a polypeptide, a ribonucleoprotein complex and a small molecule inhibitor; Optionally, the polypeptide comprises at least one of an artificial zinc finger nuclease and a transcription activator-like effector nuclease; Optionally, the nucleic acid comprises at least one of an antisense RNA molecule, an RNA interference molecule, and an RNA aptamer; Optionally, the ribonucleoprotein complex comprises a CRISPR-Cas system.

8. The use according to claim 7, characterized in that The osteoclast overactivation and related disorders include osteoporosis, osteolysis, tumor bone metastasis, malignant bone tumors and / or rheumatoid arthritis.

9. The use according to claim 7 or 8, characterized in that The osteoclast overactivation and related disorders include osteoporosis and / or osteolysis.

10. The use according to any one of claims 7 to 9, characterized in that The prevention and / or treatment of osteoclast overactivation and related disorders comprises at least one of the following (i) to (vi): (i) Inhibit excessive differentiation of osteoclasts in the body; (ii) reduce bone resorption and bone erosion by osteoclasts in the body; (iii) increasing the bone volume fraction in the body; (iv) increase the number and thickness of trabecular bones in the body; (v) reduce the separation, porosity and number of pores in the body; (vi) improve the body's bone density; Optionally, the subject is an individual who is at risk of suffering from osteoclast hyperactivation and related disorders; Optionally, the individual comprises a mammal; Optionally, the mammals include mice, rats, guinea pigs, cows, sheep, cats, dogs, horses, rabbits, pigs, monkeys and humans.

Citation Information

Patent Citations

  • Use of cholesterol-25-hydroxylase and its enzymatic products in the preparation of drugs to inhibit the novel coronavirus.

    CN113018421B

  • Methods for enhancing the Anti-tumor activity of car t cells by co-expression of ch25h

    WO2024036167A3