A small nucleic acid targeting the RANKL gene and its application in treating orthopedic diseases
By designing and optimizing small nucleic acid drugs targeting the RANKL gene, especially chemically modified siRNA, the accuracy and stability problems of the existing technology in treating diseases with high RANKL gene expression have been solved, and effective silencing of the RANKL gene has been achieved, significantly alleviating the symptoms of orthopedic diseases such as osteoarthritis and rheumatoid arthritis.
Patent Information
- Application Number
- CN202511061536.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-31
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2045-07-31
AI Technical Summary
In the existing technology, there is a lack of highly effective and stable small nucleic acid drugs for the treatment of orthopedic diseases with high expression of the RANKL gene. Traditional drugs such as monoclonal antibodies and traditional Chinese medicine have problems such as limited penetration or complex ingredients, making it difficult to achieve precise targeting.
Small nucleic acids targeting the RANKL gene are designed and optimized, containing the sense and antisense chains of specific nucleotide sequences, and chemically modified to form siRNA, which is delivered through LNP vectors to achieve precise regulation of the RANKL gene.
It can significantly reduce RANKL mRNA expression by more than 50% in vitro, significantly reduce the severity of arthritis in vivo, relieve joint swelling, and has a significant therapeutic effect.
Smart Images

Figure CN120574835B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a small nucleic acid targeting the RANKL gene and its application in treating orthopedic diseases. Background Art
[0002] The RANKL gene, encoded by the TNFSF11 gene in humans, is a member of the tumor necrosis factor (TNF) superfamily and plays a key role in bone regeneration and immune system regulation. Among multiple tissues and organs in the human body, it is highly expressed in bone joints and the thymus, and is closely associated with tissue growth, particularly bone growth.
[0003] RANKL binds to RANK receptors on the surface of osteoclast precursors, activating signaling pathways such as NF-κB and MAPK, leading to osteoclast activation, differentiation, and maturation. In arthritis, abnormally high RANKL expression promotes the accumulation of osteoclasts at the joint-bone interface, leading to bone matrix degradation and bone erosion, a major pathological basis for joint deformity and functional loss in arthritis patients. RANKL not only regulates bone metabolism but also participates in immune cell activation. Activated T cells secrete RANKL, which not only promotes osteoclastogenesis but also amplifies the joint inflammatory response through the production of inflammatory cytokines (such as TNF-α and IL-6), creating a vicious cycle of immune dysfunction and bone destruction. Given its central role in bone destruction, RANKL is considered an ideal target for the treatment of conditions such as osteoarthritis, rheumatoid arthritis, psoriatic arthritis, bone injury, osteoporosis, bone destruction, synovitis, and systemic inflammation.
[0004] Currently, there are few successful drug developments targeting RANKL. In the field of orthopedic treatment, drug development targeting RANKL primarily focuses on monoclonal antibodies, such as denosumab. By blocking the binding of RANKL to RANK, these drugs effectively inhibit osteoclast differentiation and activity. However, due to their large molecular weight and limited tissue penetration, their ability to control local joint inflammation remains limited. Traditional treatments (such as methotrexate and biologics) can alleviate inflammation, but their ability to repair established bone erosion is limited. Furthermore, while Traditional Chinese Medicine (TCM) has a long history and extensive experience in the treatment of orthopedic conditions, these herbs are often compound preparations with complex ingredients. Their mechanisms of action often involve the integrated regulation of multiple targets and pathways. Their direct effects on the RANKL gene and their specificity are relatively unclear, making precise targeted therapy difficult to achieve. Furthermore, ensuring the stability and reproducibility of therapeutic effects presents challenges.
[0005] Small nucleic acid drugs can specifically recognize and bind to target mRNA sequences through the principle of complementary base pairing, precisely regulating target genes and silencing the expression of disease-related proteins at the translational level. However, in the treatment of diseases with high RANKL expression, there is still an unmet need for small nucleic acid drugs that can effectively and stably silence RANKL. Summary of the Invention
[0006] In response to the shortcomings of the existing technology, the present invention designed a small nucleic acid drug targeting the RANKL gene and further optimized the sequence and chemical modification, aiming to provide an effective treatment strategy for the treatment of diseases with high RANKL expression.
[0007] In one aspect, the present invention provides a small nucleic acid targeting the RANKL gene, wherein the small nucleic acid comprises a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 1, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 2.
[0008] In one or more embodiments, the small nucleic acid comprises a modification, and the nucleotide sequence of the modified sense strand is SEQ ID NO: 11, and the nucleotide sequence of the modified antisense strand is SEQ ID NO: 12; or, the nucleotide sequence of the modified sense strand is SEQ ID NO: 17, and the nucleotide sequence of the modified antisense strand is SEQ ID NO: 18.
[0009] In another aspect, the present invention provides a small nucleic acid targeting the RANKL gene, wherein the small nucleic acid comprises a sense strand and an antisense strand, and the small nucleic acid comprises a modification, wherein the nucleotide sequence of the modified sense strand is SEQ ID NO: 11, and the nucleotide sequence of the modified antisense strand is SEQ ID NO: 12.
[0010] In another aspect, the present invention provides a small nucleic acid targeting the RANKL gene, wherein the small nucleic acid comprises a sense strand and an antisense strand, and the small nucleic acid comprises a modification, wherein the nucleotide sequence of the modified sense strand is SEQ ID NO: 17, and the nucleotide sequence of the modified antisense strand is SEQ ID NO: 18.
[0011] In another aspect, the present invention provides use of a small nucleic acid targeting the RANKL gene according to any embodiment of the present invention in the preparation of a medicament for treating an orthopedic disease or disorder.
[0012] In one or more embodiments, the orthopedic disease or condition is selected from one or more of osteoarthritis, rheumatoid arthritis, psoriatic arthritis, bone injury, osteoporosis, bone destruction, and synovitis.
[0013] In another aspect, the present invention provides a method for preparing a small nucleic acid targeting the RANKL gene as described in any embodiment herein, the method comprising synthesizing nucleotide monomers into a small nucleic acid.
[0014] Preferably, the method is the phosphoramidite triester method.
[0015] In another aspect, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a small nucleic acid targeting the RANKL gene as described in any embodiment herein, and a pharmaceutically acceptable carrier.
[0016] In one or more embodiments, the carrier is LNP.
[0017] In another aspect, the present invention provides use of the pharmaceutical composition as described in any embodiment herein in the preparation of a medicament for treating an orthopedic disease or condition.
[0018] In one or more embodiments, the orthopedic disease or condition is selected from one or more of osteoarthritis, rheumatoid arthritis, psoriatic arthritis, bone injury, osteoporosis, bone destruction, and synovitis.
[0019] Compared with the prior art, the small nucleic acid targeting the RANKL gene of the present invention has the following beneficial effects:
[0020] 1. By transfecting HaCat cells with Lip3000, the RANKL mRNA expression level can be reduced by more than 50% at a transfection concentration of tens of nM.
[0021] 2. After the introduction of modification, siRNA-1-mode2, siRNA-1-mode3, and siRNA-1-mode5 molecules can maintain long-term stability in serum for 24 hours; and the off-target risk is significantly reduced compared to before the introduction of modification.
[0022] 3. siRNA-1-mode2, siRNA-1-mode3, and siRNA-1-mode5 were transfected into HaCat cells at a concentration of nM, resulting in a decrease of approximately 75% in RANKL mRNA expression levels.
[0023] 4. Subcutaneous injection of LNP preparations of siRNA-1-mode2, siRNA-1-mode3, and siRNA-1-mode5 can significantly reduce the severity of CIA in rats and alleviate CIA-induced limb swelling. This indicates that based on its significant silencing effect on RANKL gene expression, it has great application value in the treatment of bone diseases or conditions, especially for the treatment of osteoarthritis, rheumatoid arthritis, psoriatic arthritis, bone injury, osteoporosis, bone destruction and synovitis, which are closely related to the RANKL gene. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 It is to verify the effect of siRNA on the relative expression level of mRNA targeting RANKL gene at the cell level.
[0025] Figure 2 Figure 2 is the enzymatic digestion diagram of serum containing modified siRNA.
[0026] Figure 3 This is a map of the psiCHECK-2 plasmid.
[0027] Figure 4 Figure 2 is a graph of the relative luciferase activity detected when using each siRNA in the dual-luciferase reporter gene assay system.
[0028] Figure 5 It is a statistical chart of the weight changes of rats in each group.
[0029] Figure 6 It is the statistical graph of arthritis scores of rats in each group.
[0030] Figure 7 is the statistical graph of the foot volume of rats in each group. DETAILED DESCRIPTION
[0031] The present invention incorporates the entirety of the cited references into the present invention by way of reference.
[0032] Unless otherwise specified, the experimental animals or materials in this description are commercially available.
[0033] Example 1: Sequence design and synthesis of siRNA
[0034] (1) siRNA sequence design
[0035] The sequence of the RANKL gene was obtained from the NCBI database. Sequences in the 5' untranslated region (5'UTR), 3' untranslated region (3'UTR), and the vicinity of the start codon were avoided to design naked siRNA sequences targeting the RANKL gene. The appropriate binding of the sense and antisense strands was taken into consideration, along with maintaining the linearity of the sense strand in the single-stranded state and preventing preferential loading of the sense strand by RISC. This ensured that the free energy value of the sense strand was close to or slightly less than 0. The siRNA sequences shown in Table 1 were designed, where SEQ ID NOs: 1, 3, 5, and 7 are sense strand sequences, and SEQ ID NOs: 2, 4, 6, and 8 are antisense strand sequences. The free energy values of each sense strand are shown in Table 2.
[0036] Table 1: siRNAs targeting RANKL gene and their sequences
[0037]
[0038] Table 2: Free energy values of siRNA sense strand
[0039]
[0040] (2) Synthesis of siRNA
[0041] siRNA was synthesized using the phosphoramidite triester method, which involves repeating a five-step process of "deprotection - activation - coupling - capping - oxidation." After each round, the oligonucleotide chain is extended by one nucleotide, ultimately yielding a crude siRNA of the target length. The deprotection reagent used was TCA Deblock, the activation agent was 5-benzylthiotetrazole, the capping reagents were CAPA and CAPB, and the oxidant was iodine solution or (E)-N,N-dimethyl-N'-(3-thioxo-3H-1,2,4-dithiazol-5-yl)formamidine.
[0042] The crude siRNA product was deprotected, annealed, and purified to obtain the crude siRNA. HPLC purification was performed using an anion exchange column, Diamond Q Mustang (purchased from Boglon), and eluents (mixtures of Solution A and Solution B in varying ratios; Solution A: 100 mM Tris, 10 mM EDTA, 300 mM NaCl, pH 9.0; Solution B: 100 mM Tris, 10 mM EDTA, 1000 mM NaCl, pH 9.0).
[0043] Purification procedure: elution with 5 column volumes (CV) of solution A; elution with 50 CV of eluent (containing 0%-100% solution B); and elution with 5 CV of solution B. The target elution peak was desalted using a G25M column (purchased from Boglund). The desalted product was concentrated by ultrafiltration to obtain the purified product, which was lyophilized, vacuum-packed, and stored at -20°C until use.
[0044] (3) siRNA knockdown experiment on RANKL cell expression
[0045] The four synthesized siRNAs listed in Table 1 were dissolved and diluted to 100 μM and set aside. HaCat cells were seeded into 12-well plates and transfected with siRNA 24 hours after seeding. The transfection reagent used was Lip3000 (Lipofectamine 3000, purchased from Thermofisher). The final siRNA concentrations after transfection were 30 nM and 100 nM. The cells were cultured in a CO2 incubator for 48 hours. A control group without siRNA was also established. Cells were harvested for RNA extraction, reverse transcribed into cDNA, and the relative expression level of RANKL mRNA was determined by qPCR.
[0046] qPCR test results are as follows Figure 1 The vertical axis represents the relative expression level of RANKL mRNA compared to the control group. RANKL expression decreased in all groups, with siRNA-1, siRNA-2, and siRNA-4 achieving knockdown effects exceeding 50%. siRNA-1 achieved the best knockdown effect at transfection concentrations of 30 nM and 100 nM.
[0047] Example 2: Design, synthesis and screening of modified siRNAs
[0048] Typically, siRNA degrades rapidly in blood. According to a reference (doi: 10.1038 / mt.2009.91), unmodified siRNA can be degraded in blood within one minute. The effects of different modification schemes on siRNA stability were examined using serum enzymatic hydrolysis experiments. Therefore, to obtain the most stable and effective siRNA possible, this example selected siRNA-1, the most effective siRNA screened in Example 1, for appropriate chemical modification.
[0049] (1) Design and synthesis of modified siRNA
[0050] The RNA modifications in the present invention include, but are not limited to, phosphate backbone modifications, base modifications, ribose modifications, 5' end modifications, 3' end modifications, and bioconjugation modifications.
[0051] Phosphate backbone modifications include, but are not limited to, phosphorothioate, phosphorodithioate, peptide nucleic acid (PNA), and morpholinos (PMOs) modifications.
[0052] Base modifications include but are not limited to pseudouracil (φ), 2-thiouracil (s2U), 5-methylcytosine (5-methyl-cytosine), 2,6-diaminopurine, and 2-thiothymine.
[0053] Ribose modifications include, but are not limited to, 2'-O-methyl (2ʹ-O-methyl), 2'-O-methoxyethyl (2ʹ-O-methoxyethyl), 2'-fluoro (2ʹ-F), locked nucleic acid (LNA), constrained ethyl (cEt), ENA (ethylene-bridged nucleic acid), and GNA (glycerolnucleic acid).
[0054] 5'-end conjugation includes, but is not limited to, cholesterol, 5'-Vp (5'-vinylphosphonate), antibodies, polysaccharides, sterols, phospholipids, or polypeptides.
[0055] 3'-end conjugation includes, but is not limited to, cholesterol, polyethylene glycol, N-acetylglucosamine derivatives, biotin, polypeptides, phospholipids, and the like.
[0056] Bioconjugation modifications include, but are not limited to, one or more combinations of N-acetylgalactosamine (GalNAc), cholesterol, aptamers, and peptides.
[0057] Sequence-modified isomers include, but are not limited to, isomers introduced by different monomer configurations or obtained by synthetic reactions, including but not limited to isomerism introduced by thiophosphate (R / S) and GNA (R / S).
[0058] According to the above sequence modification principles, siRNA-1 obtained in Example 1 was further modified. Specifically, modified siRNA sequences were synthesized according to the siRNA synthesis method of Example 1 to obtain the modified siRNA molecules shown in Table 3. The modified specific nucleotide monomers are all commercially available. In Table 3, SEQ ID NOs: 9, 11, 13, 15, 17, and 19 represent the sense strand sequences, and SEQ ID NOs: 10, 12, 14, 16, 18, and 20 represent the antisense strand sequences.
[0059] Table 3: Modified siRNA sequences targeting the RANKL gene
[0060]
[0061] Wherein, T represents thymidine deoxynucleotide; G represents guanine deoxynucleotide; C represents cytosine deoxynucleotide; A represents adenine deoxynucleotide; u represents uracil ribonucleotide; g represents guanine ribonucleotide; c represents cytosine ribonucleotide; a represents adenine ribonucleotide; x represents thymidine deoxynucleotide; m represents a 2'-O-methyl modified ribonucleotide (x = a, g, c, or u); * represents a nucleotide with a sulfur atom replacing a non-bridging oxygen atom in the phosphodiester bond (i.e., P=S instead of P=O); X f represents a 2'-fluoro modified deoxyribonucleotide (X = A, G, C or U); (C n x) represents a 2'-0n carbon atom n-alkyl-modified ribonucleotide (x = a, g, c or u), n = 16; (VPx) represents a 5'-E-vinyl phosphate-modified ribonucleotide (x = a, g, c or u).
[0062] Serum stability testing of siRNA
[0063] To multiple 0.2 mL PCR tubes, add 800 ng of each modified siRNA listed in Table 3 (concentration: 260 ng / μL) and 1 μL of fetal bovine serum. Make up to 10 μL with DEPC water. Incubate at 37°C for 0 or 24 hours to obtain serum enzymatic digestion samples. Detect the siRNA content in the serum enzymatic digestion samples by agarose gel electrophoresis at 140 V for 8 minutes.
[0064] like Figure 2 As shown in the figure, by electrophoresis detection, clear bands were visible for siRNA-1-mode2, siRNA-1-mode3, and siRNA-1-mode5 at 0 h and 24 h, indicating that siRNA-1-mode2, siRNA-1-mode3, and siRNA-1-mode5 had good stability.
[0065] Example 3: Verification of the effect of siRNA at the cellular level
[0066] (1) siRNA knockdown experiment on RANKL cell expression
[0067] This example uses the siRNA in Table 3 to verify the knockdown effect of expression at the cellular level.
[0068] Cells were cultured according to the method in Example 1 and transfected with the siRNAs listed in Table 3 at final concentrations of 1 nM, 30 nM, 100 nM, or 200 nM. Cells without siRNA served as the control group. Forty-eight hours after transfection, total RNA was extracted using Trizol, and RANKL mRNA expression levels in each well were measured by RT-qPCR relative to the control group.
[0069] The relative expression levels of RANKL mRNA in HaCat cells are shown in Table 4. At transfection concentrations of 1 nM, 30 nM, 100 nM, or 200 nM, particularly at the low transfection concentration of 1 nM, siRNA-1-mode 2 and siRNA-1-mode 5 significantly knocked down RANKL mRNA expression; siRNA-1-mode 3 only exhibited a limited knockdown effect. Thus, at the cellular level, siRNA-1-mode 2 and siRNA-1-mode 5 targeting the RANKL gene can significantly knock down RANKL gene expression, with a maximum knockdown efficiency of approximately 75%.
[0070] Table 4: Knockdown effect of siRNA on RANKL mRNA expression level
[0071]
[0072] Example 4: Off-target risk assessment of siRNA
[0073] This example detects the off-target risk of siRNA based on the dual-luciferase reporter gene assay system plasmid vector psiCHECK™-2 Vector (purchased from Promega, Catalog No. 8021). The psiCHECK™-2 Vector plasmid vector contains Renilla luciferase (hRluc) and firefly luciferase (hluc+) genes.
[0074] The target gene fragment is inserted downstream of the Renilla luciferase gene, so that the target gene and Renilla luciferase co-express mRNA. The mRNA is then silenced with siRNA. The expression of Renilla luciferase will also be affected, while the expression of firefly luciferase will not be affected by siRNA. Therefore, the binding stability of the used siRNA and the target gene is determined by detecting the ratio of the fluorescence intensity of Renilla luciferase and firefly luciferase to indirectly assess the off-target risk.
[0075] (1) Design and synthesis of target gene fragments
[0076] like Figure 3 As shown in the plasmid map, due to the psiCHECK™-2 Vector, HkDJ The downstream of the target gene contains XhoI and NotI restriction sites, and the target gene sequence is designed to contain XhoI (recognizing C^TCGAG) and NotI (recognizing GC^GGCCGC) restriction sites and protective bases at both ends, and contains four tandem siRNA-1 antisense strand seed region sequences (uaucaua) complementary to the target gene sequence (ATAGTAT). The target gene sequence information is as follows:
[0077] Forward sequence (5'-3'):
[0078] CCGCTCGAGATAAACAAGGTTTGACATCAATCTAGCTATATCTTTAAGAATGATAAACTCATAGTATATAATATTACATAAATAAAACATAGTATATAATATTACATAAAAAACATAGTATAATATTACATAAAATAAAACATAGTATAGACATTGGTGAGGAAAAATCCTTTGGCCGTTTCCAAGATCTGACAGTGCAGCGGCCGCATTCTTAT (SEQ ID NO: 21)
[0079] Reverse sequence (3'-5'):
[0080] GGCGAGCTCTATTTGTTCCAAACTGTAGTTAGATCGATATAGAAATTCTTACTATTTGAGTATCATATATTATAATGTATTTATTTTGTATCATATATTATAATGTATTTATTTTGTATCATATATTATAATGTATTTATTTTGTATCATATCTGTAACCACTCCTTTTTAGGAAACCGGCAAAGGTTCTAGACTGTCACGTCGCCGGCGTAAGAATA (SEQ ID NO: 22)
[0081] (2) Recombinant plasmid construction and extraction
[0082] The psiCHECK™-2 Vector and target gene sequence were digested with XhoI and NotI, respectively, and then recovered using a gel extraction kit. The fragments were ligated with T4 DNA ligase, and the ligated product was transformed into DH5α competent cells. The cells were then plated on LB plates containing ampicillin and cultured overnight. Single colonies were selected for colony PCR verification of positive transformants, cultured, and large-scale plasmid extraction was performed. The extracted plasmids were sequenced and used after sequencing.
[0083] (3) Transfection of recombinant plasmid into 293T cells
[0084] 293T cells were seeded in 96-well plates and cultured overnight at a density of 3000 cells / well. After incubation, the culture medium was discarded and 100 μL of serum-free culture medium containing various transfection concentrations of siRNA (siRNA-1-mode2, siRNA-1-mode3, siRNA-1-mode5), 0.3 μL of Lipofectamine 3000 (purchased from Thermofisher), or 0.1 μg of psiCHECK™-2 Vector was added to achieve final siRNA transfection concentrations of 0.005, 0.05, 0.5, 5 nM, and 50 nM, respectively. One hour later, an equal volume of 100 μL of complete culture medium supplemented with 20% (v / v) serum was added. Three replicates were set for each concentration. The cells were cultured for another 24 h. After the culture was completed, the culture medium was discarded and 100 μL of reporter gene cell lysis buffer was added to each well for complete lysis. The cells were then centrifuged at 10,000-15,000 g for 3-5 min, and the supernatant was used for assay. A negative control group was also established in which the same concentration of siSCR was used instead of each siRNA for transfection. The siSCR is a nonsense nucleic acid with no homology to the target gene or mammalian gene and will not specifically bind to or interact with mRNA or other nucleic acid molecules in the cell. The sense strand sequence is uucuccgaacgugucacguTT; the antisense strand sequence is acgugacacguucggagaaTT).
[0085] (4) Sample testing
[0086] The dual-luciferase reporter gene assay kit (purchased from Beyotime, product number RG027) was used to prepare the firefly luciferase assay reagent and the Renilla luciferase assay working solution according to the instructions.
[0087] Take 100 μL of each supernatant sample from step (3), add 100 μL of firefly luciferase detection reagent, mix well, and measure the fluorescence intensity using a microplate reader; use a mixture of 100 μL of reporter gene cell lysate and 100 μL of firefly luciferase detection reagent as a control. After the test, add 100 μL of Renilla luciferase detection working solution, mix well, and measure the fluorescence intensity again.
[0088] Both fluorescence intensities are measured in RLU (relative light units). Using firefly luciferase as an internal reference, the RLU value corresponding to Renilla luciferase is divided by the RLU value corresponding to firefly luciferase. The resulting ratio is recorded as relative luciferase activity and is used to compare the degree of target reporter gene activation between different samples.
[0089] The relative luciferase activity of each siRNA is as follows Figure 4At final transfection concentrations of 0.005, 0.05, 0.5, 5 nM, and 50 nM, the relative luciferase activities of the three modified siRNAs were significantly lower than those of the negative control group (siSCR), indicating that the modified siRNAs bind more stably to the target gene through the seed region sequence, significantly reducing the off-target risk compared to unmodified siRNAs.
[0090] Example 5: Preparation of LNP-siRNA
[0091] In this example, based on the siRNAs in Table 1 or Table 3, LNP-siRNAs were prepared according to the method of steps S1 to S4 in Example 2 of patent application CN119979543A. The obtained LNP-siRNAs had a good particle size, uniform particle distribution (PDI <0.1), and a high encapsulation efficiency (>90%).
[0092] Example 6: In vivo efficacy of LNP-siRNA
[0093] In this example, the LNP-siRNA-1 mode 2 prepared in Example 5 was used to conduct an in vivo efficacy study in rats.
[0094] Eighteen female Wistar rats weighing approximately 100-140 g were purchased and acclimated for 7 days. Three groups, each consisting of six rats, were divided into control, model, and experimental groups. Following the acclimation period, the model and experimental groups were treated with the collagen-induced arthritis (CIA) model. The inducing agent was injected subcutaneously at the base of the rat's tail to induce rheumatoid arthritis, producing key symptoms such as bone destruction and synovitis. Approximately five days after modeling, rheumatoid arthritis symptoms, such as joint redness and swelling, began to appear in all four limbs. The experimental group received a subcutaneous injection of 0.9 mg / kg of LNP-siRNA-1 mode 2 on days 5, 8, and 11 after modeling. Body weight, arthritis score, and paw volume were measured from the beginning of the acclimation period. Arthritis scoring was based on a scale of 0 to 4, with a maximum score of 4 for each limb and 16 for each animal, depending on the severity of the lesion (redness, swelling, and joint deformity). Scoring criteria are as follows: 0, no redness or swelling; 1, mild redness or swelling of the midfoot (tarsal bones) or ankle joint; 2, mild redness or swelling from the ankle joint to the midfoot (tarsal bones); 3, moderate redness or swelling from the ankle joint to the metatarsal joint; 4, severe redness or swelling from the toes or fingers to the ankle joint or wrist joint. Figures 5 to 7 As shown in the figure, * represents a significant difference compared with the model group, p < 0.05; *** represents a significant difference compared with the model group, p < 0.001.
[0095] Depend on Figure 5 It can be seen that there is no significant difference in body weight between the experimental group and the model group, indicating that LNP-siRNA-1 mode2 does not affect the changes in rat body weight and does not bring about obvious adverse reactions. Figure 6 It can be seen that the arthritis score of the experimental group was significantly lower than that of the model group. It can be seen that subcutaneous injection of LNP-siRNA-1 mode2 can significantly reduce the severity of CIA-induced arthritis. Figure 7 It can be seen that the foot volume of the experimental group was significantly lower than that of the model group. It can be seen that subcutaneous injection of LNP-siRNA-1 mode2 can significantly alleviate the limb swelling caused by CIA-induced arthritis.
[0096] As can be seen from the above examples, the siRNA targeting the RANKL gene provided by the present invention has strong stability and significantly reduced off-target risk after the introduction of modifications; it can achieve a significant reduction in RANKL mRNA expression levels at the cellular level at a transfection concentration of nM in vitro; and its LNP formulation can significantly reduce the severity of arthritis and significantly alleviate arthritis-induced limb swelling in vivo. It can be seen that based on its significant silencing effect on RANKL gene expression, it has great application value in the treatment of arthritis and bone diseases, especially for the treatment of orthopedic diseases closely related to the RANKL gene, such as osteoarthritis, rheumatoid arthritis, psoriatic arthritis, bone damage, osteoporosis, bone destruction, and synovitis.
Claims
1. A small nucleic acid targeting the RANKL gene, characterized in that: The small nucleic acid comprises a sense strand and an antisense strand, the nucleotide sequence of the sense strand is shown in SEQ ID NO: 1, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:
2.
2. The small nucleic acid targeting RANKL gene according to claim 1, wherein The small nucleic acid comprises a modification, wherein the nucleotide sequence of the modified sense strand is SEQ ID NO: 11, and the nucleotide sequence of the modified antisense strand is SEQ ID NO: 12; or, the nucleotide sequence of the modified sense strand is SEQ ID NO: 17, and the nucleotide sequence of the modified antisense strand is SEQ ID NO:
18.
3. Use of the small nucleic acid targeting the RANKL gene according to claim 1 or 2 in the preparation of a medicament for treating an orthopedic disease or condition, wherein the orthopedic disease or condition is selected from one or more of osteoarthritis, rheumatoid arthritis, psoriatic arthritis, osteoporosis and synovitis. 4 . A method for preparing the small nucleic acid targeting the RANKL gene as claimed in claim 1 or 2 , comprising synthesizing nucleotide monomers into the small nucleic acid.
5. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises a therapeutically effective amount of the small nucleic acid targeting the RANKL gene according to claim 1 or 2, and a pharmaceutically acceptable carrier.
6. The pharmaceutical composition according to claim 5, wherein The carrier is LNP.
7. Use of the pharmaceutical composition according to claim 5 in the preparation of a medicament for treating an orthopedic disease or condition, wherein the orthopedic disease or condition is selected from one or more of osteoarthritis, rheumatoid arthritis, psoriatic arthritis, osteoporosis and synovitis.
Citation Information
Patent Citations
Small nucleic acid targeting androgen receptor as well as pharmaceutical composition and application thereof
CN119979543A
A novel bone mass increasing agent
CN101772351A
Application of Semaphorin 4D in preventing and treating bone metabolic diseases
CN104127862A