Polyguanine DNA tetrahedral nano-carrier as well as preparation method and application thereof

Abstract

The invention relates to a polyguanine DNA tetrahedral nano-carrier as well as a preparation method and application thereof, and belongs to the technical field of biology. The invention aims to overcome the defects of existing DNA tetrahedrons in the aspects of targeted delivery efficiency and cell specific uptake. A DNA tetrahedral structure formed by annealing four single-stranded DNAs is constructed, and polyguanine is modified on the surface of a tetrahedron through complementary base pairing, so that the polyguanine DNA tetrahedral nano-carrier is formed. The carrier significantly enhances the uptake of DNA tetrahedrons by macrophages, and improves the targeted delivery efficiency. The nano-carrier disclosed by the invention can efficiently target macrophages, is used for treating diseases such as acute respiratory distress syndrome and the like, reduces release of inflammatory factors and relieves lung inflammation, and has a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a polyguanine DNA tetrahedron nanocarrier, a preparation method thereof and an application thereof. Background Art

[0002] Acute Respiratory Distress Syndrome (ARDS) is a severe lung disease, usually caused by external stimuli or endogenous etiologies, characterized by acute lung injury and respiratory distress. Clinical treatments for ARDS include mechanical assisted ventilation, hormones, bronchodilators, antibiotics, etc., but there is a lack of specific treatment, and there is no specific drug targeting the etiology that can effectively reverse the disease process. The core aspect of its pathogenesis involves an inflammatory cytokine-driven cytokine storm, and these inflammatory cells include monocytes-macrophages recruited from the blood to the lungs. Monocytes are innate immune cells derived from the bone marrow and continuously released into the circulatory system. They have high plasticity. When tissue inflammation occurs, damaged tissues release pro-inflammatory cytokines and chemokines, which can recruit monocytes to migrate from the blood to the inflamed site. There, monocytes further differentiate into various monocyte-derived cells to replace resident tissue macrophages, promoting the inflammatory response or the resolution of inflammation.

[0003] DNA nanotechnology has shown great potential in the field of drug delivery due to its precise structure design ability, good biocompatibility and programmability. Among them, DNA tetrahedron (TDN), as a simple three-dimensional nanocarrier, has become a research hotspot due to its stable spatial structure, high cell uptake efficiency and low toxicity. However, existing DNA tetrahedrons still have significant limitations in terms of targeted delivery efficiency and cell-specific uptake, especially the targeting strategy for highly phagocytic cells such as macrophages urgently needs to be broken through. Using nano-drugs to target and intervene macrophages is an important strategy for treating ARDS. Nano-drugs targeting macrophages include passive targeting and active targeting. Passive targeting is one of the important strategies for nano-drug targeted therapy and is a non-specific targeting method that does not require specific targeting molecules and relies on the physical properties of nano-drugs (such as size, shape and charge). Active targeting relies on specific molecular recognition and has higher efficiency than passive targeting. However, there are currently few identified molecules specifically expressed on the surface of macrophages, including CD206, Folate receptor, SIRPα, M2pep. However, the above active targeting strategies have disadvantages such as complex synthesis, high cost and low efficiency.

[0004] CN117050127A proposes a pH-responsive DNA tetrahedron based on a C-rich sequence. By introducing a cytosine-rich (C) sequence (with a cytosine proportion of 30 - 80%) into the four single strands, this carrier can rapidly disintegrate and release anti-cancer drugs in a weakly acidic environment (pH 5.0 - 6.0), enhancing the targeting ability in the tumor microenvironment. However, such a design relies on a passive response mechanism and is difficult to achieve active targeting of specific cells (such as macrophages). In addition, the i-motif structure formed by the C-rich sequence may limit its interaction with biomolecules (such as complement proteins), affecting the drug delivery efficiency.

[0005] CN118421621A discloses a crab-shaped DNA tetrahedron (CDT) that dynamically targets mRNA through an extended PolyT linker and a variable recognition segment, and has been successfully applied to the treatment of prostate cancer. By leveraging the specific recognition ability of DNA aptamers, this design can interfere with the expression of AR or FOXA1 mRNA in cancer cells. However, the advantages of this structure are limited to nucleic acid drug delivery and do not involve the loading of small molecule or polypeptide drugs; the functionalization modification achieved by extending the single-strand ends may increase the structural complexity and reduce the stability in serum, thus limiting its application as a general-purpose carrier.

[0006] Although conventional DNA tetrahedron nanocarriers have basic delivery capabilities, they have deficiencies in the following aspects: Limited targeting: Relying on passive diffusion or simple modification, they cannot efficiently target specific cells (such as macrophages at the inflammation site); Poor serum stability: Prone to being recognized and cleared by the complement system, resulting in a short circulation time; Insufficient uptake efficiency: Especially in a complex physiological environment, the efficiency of entering target cells is significantly reduced. Summary of the Invention

[0007] In view of this, one object of the present invention is to provide a polyguanine DNA tetrahedron nanocarrier, another object is to provide a preparation method of the polyguanine DNA tetrahedron nanocarrier, and a third object is to provide the application of the polyguanine DNA tetrahedron nanocarrier in the preparation of a drug carrier.

[0008] To achieve the above object, the present invention provides the following technical solutions:

[0009] The present invention provides a polyguanine DNA tetrahedron nanocarrier, which is composed of the following components: DNA tetrahedron: A DNA tetrahedron structure formed by annealing four single-stranded DNAs;

[0010] Polyguanine: Polyguanine is modified on any three vertices of the surface of the DNA tetrahedron through base complementary pairing;

[0011] The molar ratio of the polyguanine to the DNA tetrahedron is 3:1;

[0012] Preferably, the nucleic acid sequence of the polyguanine is as shown in SEQ ID NO:5.

[0013] Preferably, the nucleic acid sequences of the four single-stranded DNAs are as shown in SEQ ID NO:1-SEQ ID NO:4.

[0014] Furthermore, a method for preparing a polyguanine DNA tetrahedron nanocarrier comprises the following steps:

[0015] (1) Anneal the four single-stranded DNAs in a TAE-Mg 2+ buffer solution. The annealing program is 95°C for 5 minutes, 65°C for 30 minutes, 50°C for 30 minutes, 37°C for 30 minutes, and 22°C for 30 minutes to form the DNA tetrahedron.

[0016] (2) Mix polyguanine with the DNA tetrahedron obtained in step (1) at a molar ratio of 3:1 and incubate at 37°C for 30 minutes to obtain the polyguanine DNA tetrahedron.

[0017] Furthermore, the application of the polyguanine DNA tetrahedron nanocarrier in the preparation of a drug carrier;

[0018] Furthermore, the application of the polyguanine DNA tetrahedron nanocarrier in the preparation of a drug targeting macrophages;

[0019] Furthermore, the application of the polyguanine DNA tetrahedron nanocarrier in the preparation of a drug for treating acute respiratory distress syndrome;

[0020] The drug further comprises TNF-α siRNA, and the sequence of the TNF-α siRNA is as shown in SEQ ID NO:6.

[0021] The beneficial effects of the present invention are as follows:

[0022] In the present invention, polyG significantly enhances the uptake of DNA tetrahedron by macrophages, with an enhancement factor of about 7.6 times. The mechanism of polyguanine DNA tetrahedron targeting macrophages is clarified. Under serum-free conditions, polyguanine mainly binds to scavenger receptor A (SR-A) on the surface of macrophages; under serum-containing conditions, polyguanine binds to scavenger receptor A (SR-A) and complement receptor on the surface of macrophages. The polyguanine DNA tetrahedron nanocarrier drug of the present invention efficiently targets macrophages and is used in the preparation of drugs for treating diseases such as acute respiratory distress syndrome, reducing the release of inflammatory factors, alleviating lung inflammation, and having good application prospects.

[0023] Other advantages, objects, and features of the present invention will be set forth in part in the following description, and in part will be obvious to those skilled in the art upon examination of the following, or may be learned by practice of the present invention. The objects and other advantages of the present invention may be realized and attained by the means of the instrumentalities and combinations particularly pointed out hereinafter. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to make the objects, technical solutions, and advantages of the present invention more clear, the present invention will be described in detail with reference to the accompanying drawings, where:

[0025] Figure 1 For the synthesis of polyguanine DNA tetrahedron. (A) PAGE analysis of polyguanine DNA tetrahedron (TET PolyG ). Lane 1: T1, Lane 2: T1:T2 = 1:1, Lane 3: T1:T2:T3 = 1:1:1, Lane 4: T1:T2:T3:T4 = 1:1:1:1, Lane 5: T1:T2:T3:T4:polyG = 1:1:1:1:3. The PAGE gel results show an increase in molecular weight after adding the polyG strand. (B) Dynamic light scattering (DLS) data of TET PolyG . The DLS results show an increase in the particle size of TET PolyG ( Figure 1 B).

[0026] Figure 2 For the enhanced uptake of TET PolyG in RAW264.7 macrophages. (A) Flow cytometry analysis of the uptake of TET PolyG by RAW264.7 macrophages after incubation in HBSS for 1 hour. The mean fluorescence intensity (MFI) of the TET PolyG group is 7.6 times higher than that of the TET group. (B) Flow cytometry analysis comparing the uptake of DNA tetrahedron (TET) and TET PolyG by RAW264.7 in HBSS and 10% mouse serum. In the presence of serum medium, the promotion efficiency is lower than that in the absence of serum medium. Compared with the serum-free condition, it decreased by 21.0% in RAW264.7. (C) Confocal laser scanning microscope images showing the uptake of TET PolyG by RAW264.7 macrophages after incubation for 1 hour. The nucleus is stained with DAPI. The cytoskeleton is stained with phalloidin. Scale bar: 10 μm. The confocal results are the same as the flow cytometry results.

[0027] Figure 3 For the mechanism of polyG promoting macrophage uptake of TET. (A) TET PolyGCD spectra. The results showed that when the number of guanines was greater than or equal to 9, a peak was observed at 265 nm and a valley at 240 nm, indicating the formation of G-quadruplexes. (B) After exposure to chemical inhibitors in a serum-free environment to inhibit interactions with cell surface receptors, the uptake of RAW264.7 macrophages was quantitatively analyzed. Specifically, Fc receptor (FcR) blockade was used to inhibit Fc receptors, CD44 receptor (CD44R) blockade was used to block CD44 receptors, trypan blue was used to inhibit complement receptors (CRs), and SR-A blockade was used to inhibit class A scavenger receptors. The results showed that in the absence of serum, blocking SR-A significantly reduced the enhancement of polyguanine. (C) After exposure to chemical inhibitors in a 10% mouse serum environment to inhibit interactions with cell surface receptors, the uptake of RAW264.7 macrophages was quantitatively analyzed. In the presence of serum, blocking complement receptors or SR-A reduced the enhancement of polyguanine. In addition, the combination of blocking complement receptors and SR-A reduced the enhancement more significantly than blocking either receptor alone. (D) Schematic diagram of the mechanism by which polyG enhances macrophage uptake of TET in serum-free and serum environments. In the absence of serum, the mechanism by which polyguanine promotes macrophage uptake of TET involves specific binding of polyguanine to SR-A on the macrophage surface, thus promoting phagocytosis. In the presence of serum, the mechanism by which polyguanine promotes macrophage uptake of TET is related to SR-A and CR on the macrophage surface. (E) TET PolyG was fluorescently labeled with Cy5 and then incubated in 10% mouse serum for 30 or 60 minutes. After centrifugation, images were taken using the Cy5 channel of the imaging device. TET polyG groups showed significant precipitation at the bottom of the centrifuge tube, while the TET group did not show significant precipitation, indicating that TET PolyG enriched more serum proteins. (F) Quantitative analysis of the amount of protein bound to TET PolyG after incubation in 10% mouse serum. At 30 minutes, the protein enriched by TET PolyG was 6.2-fold higher than that of TET. At 60 minutes, the protein enriched by TET PolyG was 8.8-fold higher than that of TET. (G-I) Pie charts showing the relative concentration ratios of complement factors. In the TET group, after 30 minutes of incubation with serum, complement C3 accounted for 39.7% of the complement protein concentration. In the TET PolyG group, after 30 minutes of incubation with mouse serum, the proportion of C3 in the complement protein concentration was 56.0% ( Figure 3 H), and after 60 minutes of incubation, this proportion reached 61.9% ( Figure 3 I), indicating that TET PolyGThe concentration of C3 in the group increased.

[0028] Figure 4 For the in vivo distribution after tail vein injection of TET carrying siRNA PolyG (siTET PolyG ). (A) Schematic diagram of the experimental design. First, PBS or LPS (50 μL, 5 mg kg -1 ) was injected into the lungs through a pulmonary quantitative nebulizer. 3 hours later, 200 μL of siTET PolyG -Cy5 was injected via the tail vein. (B) Fluorescence imaging of major organs of ALI mice taken at different time intervals. At 0.5 hours after the TET group, a large amount of TET accumulated in the liver and kidneys, while the deposition amount in the lungs was less. (C-D) Fluorescence intensity and quantification of TET PolyG in the lungs at different time intervals. The fluorescence intensity in the lungs of the siTETPolyG group increased significantly and was higher than that in the liver and kidneys. When comparing the fluorescence intensity in the lungs at different time points, the fluorescence intensity of the siTETPolyG group was higher than that of the TET group. (E) Flow cytometry analysis of the mean fluorescence intensity (MFI) of TET PolyG in various immune cells in the blood. Analysis of the Cy5 fluorescence intensity of these cells showed that in monocytes, the fluorescence intensity of the siTET PolyG group was 4.6 times that of the TET group.

[0029] Figure 5 For the anti-inflammatory effect of TET PolyG in the ALI mouse model. (A) Timeline of the LPS-induced ALI model. First, 50 μL of LPS (5 mg / kg) or an equal volume of PBS was injected into the trachea. 3 hours later, all treated samples were injected into the mice via the tail vein. Bronchoalveolar lavage fluid (BALF) and lung tissue were collected 24 hours later. (B) Measurement of the protein content in BALF using a BCA protein assay kit. Compared with the PBS group, the siTET PolyG group significantly downregulated the protein level in BALF by approximately half, and the effect was better than that of the siTET group. (C) Representative images of the lungs after EB staining. siTET PolyG significantly reduced the lung permeability. (D) Wet-to-dry weight ratio (W / D weight ratio) of lung tissue in different treatment groups. (E) Quantification of the level of the cytokine TNF-α using an ELISA kit. The TNF-α inflammatory factor in BALF was most significantly reduced in the siTET PolyG group. (F) H&E staining of lung tissue in different treatment groups. Compared with the control group, the LPS challenge group showed severe ALI, accompanied by infiltrating inflammatory cells and thickened alveolar walls. In addition, siTET PolyGCompared with the PBS group, the inflammation was significantly reduced. (G) FCM was used to detect the expression of TNF-α in monocytes in the inflamed lungs. siTET PolyG It can effectively down-regulate TNF-α in monocytes recruited in lung tissue during inflammation. Specific implementation manners

[0030] The following specific examples illustrate the implementation manners of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific implementation manners. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the diagrams provided in the following examples only illustrate the basic concept of the present invention in a schematic manner. Without conflict, the following examples and the features in the examples can be combined with each other.

[0031] Among them, the attached drawings are only for illustrative purposes, showing only schematic diagrams, not physical diagrams, and cannot be understood as a limitation to the present invention; in order to better illustrate the embodiments of the present invention, some components in the attached drawings will be omitted, enlarged or reduced, and do not represent the dimensions of the actual product; for those skilled in the art, it is understandable that some well-known structures and their descriptions in the attached drawings may be omitted.

[0032] In the attached drawings of the embodiments of the present invention, the same or similar reference numerals correspond to the same or similar components; in the description of the present invention, it should be understood that if there are terms such as "upper", "lower", "left", "right", "front", "rear", etc. indicating the orientation or positional relationship, they are based on the orientation or positional relationship shown in the attached drawings, and are only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation. Therefore, the terms describing the positional relationship in the attached drawings are only for illustrative purposes and cannot be understood as a limitation to the present invention. For those of ordinary skill in the art, the specific meanings of the above terms can be understood according to specific circumstances.

[0033] Example 1 Construction of polyguanine DNA tetrahedron

[0034] Nucleic acid strand synthesis:

[0035] 4 single-stranded DNAs and polyguanine (polyG strand) were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the sequences are as follows:

[0036] T1 (SEQ ID NO: 1):

[0037] TCTCAGCCTCTTCATTCCTGCTACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTA;

[0038] T2 (SEQ ID NO:2):

[0039] ATTAGCCGTCTTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCT CGCAT;

[0040] T3 (SEQ ID NO:3):

[0041] ATTAGCCGTCTCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC;

[0042] T4 (SEQ ID NO:4):

[0043] ATTAGCCGTCTATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC;

[0044] Polyguanine (polyG strand) (SEQ ID NO:5):

[0045] GACGGCTAATGGGGGGGGGGGGGG。

[0046] The sequence of TNF-α siRNA is AGCAGGAAUGAAGAGGCUGAGACAU (SEQ ID NO:6)

[0047] DNA tetrahedron preparation:

[0048] Anneal in Tris-Acetic-EDTA-Mg2+ (TAE-Mg2+) buffer, program: 95°C for 5 min, 65°C for 30 min, 50°C

[0049] 30 min, 37°C for 30 min, and 22°C for 30 min.

[0050] Polyguanine DNA tetrahedron nanomaterial preparation: Add polyguanine (polyG strand), the molar ratio of DNA tetrahedron to polyguanine is 1:3, incubate at 37°C for 30 min to prepare the polyguanine DNA tetrahedron nanomaterial.

[0051] Example 2 Polyguanine DNA Tetrahedron Targeting Macrophages

[0052] Extraction of mouse serum: After the mice were anesthetized, blood was collected from the heart. The collected blood was then transferred to an EP tube and stored in a refrigerator at 4 °C for 3 hours. After 3 hours, it was centrifuged at 400 g for 15 minutes at 4 °C to separate the serum. The supernatant was the serum. The serum was stored in a freezer at -80 °C for later use.

[0053] Laser confocal microscopy imaging and flow cytometry: Under the confocal microscope, RAW264.7 cells and MHS cells were pre-cultured in confocal dishes. Then, the cells were treated with TET and TET PolyG After treatment, the cells were washed and fixed with 4% paraformaldehyde for 15 minutes. Finally, the cells were treated with an anti-fluorescence quencher containing DAPI and imaged by confocal fluorescence microscopy. For flow cytometry, RAW264.7 and MHS cells were seeded in 6-well culture plates and treated with TET and TET PolyG After treatment, the cells were digested with cell dispersion buffer and collected. Finally, the cells were washed 3 times with PBS buffer and data was collected using flow cytometry.

[0054] Example 3 Mechanism of guanine-rich DNA tetrahedron targeting macrophages

[0055] Blocking of macrophage surface receptors: 2 μg mL-1 mouse SR-AI / MSR antibody, 5 μg mL-1 Fc blocker, 2 μg mL-1 mouse CD44 antibody, and 1×10-3 M trypan blue were first incubated with the cells for 30 minutes. Then the macrophages were incubated with TET and TET PolyG for 1 hour, and the cells were collected for flow cytometry analysis.

[0056] Separation and quantification of serum proteins: TET and TET PolyG were incubated with 10% mouse serum at 37 °C for 30 minutes and 60 minutes. Unbound proteins were removed by centrifugation at 13,000 rpm for 20 minutes. The proteins bound to TET PolyG were quantified using the BCA assay.

[0057] Protein identification: The enzymatic digestion products were separated by high performance liquid chromatography (HPLC) through a capillary column and subjected to mass spectrometry analysis using a QExactiveHF-X mass spectrometer (ThermoFisher) for a total duration of 60 minutes. After each full scan, 10 fragment spectra (MS2 scans) were acquired. The original files of the mass spectrometry tests were processed using MaxQuant 1.5.5.1 software to search the corresponding database, thereby achieving protein identification and quantitative analysis.

[0058] Example 4 Application of guanine-rich DNA tetrahedron nucleic acid drugs in the treatment of mouse ARDS

[0059] Construction of ALI mouse model: C57BL / 6 mice were purchased from Beijing Laboratory Animal Co., Ltd. (Beijing, China). All animal experiment procedures followed the regulations of the Laboratory Animal Welfare and Ethics Committee of the Third Military Medical University. After anesthesia, 50 μL of LPS (5 mg kg-1) or the same volume of PBS was injected into the lungs of mice through a pulmonary quantitative nebulizer (Yuyan, China). Biodistribution study: TET PolyG was labeled with Cy5. In the ALI model, TET-polyG was injected via the tail vein, and the nucleic acid drug TNF-α siRNA had the sequence AGCAGGAAUGAAGAGGCUGAGACAU (SEQ ID NO: 6).

[0060] And mouse organ images were collected at different time points.

[0061] In vivo targeting ability detection by flow cytometry: TET PolyG was labeled with Cy5. After tail vein injection, mouse heart blood was collected, cells were collected after red blood cell lysis, and stained with viability dyes, CD16 / 32, CD45, CD11b, Ly6G, Ly6C, CD19, and CD3 flow antibodies. Data were collected by FCM and analyzed using FlowJo software.

[0062] Wet-to-dry ratio and pulmonary vascular permeability: Lung tissues were collected and surface blood was removed. The wet weight of the lungs was measured, and then the lungs were dried at 60 °C for 72 hours to determine the dry weight. Then the ratio of wet weight to dry weight was calculated. To evaluate vascular permeability, Evans Blue (50 mg kg-1) was injected via the tail vein, lung tissues were collected and photographed. Then the lungs were immersed in formamide solution and placed in a temperature-controlled chamber at 45 - 50 °C for 72 hours. The supernatant was collected and colorimetric determination was performed at 620 nm using a spectrophotometer.

[0063] Histopathology: Lung tissues were collected, preserved in 4% paraformaldehyde, then paraffin-embedded and stained with hematoxylin-eosin. Images were shown by an EasyScanner optical microscope.

[0064] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the purpose and scope of the present technical solution, and they should all be covered within the scope of the claims of the present invention.

Claims

1. A polyguanine DNA tetrahedron nanocarrier, characterized in that: It is composed of the following components: DNA tetrahedron: A DNA tetrahedron structure formed by annealing four single-stranded DNAs; Polyguanine: Polyguanine is modified on any three tops of the surface of the DNA tetrahedron through base complementary pairing; The molar ratio of polyguanine to DNA tetrahedron is 3:

1.

2. The polyguanine DNA tetrahedron nanocarrier according to claim 1, characterized in that: The nucleic acid sequence of the polyguanine is shown in SEQ ID NO:

5.

3. The polyguanine DNA tetrahedral nanocarrier according to claim 1, characterized in that: The nucleic acid sequences of the four single-stranded DNAs are shown in SEQ ID NO: 1 to SEQ ID NO:

4.

4. A method for preparing the polyguanine DNA tetrahedral nanocarrier according to any one of claims 1 to 3, characterized in that: The preparation steps are as follows: (1) annealing four single-stranded DNAs in TAE-Mg2+ buffer, with the annealing program being 95°C for 5 minutes, 65°C for 30 minutes, 50°C for 30 minutes, 37°C for 30 minutes, and 22°C for 30 minutes to form the DNA tetrahedron; (2) Mixing polyguanine and the DNA tetrahedron obtained in step (1) at a molar ratio of 3:1, and incubating at 37° C. for 30 minutes to obtain the polyguanine DNA tetrahedron.

5. Use of the polyguanine DNA tetrahedron nanocarrier according to any one of claims 1 to 3 in the preparation of a drug carrier.

6. Use of the polyguanine DNA tetrahedron nanocarrier according to any one of claims 1 to 3 in the preparation of a macrophage targeting drug.

7. Use of the polyguanine DNA tetrahedron nanocarrier according to any one of claims 1 to 3 in the preparation of a drug for treating acute respiratory distress syndrome.

8. The use according to claim 7, characterized in that: The drug also includes TNF-α siRNA, and the sequence of the TNF-α siRNA is shown in SEQ ID NO:6.

Images