Rabbit-derived antibody against human TRAIL-R3 protein and application thereof

Abstract

The invention belongs to the technical field of antibody preparation, and particularly relates to an anti-human TRAIL-R3 protein rabbit-derived antibody and application thereof. The amino acid sequences of CDR1-3 on a light chain variable region of the antibody are respectively shown as SEQ ID NO.3-5, and the amino acid sequences of CDR1-3 on a heavy chain variable region of the antibody are respectively shown as SEQ ID NO.8-10. The antibody provided by the invention has good specificity and strong anti-interference capability, can effectively identify TRAIL-R3 protein without specific reaction with other non-target antigens, has a high coincidence degree between a detection result and an actual situation, is beneficial to avoiding false positive or false negative results, improves the accuracy, reliability and signal-to-noise ratio of the detection result, and has a wide application prospect. And the TRAIL-R3 has wide development potential in the development of TRAIL-R3 diagnostic reagents and anti-tumor preparations.

Description

Technical Field

[0001] The present invention relates to the technical field of antibody preparation, and particularly relates to a rabbit-derived antibody against human TRAIL-R3 protein and its application. Background Art

[0002] TRAIL-R3, namely Tumor Necrosis Factor related apoptosis inducing ligand receptor 3 (TRAILR3), also known as CD263, Tumor Necrosis Factor Receptor Superfamily Member 10C (TNFRSF10C) or Decoy Receptor 1 (DcR1), is a glycophosphatidylinositol-anchored cell membrane protein composed of 259 amino acids and belongs to the tumor necrosis factor receptor superfamily. TRAIL-R3 contains an extracellular domain rich in cysteine (Cys) and a transmembrane domain, without an intracellular death domain (DD). This structural feature makes it functionally different from other TRAIL receptors with a complete death domain, such as death receptors TRAIL-R1 (DR4) and TRAIL-R2 (DR5). As a decoy receptor, TRAIL-R3 can bind to Tumor Necrosis Factor related apoptosis inducing ligand (TRAIL). Due to the lack of cytoplasmic DD and the inability to transmit apoptosis signals, the binding opportunity between TRAIL and its functional receptors (such as DR4 and DR5) is reduced, blocking apoptosis induced by death receptors, playing a role in protecting normal cells from TRAIL-mediated cytotoxicity and regulating TRAIL-induced apoptosis.

[0003] Apoptosis is a programmed cell death process. The dysregulation of apoptosis is one of the important causes of tumorigenesis. Cancer cells often evade death by inhibiting the apoptotic pathway. Clinical studies have shown that in many tumor tissues, TRAIL-R3 is often highly expressed, which helps tumor cells develop resistance to TRAIL-induced apoptosis, thereby evading the killing of the body's immune system, promoting the survival, proliferation, and metastasis of tumor cells. The expression level of TRAIL-R3 is often negatively correlated with the survival rate of patients. Tumor cells with high expression of TRAIL-R3 may be more resistant to the treatment of TRAIL and its analogs. For example, in lung cancer and breast cancer, the high expression of TRAIL-R3 is associated with tumor resistance to chemotherapy drugs and poor prognosis. In addition, in autoimmune diseases such as rheumatoid arthritis and systemic lupus erythematosus, the abnormal expression and function of TRAIL-R3 on immune cells may lead to an imbalance in immune cell apoptosis, resulting in the failure to timely eliminate autoreactive immune cells, thereby triggering and exacerbating autoimmune inflammatory responses. Therefore, detecting the expression level of TRAIL-R3 in serum or tissues helps in the early diagnosis, disease monitoring, and prognosis assessment of tumors. On the other hand, based on the role of TRAIL-R3 in tumor cell escape, it has become an important target for tumor treatment. By inhibiting the expression of TRAIL-R3 or by blocking its binding to TRAIL, it is expected to restore the sensitivity of tumor cells to TRAIL-induced apoptosis and enhance the tumor treatment effect.

[0004] Both the detection of the TRAIL-R3 expression level and the targeted treatment strategy rely on the development of its high-performance antibodies. Therefore, obtaining monoclonal antibodies with good biological activity that can efficiently and specifically target and bind to the TRAIL-R3 protein is of great significance for the development of related TRAIL-R3 diagnostic reagents and anti-tumor preparations. Summary of the Invention

[0005] Aiming at the problems in the prior art such as the lack of monoclonal antibodies with high biological activity that can specifically bind to the human TRAIL-R3 protein, the present invention provides a rabbit-derived antibody against the human TRAIL-R3 protein, and further provides the application of the rabbit-derived antibody or its antibody conjugate in the preparation of an immunoassay kit for human TRAIL-R3 protein and provides a related immunoassay kit. To achieve the foregoing objectives, the present invention is specifically realized through the following technical solutions:

[0006] In the first aspect of the present invention, a rabbit-derived antibody against the human TRAIL-R3 protein is provided, which includes a light chain variable region and a heavy chain variable region. The amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region are respectively as shown in SEQ ID NO.3-5, and the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are respectively as shown in SEQ ID NO.8-10.

[0007] Furthermore, the amino acid sequence of the light chain variable region is as shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is as shown in SEQ ID NO.7.

[0008] Furthermore, the amino acid sequence of the antibody light chain is as shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is as shown in SEQ ID NO.6.

[0009] Furthermore, the antibody is a full-length antibody or its antigen-binding region; the antigen-binding region is selected from at least one of Fab fragment, F(ab) 2 fragment, Fv fragment, (Fv) 2 fragment, scFv fragment and sc(Fv) 2 fragment.

[0010] The second aspect of the present invention provides an antibody conjugate, comprising a rabbit-derived antibody against human TRAIL-R3 protein as described above and a detection label linked to the antibody.

[0011] The third aspect of the present invention provides a nucleic acid molecule, a recombinant vector containing the nucleic acid molecule or a host cell containing the nucleic acid molecule, and the nucleic acid molecule encodes a rabbit-derived antibody against human TRAIL-R3 protein as described above.

[0012] Furthermore, the nucleic acid sequence of the antibody light chain variable region is as shown in SEQ ID NO.12 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is as shown in SEQ ID NO.14 or a sequence complementary thereto.

[0013] Furthermore, the nucleic acid sequence of the antibody light chain is as shown in SEQ ID NO.11 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.13 or a sequence complementary thereto.

[0014] The fourth aspect of the present invention provides the use of the rabbit-derived antibody against human TRAIL-R3 protein or the antibody conjugate as described above in the preparation of an immunoassay kit for human TRAIL-R3 protein.

[0015] Furthermore, the immunoassay kit is selected from an enzyme-linked immunosorbent assay kit, an enzyme-linked immunospot assay kit, an immunohistochemistry kit, an immunofluorescence kit, an immunoblot kit or a flow cytometry kit.

[0016] The fifth aspect of the present invention provides an immunoassay kit for human TRAIL-R3 protein, and the kit comprises a rabbit-derived antibody against human TRAIL-R3 protein or an antibody conjugate as described above.

[0017] Furthermore, the kit further includes a fluorescence-conjugated anti-rabbit IgG secondary antibody.

[0018] The advantages and positive effects of the present invention are as follows:

[0019] The antibody of the present invention has good specificity and strong anti-interference ability, can effectively recognize the TRAIL-R3 protein without specifically reacting with other non-target antigens, the detection result has a high degree of conformity with the actual situation, which is beneficial to avoiding the appearance of false positive or false negative results, improving the accuracy, reliability and signal-to-noise ratio of the detection result, and has broad development potential in the development of TRAIL-R3 diagnostic reagents and anti-tumor preparations. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0021] Figure 1 It is a detection result diagram of the immune serum titer after immunizing rabbits with human TRAIL-R3 protein in Example 1 of the present invention;

[0022] Figure 2 It is a flow cytometry detection result diagram of the immune serum binding to human choriocarcinoma cell samples after immunizing rabbits with human TRAIL-R3 protein in Example 1 of the present invention;

[0023] Figure 3 It is a flow cytometry detection result diagram of the immune serum binding to human chronic myelogenous leukemia cell samples after immunizing rabbits with human TRAIL-R3 protein in Example 1 of the present invention;

[0024] Figure 4 It is a map of the rabbit-derived antibody expression vector for constructing anti-human TRAIL-R3 protein in Example 1 of the present invention. From left to right, it is the pRB322 vector pre-carried with the constant region of the antibody light chain and the constant region of the heavy chain;

[0025] Figure 5 It is a flow cytometry detection result diagram of the rabbit-derived antibody against human TRAIL-R3 protein binding to human choriocarcinoma cells and human chronic myelogenous leukemia cell samples in Example 2 of the present invention;

[0026] Figure 6 It is an immunoblot detection result diagram of the rabbit-derived antibody against human TRAIL-R3 protein binding to human choriocarcinoma cell lysate samples in Example 2 of the present invention;

[0027] Figure 7 This is the immunohistochemical detection result diagram of the rabbit - derived antibody against human TRAIL - R3 protein binding to human spleen and human brain tissue section samples in Example 2 of the present invention. Detailed implementation manners

[0028] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below in conjunction with embodiments. The embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0029] Based on the information included in the present invention, those skilled in the art can easily make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties or components, because these embodiments and other descriptions are only for schematically illustrating specific aspects of the present invention. In fact, various changes that can be made by those skilled in the art or related fields to the embodiments of the present invention are all covered within the scope of the appended claims.

[0030] In order to better understand the present invention rather than limit its scope, all numbers representing amounts, percentages and other numerical values used in the present invention should be understood to be modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to different desired properties. Each numerical parameter should be regarded as obtained at least according to the reported significant figures and by the conventional rounding method.

[0031] In addition, it should be noted that, unless otherwise defined, the scientific and technical terms used in the context of the present invention should have the meanings commonly understood by those of ordinary skill in the art.

[0032] The meanings of terms such as "comprise", "include", "contain", "have" and the like are non - restrictive, that is, other steps and other components can be added without affecting the result.

[0033] The term "and / or" should be regarded as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" is regarded as including the following situations: (i) A, (ii) B, and (iii) A and B.

[0034] The terms "rabbit monoclonal antibody", "monoclonal antibody", "rabbit-derived antibody", "rabbit mAb" and similar terms have the same meaning, and unless otherwise specified, all refer to antibodies that specifically bind to human tumor necrosis factor-related apoptosis-inducing ligand receptor 3. The terms "TRAIL-R3", "CD263", "TRAIL-R3 / CD263", "tumor necrosis factor-related apoptosis-inducing ligand receptor 3", "TRAIL receptor 3", "DcR1", "DcR1 / CD263", "TNFRSF10C", etc. have the same meaning. The modifier "rabbit" indicates that the complementarity-determining regions (CDRs) of the antibody are derived from rabbit immunoglobulin sequences.

[0035] An antibody is an immunoglobulin molecule that can specifically bind to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In the present invention, the term "antibody" should be interpreted in the broadest sense and includes different antibody structures, including but not limited to so-called full-length antibodies, antibody fragments, and their genetic or chemical modifications, as long as they exhibit the desired antigen-binding activity. Antibody fragments can be one or more parts or fragments of a full-length antibody that retain the ability of the antibody to specifically bind to the target antigen.

[0036] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). The light chains can be divided into two types, namely κ chain and λ chain; the heavy chains can be classified into five types, namely μ, δ, γ, α and ε chains, and the antibodies are defined as IgM, IgD, IgG, IgA and IgE respectively. The amino acid sequences near the N-terminus of the heavy and light chains vary greatly, while the amino acid sequences of other parts are relatively constant. The regions with relatively large amino acid sequence variations near the N-terminus in the light and heavy chains are called variable regions (V), and the regions with relatively stable amino acid sequences near the C-terminus are called constant regions (C). The variable region of the heavy chain (VH) and the variable region of the light chain (VL) are usually the most variable parts of the antibody and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (HVR) and framework regions (FR). The hypervariable regions are also called complementarity-determining regions (CDR), which are loop structures. The CDRs of the heavy chain and the CDRs of the light chain are closely juxtaposed and cooperate with each other through the FR regions to jointly form a surface that is complementary to the three-dimensional structure of the target antigen or epitope, determining the specificity of the antibody and being the site where the antibody recognizes and binds to the antigen. The FR regions are the more conserved parts of VH and VL. They generally have a β-sheet configuration and are connected by three CDRs that form linker loops. Each VH and VL usually consists of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0037] The constant region of the light chain (CL) and the constant region of the heavy chain (CH) do not directly participate in the binding of the antibody to the antigen, but they exhibit different effector functions, such as antibody-dependent cell-mediated cytotoxicity (ADCC). The lengths of the CLs of different Ig types (κ or λ) are basically the same, but the lengths of the CHs of different Ig classes are different. For example, IgG, IgA and IgD include CH1, CH2 and CH3, while IgM and IgE include CH1, CH2, CH3 and CH4. The amino acid sequences of the constant regions of the heavy and light chains of antibodies are well known in the art and can be obtained by querying the IMGT database.

[0038] The full-length antibody is the most complete antibody molecular structure and has a typical Y-shaped molecular structure. Therefore, in the context of the present invention, "full-length antibody", "complete antibody" and "Y-shaped antibody" have the same meaning and can be used interchangeably.

[0039] An antibody fragment is one or more parts or fragments of a full-length antibody that substantially retain the same biological function or activity as the full-length form. Specifically, the antibody fragment includes at least the same CDR regions as the full-length antibody, and more preferably has the same variable regions, thereby retaining the complete antigen recognition and binding sites and being able to bind to the same antigen as the full-length antibody, especially to the same epitope. In a typical example, antibody fragments include: Fab, F(ab) 2 、Fab’, F(ab’) 2 、Fv、(Fv) 2 、scFv、sc(Fv) 2 , and these antibody fragments can be obtained by conventional techniques in the art.

[0040] (i) Fab: The antigen-binding fragment (Fab) is a monovalent fragment composed of a complete light chain (variable region and constant region) and a part of the heavy chain (variable region and the first constant region). By protease digestion of the full-length antibody, Fab, F(ab’) 2 、Fab’ and other fragments can be obtained. For example, under the action of papain, IgG can be degraded into two Fab fragments and one Fc fragment; under the action of pepsin, IgG can be degraded into one F(ab’) 2 fragment and one pFc' fragment. The F(ab') 2 fragment is further reduced to form two Fab’ fragments. Since Fab has an antigen-binding region and a part of the constant region, it not only has the same antibody-antigen affinity and excellent tissue penetration ability as scFv, but also has a more stable structure.

[0041] (ii) F(ab) 2 : A bivalent fragment containing two Fabs linked by a hinge region disulfide bridge.

[0042] (iii) Fv: The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment and contains only the variable regions. It consists of the variable regions of a light chain and a heavy chain and is a non-covalently bound dimer of a VH and a VL (VH-VL dimer). The three CDRs of each variable region interact to form an antigen-binding site on the surface of the VH-VL dimer, which has the ability to recognize and bind antigens, although the affinity is lower than that of the complete antibody.

[0043] (iv) (Fv) 2 : Consists of two Fv fragments covalently linked together.

[0044] (v) scFv: A single-chain variable fragment (scFv) is an Fv fragment consisting of a single polypeptide chain, which is formed by connecting a heavy-chain variable region (VH) and a light-chain variable region (VL) through a flexible linker (usually composed of 10 - 25 amino acids). It retains the binding specificity of the original antibody to the antigen. In the present invention, the linker only needs to not interfere with the expression of the antibody variable regions connected to its two ends, and there is no particular limitation. Compared with the full-length antibody, scFv has the characteristics of a small molecular weight, so it has higher penetrability and lower immune side reactions.

[0045] (vi) sc(Fv) 2 fragment, which is formed by connecting two heavy-chain variable regions and two light-chain variable regions through a linker or the like.

[0046] In some embodiments, the full-length sequence of the antibody or antibody fragment of the present invention may contain CDR regions and FR regions from rabbit immunoglobulin sequences. In other embodiments, the antibody may contain amino acid residues encoded by non-rabbit immunoglobulin sequences. For example, types such as humanized antibodies and chimeric antibodies are used to reduce the body's rejection reaction while maintaining the required specificity and affinity. The term "chimeric antibody" refers to an antibody in which a part is derived from a specific source or species, while the rest is derived from a different source or species. The term "humanized antibody" is a chimeric antibody with the CDR regions of a non-human antibody such as a rabbit antibody and the FR regions from a human. In some cases, the variable region of the non-human antibody binds to the constant region of the human antibody, such as a human-rabbit chimeric antibody; in other cases, the CDR regions of the non-human antibody bind to the FR regions and constant regions derived from human antibody sequences, that is, the CDR regions of the non-human antibody are grafted onto the human antibody framework (FR) sequence, and this framework sequence is derived from the FR sequences of a single or multiple other human antibody variable regions. In the present invention, the CDR regions in the chimeric antibody or humanized antibody are derived from rabbit CDR regions.

[0047] Terms such as "monoclonal antibody" or "mAb" can be used interchangeably and refer to a homogeneous group of antibodies, that is, except for a small number of possible natural mutations and / or post-translational modifications (such as isomerization, amidation), each antibody constituting the population is the same. "Monoclonal antibodies" are highly specific and show a single binding specificity and affinity for the same or substantially the same epitopes on the antigen. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous group of antibodies and should not be construed as limiting the source or preparation method of the antibody. The antibody can be prepared by a variety of methods, including but not limited to the hybridoma method, phage display method, yeast display method, recombinant DNA method, single-cell screening or single-cell sequencing method.

[0048] The term "specific binding" is a well-known term in the art. A molecule exhibits "specific binding" if it reacts more frequently, more rapidly, for a longer duration, and / or with greater affinity with a specific target antigen or epitope than with other target antigens or epitopes. "Specific binding", also referred to as "preferential binding", does not necessarily require (although it may include) exclusive binding. To make the above objects, features, and advantages of the present invention more apparent and understandable, the following detailed description of specific embodiments of the present invention will be given in conjunction with the accompanying drawings.

[0049] An embodiment of the present invention provides a rabbit-derived antibody against human TRAIL-R3 protein, which includes a light chain variable region and a heavy chain variable region. Both the light chain variable region and the heavy chain variable region include 3 complementarity-determining regions (CDRs), named CDR1, CDR2, and CDR3 respectively. Among them, the amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region are shown as SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5 respectively; the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are shown as SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10 respectively.

[0050] The present invention provides antibody strains that can specifically recognize and bind to human TRAIL-R3 protein, and have good applicability in multiple immunoassay systems, especially immunoblotting, immunohistochemistry, and flow cytometry assay systems. Specifically, in the immunoblotting assay system, the antibody of the present invention can accurately and sensitively detect a single band of TRAIL-R3 in cell lysates and does not specifically bind to other irrelevant antigens; in the immunohistochemistry assay system, the antibody of the present invention accurately locates positive cell populations in tissue samples, has no staining signal in the absence of target antigen and in negative tissues, has strong positive detection signals and low background interference; in the flow cytometry assay system, the antibody of the present invention shows an obvious signal transition on positive cells, and the signal on negative cells that do not express the target antigen is similar to that of the isotype control, and can accurately distinguish positive and negative cell populations. These results indicate that the antibody of the present invention has good specificity and strong anti-interference ability, can effectively recognize TRAIL-R3 protein without specifically reacting with other non-target antigens, and the detection results are highly consistent with the actual situation, which is conducive to avoiding the occurrence of false positive or false negative results, improving the accuracy, reliability, and signal-to-noise ratio of the detection results, and has broad development potential in the development of TRAIL-R3 diagnostic reagents and anti-tumor preparations.

[0051] Optionally, both the light chain variable region and the heavy chain variable region each include 4 framework regions (FRs), and the 4 FRs and 3 CDRs are interleaved in sequence to form the variable region. The amino acid sequence of the light chain variable region (VL) of the antibody of the present invention is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO.7.

[0052] Optionally, the antibody of the present invention further includes a light chain constant region (CL) and a heavy chain constant region (CH). CL and VL form a complete light chain (FL), and CH and VH form a complete heavy chain (FH). The constant regions of antibodies can generally be obtained through public queries. For example, through the IMGT online database (www.imgt.org), search for rabbit IgG gamma C reign to obtain CH, and search for rabbit IgGKappa C reign to obtain CL.

[0053] Specifically, the amino acid sequence of the light chain of the antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6.

[0054] It should be noted that the monoclonal antibody of the present invention can be a full-length antibody (having a typical Y-shaped molecular structure) or the antigen-binding region of the full-length antibody; the antigen-binding region refers to a polypeptide that substantially retains the same biological function or activity as the full-length form. Specifically, the antigen-binding region includes the CDR regions as described above, and more preferably has the variable region as described above, thereby retaining the complete antigen recognition and binding sites and being able to bind to the same antigen as the full-length antibody, especially binding to the same epitope. Optionally, the antigen-binding region is selected from Fab, F(ab) 2 ', Fab', F(ab') 2 ', Fv, (Fv) 2 ', scFv and sc(Fv) 2 and at least one of them. These antigen-binding regions can be obtained by conventional techniques in the art.

[0055] Another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector containing the nucleic acid molecule, or a host cell containing the nucleic acid molecule, and the nucleic acid molecule encodes a rabbit antibody against human TRAIL-R3 protein as described above.

[0056] The nucleic acid molecule can be in the form of DNA (such as cDNA or genomic DNA or synthetic DNA) or RNA (such as mRNA or synthetic RNA). DNA can be single-stranded or double-stranded, and can also be a coding strand or a non-coding strand.

[0057] The sequence of the nucleic acid molecule can be derived from the antibody AA sequence by conventional means such as codon encoding rules. The full-length sequence of the nucleic acid molecule or its fragment can usually be obtained by PCR amplification, recombination or artificial synthesis methods.

[0058] Exemplarily, the nucleic acid sequence of the variable region of the antibody light chain is as shown in SEQ ID NO.12 or a sequence complementary thereto, and the nucleic acid sequence of the variable region of the heavy chain is as shown in SEQ ID NO.14 or a sequence complementary thereto.

[0059] Exemplarily, the nucleic acid sequence of the antibody light chain is as shown in SEQ ID NO.11 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.13 or a sequence complementary thereto.

[0060] Those skilled in the art can understand that due to the degeneracy of the genetic code, nucleic acid molecules different from the above examples can also encode the antibodies of the present invention. Therefore, the nucleic acid molecules of the above examples should not be used to limit the protection scope of the present invention.

[0061] The original vectors for constructing recombinant vectors are various conventional vectors in the art, as long as they can accommodate the nucleic acid molecule. Typical vectors include plasmids (such as pBR322, pUC series, pET series, pGEX series), viral vectors, phages (such as λgt4λB, λ-Charon, λΔz1 and M13), cosmids and minichromosomes. The vector can be a cloning vector (i.e., used to transfer the nucleic acid molecule into a host and multiply it in the host cell) or an expression vector (i.e., containing the necessary genetic elements to allow the nucleic acid molecule inserted into the vector to be expressed in the host cell). The nucleic acid molecule is inserted into a suitable vector to form a cloning vector or an expression vector carrying the nucleic acid molecule, then introduced into the host cell, and cultured under specific conditions to express and obtain the antibody. This is well-known technology in the art and will not be described in detail here.

[0062] The nucleic acid molecules encoding the antibodies FL and FH of the present invention can be inserted into two vectors respectively, which can be introduced into the same or different host cells. When the heavy chain and the light chain are expressed in different host cells, each chain can be separated from the host cell expressing it, and the separated heavy chain and light chain are mixed and incubated under suitable conditions to form the antibody. In some other embodiments, the nucleic acid molecules of the antibodies FL and FH can also be cloned into one vector, and each nucleic acid sequence is connected downstream of a suitable promoter; for example, each nucleic acid sequence encoding the heavy chain and the light chain can be operably connected to different promoters, or the nucleic acid sequences encoding the heavy chain and the light chain can be operably connected to a single promoter, so that both the heavy chain and the light chain can be expressed by the same promoter. The choice of the expression vector / promoter depends on the type of host cell used to produce the antibody.

[0063] The transfection or transformation of the recombinant vector into the host cell is carried out by conventional techniques. When the host is a prokaryote such as Escherichia coli, competent cells capable of taking up DNA are harvested after the exponential growth phase and treated with CaCl 2 method or MgCl 2 treatment; it can also be through microinjection, electroporation or liposome packaging, etc. When the host is a eukaryote, the following DNA transfection methods can be selected: calcium phosphate co-precipitation method, microinjection method, electroporation method, liposome packaging or gene gun bombardment and other methods to achieve gene introduction.

[0064] The host cell can be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells that can be used in the present invention include but are not limited to Escherichia coli (such as DH5α, JM109, BL21, W3110), Bacillus spp. (such as Bacillus subtilis, Bacillus thuringiensis), and Enterobacteriaceae strains (such as Salmonella typhimurium, Serratia marcescens) and Pseudomonas spp. Examples of eukaryotic host cells that can be transformed include but are not limited to yeast, insect cells and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHO DG44, CHO-S, COS-7, 293 series cells, HepG2, Huh7, 3T3, RIN, MDCK and HEK293 cell lines. After obtaining the host cell transfected or transformed with the recombinant vector as described above, it is cultured under suitable conditions, and then the antibody can be expressed, and then separated to obtain the purified antibody.

[0065] In a typical embodiment, the method for preparing the antibody includes, after the heavy chain gene and light chain gene of the antibody are concatenated with a signal peptide, they are respectively loaded on the expression vector pBR322, co-transfected into human renal epithelial cells (293F), the 293F cells are cultured, and the cell culture supernatant is collected and purified to obtain the target antibody strain. The selection of the signal peptide is designed according to the host cell, and the present invention has no special limitation in this regard.

[0066] Another embodiment of the present invention provides the use of the rabbit-derived antibody against human TRAIL-R3 protein or its antibody conjugate as described above in the preparation of a human TRAIL-R3 protein immunoassay kit, and the antibody conjugate includes the rabbit-derived antibody against human TRAIL-R3 protein as described above and a detection label linked to the antibody.

[0067] The application advantages of the rabbit-derived antibody against human TRAIL-R3 protein or its antibody conjugate in the preparation of a human TRAIL-R3 protein immunoassay kit are the same as the advantages of the rabbit-derived antibody against human TRAIL-R3 protein as described above over the prior art, and will not be elaborated here.

[0068] It should be emphasized that the antibodies of the present invention can be used alone or conjugated with a detection label (covalently or non-covalently) to form an antibody conjugate. In some embodiments, the antibody of the present invention is used as an antigen-binding (or capturing) antibody that specifically recognizes and binds the TRAIL-R3 protein in a sample to be tested, and then the expression of TRAIL-R3 in the sample is qualitatively or quantitatively detected by analyzing the signal of the detection label conjugated thereto; in other embodiments, the antibody against the TRAIL-R3 protein (as a primary antibody or a capturing antibody) is not labeled, but the detection label is conjugated to a secondary antibody (as a detection antibody) or other molecules that can bind to the primary antibody. For example, if the anti-TRAIL-R3 antibody is a rabbit IgG antibody, then the secondary antibody can be an anti-rabbit IgG antibody. Thus, by analyzing the change in the signal of the detection label generated after the secondary antibody specifically binds to the antibody of the present invention, the qualitative or quantitative detection of TRAIL-R3 is achieved, such as the multiple detection systems established in Example 2 below of the present invention.

[0069] The detection label is used to generate a recognizable signal change to identify the antibody of the present invention or its secondary antibody according to the signal change, and then the expression of the TRAIL-R3 antigen in the sample to be tested is identified through the specific reaction of antigen and antibody. The detection label includes but is not limited to: biotin, fluorescent dyes (such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride), fluorescent proteins (such as allophycocyanin, phycoerythrin, PerCP, and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies, or combinations thereof.

[0070] The above-mentioned immunoassay methods include but are not limited to: Enzyme linked immunosorbent assay (ELISA), Enzyme-linked Immunospot (ELISPOT), Immunohistochemistry (IHC), Immunofluorescence (IF), Western blot (WB), Immunoprecipitation (IP), and Flow Cytometry (FC).

[0071] Based on the same inventive concept, the embodiments of the present invention also provide a kit for immunoassay of human TRAIL-R3 protein, which includes the rabbit-derived antibody against human TRAIL-R3 protein or its antibody conjugate as described above.

[0072] Optionally, the kit is an enzyme-linked immunosorbent assay kit, an enzyme-linked immunospot kit, an immunohistochemistry kit, an immunofluorescence kit, an immunoblot kit or a flow cytometry kit.

[0073] Preferably, the kit is an immunoblot kit, an immunohistochemistry kit or a flow cytometry kit, and the kit further includes a fluorescently conjugated anti-rabbit IgG secondary antibody.

[0074] The present invention will be further described below in conjunction with specific embodiments. For the experimental methods without specific conditions indicated in the following embodiments, they are usually carried out under conventional conditions, such as the conditions described in "Molecular Cloning: A Laboratory Manual (Fourth Edition)" published by Cold Spring Harbor Laboratory, or usually according to the conditions recommended by the manufacturer.

[0075] Example 1 Preparation of Rabbit-derived Antibody Against Human TRAIL Receptor 3 (TRAIL-R3, CD263)

[0076] Immunize a New Zealand white rabbit with CD263 protein. Then, based on single B cell labeling and sorting technology, enrich and sort out B cells that can recognize the target antigen from the rabbit spleen. Culture the isolated B cells in single cell form to obtain monoclonal antibody 1D9. Finally, through genetic engineering recombinant expression technology, first amplify the genes of the naturally paired antibody light chain (VL) and heavy chain variable region (VH) from the B cells secreting the monoclonal antibody by PCR, and insert them in series with the light chain (CL) and heavy chain constant region (CH) into the expression vector, and produce a large amount of monoclonal antibody 1D9 by recombinant expression of the antibody gene. The antibody sequencing work was completed by Wuhan Kingcare Biotechnology Co., Ltd. The amino acid (AA) and nucleotide (DNA) sequences of the antibody are shown in Table 1. In the table, LCDR1-3 represent the complementarity-determining regions CDR1-3 on the light chain, and HCDR1-3 represent the complementarity-determining regions CDR1-3 on the heavy chain.

[0077] Table 1 Sequence Information of Rabbit-derived Monoclonal Antibody 1D9 in this Example

[0078]

[0079]

[0080] 1.1. Antigen preparation: The immunogen used was the polypeptide fragment of human TRAIL-R3 / CD263 protein at amino acids 26-236aa expressed and purified from 293F cells. The full-length amino acid sequence of CD263 protein can be found under Uniprot accession number O14798 or NCBI accession number NP_003832.3, and the gene sequence can be found under NCBI accession number NM_003841.5. The gene sequence corresponding to the 26-236aa polypeptide fragment was constructed into the pBR322 vector, and 293F cells were transformed to express high-quality recombinant Human CD263 mature protein with biological activity. The purity of the obtained protein was greater than 90%.

[0081] 1.2. Animal immunization: Two New Zealand white rabbits were immunized with recombinant human TRAIL-R3 / CD263 protein at 200 μg per rabbit. Before the first immunization, the antigen was mixed with an equal volume of complete Freund's adjuvant (purchased from Sigma) to form an emulsifier, which was injected subcutaneously at multiple points on the abdomen and back of the rabbit. Every 3 weeks after the first immunization, 100 μg of the immunogen was mixed with an equal volume of incomplete Freund's adjuvant (purchased from Sigma) to form an emulsifier, which was injected subcutaneously at multiple points on the abdomen and back of the rabbit for two booster immunizations. After six immunizations, rabbit sera were collected and diluted 1:243000, and the titer against the antigen protein was measured by enzyme-linked immunosorbent assay (ELISA). Rabbits with an OD450nm greater than 0.2 were selected, and a booster immunization was performed by subcutaneous multi-point injection with 200 μg of the immunogen. Three to four days later, the spleens were collected, and the affinity and specific reaction of the final immunization serum after dilution with the test cell samples were measured by flow cytometry (FC).

[0082] The steps for determining the titer of immune serum by ELISA method are as follows: (1) Add NeutrAvidin protein with a final concentration of 2 μg / mL to the ELISA plate at 25 μL / well and coat overnight at 4°C; (2) Add biotinylated TRAIL-R3 polypeptide antigen with a final concentration of 1 μg / mL to the ELISA plate at 25 μL / well and incubate at room temperature for 1 h; (3) Add washing buffer (PBS containing 0.05% (v / v) Tween-20) at 75 μL / well and wash 5 times, then add blocking buffer (PBS containing 1% BSA, 0.5% gelatin and 5% sucrose) at 50 μL / well and incubate at room temperature for 1 h; (4) Repeat the plate washing process in (3) to wash the plate, add serum diluent at 25 μL / well and incubate overnight at 4°C; the test serum starts at 1:1000 and is serially diluted three-fold with dilution buffer (PBS containing 1% BSA), with a total of 8 gradients; (5) Repeat the plate washing process in (3) to wash the plate, add diluted horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (purchased from Jackson ImmunoResearch, catalog number 111-035-045) at 1:5000 at 25 μL / well and incubate in the dark at room temperature for 1 h; (6) Repeat the plate washing process in (3) to wash the plate, add TMB for color development at 100 μL / well, incubate in the dark at 37°C for 10 min, add 0.5 M oxalic acid solution at 100 μL / well to terminate the reaction, measure the absorbance at 450 nm, use pre-immune rabbit serum as a negative control, and the detection system without adding immune serum as a blank control (NC). An immune serum is considered positive when the ratio of the measured value to the control value is ≥2.1.

[0083] The steps for determining the specificity of immune serum by FC are as follows: (1) Disinfect the laminar flow hood by ultraviolet irradiation for 15 - 20 min, turn on the blower for 5 min, and prepare for sterile work; (2) Collect and wash the cells, determine the total cell count, and check that the cell viability is between 90% - 95%; the test cell samples include human choriocarcinoma cells (BEWO) and human chronic myelogenous leukemia cells (K562); (3) Resuspend the cells in PBS buffer to approximately 3×10 6 -5×10 6cells / mL, distribute the cells into a 96-well V-bottom plate at 100 μL / well and wash once with 1×PBS; (4) Dilute the L / D staining solution (Live / Dead staining solution) of the Zombie NIR Fixable Viability Kit from Biolegend (product number 423105) at a ratio of 1:1500, distribute the diluted L / D staining solution into the well plate at 100 μL / well, resuspend the cells in the wells, and react at room temperature for 15 min; (5) Centrifuge at 400 g for 5 min, discard the supernatant, and wash twice with FACS buffer; (6) Distribute 1×IntracelluLar Fixation buffer into the well plate at 100 μL / well, resuspend the cells in each well, and react at room temperature for 30 min; (7) Centrifuge at 400 g for 5 min, discard the supernatant, and wash twice with 1×Permeablization buffer; (8) Distribute the immune serum (as the primary antibody) diluted with 1×Perm buffer into the well plate at 100 μL / well, resuspend the cells in each well, and react at room temperature for 30 min; (9) Centrifuge at 400 g for 5 min, discard the supernatant, and wash twice with 1×Permeablization buffer; (10) Distribute the fluorescent secondary antibody (Fluorescein (FITC) AffiniPure F(ab')2 Fragment Goat Anti-Rabbit IgG, purchased from jackson, product number 111-096-046) diluted with 1×Permeablization buffer (dilution ratio 1:200) into the well plate at 100 μL / well, resuspend the cells in the wells, and react at room temperature for 30 min; (11) Wash twice with 1×Permeablization buffer, then resuspend the cells in each well with 200 μL FACS buffer and store in the dark; (12) Analyze according to the operation of Beckman cytoflex flow cytometer use and maintenance SOP-105-AND-CA-008. Use rabbit IgG isotype control as the isotype control.

[0084] The results of serum titer detection are shown in Figure 1 , where WA-64580D is the project number, and N18742 and N18743 are rabbit numbers. The FC detection results of the immune serum with the positive cells BEWO expressing CD263 protein and the negative cells K562 not expressing CD263 are shown in Figures 2-3, where the abscissa represents the relative fluorescence intensity, the ordinate represents the relative number of cells, the red curve is the blank control, the blue curve is the isotype control, and the yellow curve is the serum to be tested. The serum dilution ratios from left to right are 1:500 and 1:2000 respectively. From Figures 1-3 It can be seen that a strong immune response was generated in the rabbit body during the sixth immunization and the seventh booster immunization. Compared with the rabbit isotype control, the immune serum showed specific binding to positive cells and good fluorescence transition, while there was no specific binding to negative cells and no fluorescence transition. It was determined that high-specificity and high-affinity antibodies that can be used for flow cytometry detection had been produced in the rabbit body, and the spleen cell separation stage could be entered.

[0085] 1.3 Separation of B cells in the spleen and sorting of antigen-specific B cells: For relevant methods, refer to the publicly disclosed patents "Method for efficiently separating single antigen-specific B lymphocytes from spleen cells (Publication No.: CN110016462A, Publication Date: July 16, 2019)" and "An in vitro culture system for B lymphocytes and its application (Publication No.: CN111518765A, Publication Date: August 11, 2020)".

[0086] 1.4 Cloning of genes encoding rabbit monoclonal antibodies: The supernatant of the cultured B cells was identified for positive clones using antigen-coated ELISA. After collecting and lysing the cells of the positive clones, RNA was extracted using the Quick-RNA TM Micro Prep kit (purchased from ZYMO Corporation, product number R1051) and reverse transcribed into cDNA. Using cDNA as a template, the naturally paired rabbit antibody light chain variable region (VL) and heavy chain variable region (VH) genes were amplified by PCR and sequenced. The PCR system included: 4 μL of cDNA, 1 μL of forward primer (10 mM), 1 μL of reverse primer (10 mM), 12.5 μL of 2×Gloria HiFi (from ABclonal, product number RK20717), and 6.5 μL of H 2 O; The PCR program included: 98°C for 30 s, followed by 40 cycles of 98°C for 10 s, 64°C for 30 s, and 72°C for 30 s, and finally 72°C for 5 min. The reaction solution was stored at 4°C. The primer sequences (5'-3') for amplifying the VL and VH genes are shown below, where F and R represent the forward and reverse primers respectively.

[0087] VL-F: tgaattcgagctcggtacccATGGACACGAGGGCCCCCAC (see SEQ ID NO.15);

[0088] VL-R: cacacacacgatggtgactgTTCCAGTTGCCACCTGATCAG (see SEQ ID NO.16);

[0089] VH-F: tgaattcgagctcggtacccATGGAGACTGGGCTGCGCTG (see SEQ ID NO.17);

[0090] VH-R: gtagcctttgaccaggcagcCCAGGGTCACCGTGGAGCTG (see SEQ ID NO.18).

[0091] The amplified DNA products were sequenced to obtain the VL sequence as shown in SEQ ID NO.2 and the VH sequence as shown in SEQ ID NO.7; then the sequence of the constant region was obtained by querying the IMGT online database (www.imgt.org), and the antibody 1D9 with the complete light chain (FL) as shown in SEQ ID NO.1 and the complete heavy chain (FH) as shown in SEQ ID NO.6 was obtained.

[0092] 1.5. Expression and large-scale production of rabbit antibody 1D9: The obtained heavy and light chain genes of the antibody were respectively loaded onto expression vectors. In this example, the light chain constant region (CL) and the heavy chain constant region gene (CH) were pre-inserted into the mammalian expression vector pBR322, and its expression map is shown in Figure 4 , in the figure, pBR322origin and f1origin are replication promoters, Ampcillin is a resistance gene, CMVpromoter is a transcription promoter, SV40PAterminator is a polyadenylation signal, Lightchain constant is the nucleic acid sequence of CL (left figure), and Heavy chain constant is the nucleic acid sequence of CH (right figure). Then, the VL and VH genes with signal peptides upstream were ligated to the expression vector pBR322 carrying the CL and CH genes, which were linearly processed with the restriction enzymes XbaI (955bp) and NheI (949bp) respectively, by homologous recombination to obtain the expression vectors for the complete light chain (FL) and heavy chain (FH) genes. The successful construction of the vector was verified by sequencing.

[0093] To purify the antibody more conveniently, the antibody is secreted and expressed by adding a signal peptide upstream of the VL and VH genes. The signal peptide can be a commonly used antibody expression signal peptide in the art. For example, in the patent "Rabbit monoclonal antibody against human interferon α2 and its application (Publication No.: CN116063487A, Publication Date: May 5, 2023)" and the patent "High-affinity Human IL-5 rabbit monoclonal antibody and its application (Publication No.: CN115819578A, Publication Date: March 21, 2023)", there is a signal peptide "MDTRAPTQLLGLLLLWLPGATF (the encoding gene in this example is atggacacgagggcccccact cagctgctgggtctgctgcttctgtggctgcctggcgctaccttt)" upstream of VL, and a signal peptide "METGLRWLLLVA VLKGVQC (the encoding gene in this example is atggagactgggctgcgctggcttctcctggtggcagttctgaaaggcgtgcagtgt)" upstream of VH. Of course, those skilled in the art can also replace other signal peptides for antibody expression after obtaining the antibody sequence of the present invention. Therefore, the signal peptide sequence is not shown in the antibody sequence in Table 1 of this example.

[0094] The successfully constructed FL and FH expression vectors were co-transfected into 293F cells. After transfection, the cells were cultured for 72 - 96 h to obtain an antibody that recognizes human TRAIL-R3 protein in the culture supernatant. The target antibody was purified from the culture supernatant using protein A affinity gel resin (purchased from Tiandi Renhe, product number SA015100). The purity of the antibody was verified to be ≥95% using 12% polyacrylamide gel electrophoresis (SDS-PAGE). The purified antibody was aliquoted and stored at -20 °C for later use.

[0095] Example 2 Establishment and effect evaluation of an immunoassay method based on rabbit-derived antibody 1D9 against human TRAIL-R3

[0096] In this example, a flow cytometry analysis, immunoblotting, and immunohistochemistry detection system was established for rabbit monoclonal antibody 1D9 to evaluate the application performance of the antibody.

[0097] 1. Establishment of a flow cytometry (FC) detection system

[0098] The FC detection method was the same as that in Example 1, except that the primary antibody was antibody 1D9 and the final concentration of the primary antibody was 2 μg / mL.

[0099] The FC detection results of antibody 1D9 on positive cells BEWO expressing TRAIL-R3 / CD263 protein (left figure) and negative cells K562 not expressing TRAIL-R3 / CD263 protein (right figure) are shown in Figure 5 , where the abscissa in the figure represents the relative fluorescence intensity, the ordinate represents the relative number of cells, the red curve is the negative control, the blue curve is the isotype control, and the yellow curve is antibody 1D9. It can be seen from the figure that there is an obvious difference in fluorescence signal transition between antibody 1D9 on positive and negative samples, that is, there is specific binding on positive cells and no specific binding on negative cells MCF7, which proves that it can specifically recognize TRAIL-R3 / CD263 expressed by cells, can effectively resist interference from cell components, has no cross-reaction with other complex antigen components on cells, and has good specificity and accuracy for detecting TRAIL-R3 / CD263 protein.

[0100] 2. Establishment of immunoblotting (Western blot, WB) detection system

[0101] The cell sample for WB is positive cell BEWO, and the detection steps are as follows: (1) Electrophoresis: Lyse the cells to obtain a protein lysate, and perform electrophoresis using Tris-Glycine-SDS-Buffer conventional electrophoresis solution (purchased from Monad) and 6% SDS-PAGE separating gel; (2) Transfer: Transfer the gel protein band to the NC membrane in an electrotransfer system by the conventional method; (3) Blocking: Place the NC membrane in a TBST blocking solution containing 3% skim milk powder and block at room temperature for 30 min; (4) Primary antibody incubation: Add the antibody prepared in Example 1 (final concentration of primary antibody is 0.5 μg / mL) and incubate at room temperature for 1 h; (5) Secondary antibody incubation: Wash the membrane 3-4 times with TBST, add the secondary antibody working solution (from Abclonal, product number AS014, dilution ratio of secondary antibody 1:5000), and incubate at room temperature for 1 h; (5) Color development: Wash the membrane 3-4 times with TBST, add ECL hypersensitive color development solution, and develop the image.

[0102] The WB detection results of antibody 1D9 on positive cells BEWO are shown in Figure 6 . It can be seen that antibody 1D9 detects a single band of about 65 kDa in the BEWO cell lysate, the band signal is strong, which is consistent with the size of TRAIL-R3 / CD263 protein, showing a positive signal, indicating that the antibody has good recognition specificity and sensitivity for TRAIL-R3 / CD263.

[0103] 3. Construction of immunohistochemistry (IHC) detection system

[0104] The sliced samples include: human spleen tissue slices and human brain tissue slices. The former is a positive sample, and the latter is a negative sample. The detection steps are as follows: (1) Baking the slices: Immerse the paraffin tissue slices baked at a constant temperature of 56 °C for 30 min into the dewaxing solution 1. After 5 min, take out the slices and immerse the paraffin slices successively in the order of dewaxing solution 2, dewaxing solution 3, absolute ethanol 1, absolute ethanol 2, and absolute ethanol 3, placing them in the dewaxing solution for 5 min and in the absolute ethanol for 3 min; then wash the slices with running water for 3 min; The dewaxing solutions 1-3 are purchased from Wuxi Jiangyuan Industrial and Trade Co., Ltd.; (2) Antigen retrieval: High-pressure heat retrieval with 0.01M Tris-EDTA retrieval solution (pH 9.0); (3) Inactivation of endogenous peroxidase: Wash 3 times with PBS buffer, 3 min each time, to remove the buffer on the slices; then immerse the slices in 3% hydrogen peroxide solution and incubate at room temperature for 10 min; (4) Blocking: Wash 3 times with PBS buffer, 3 min each time, then remove the buffer, circle the area to be tested on the slide, and add PBS blocking solution to the area to be tested and incubate at room temperature for 30 min; (5) Incubation with primary antibody: Remove the blocking solution, add the antibody 1D9 dilution solution (final concentration of the primary antibody is 5 μg / mL), and incubate at room temperature for 60 min; Remove the antibody working solution, quickly rinse once with PBS buffer and soak and wash 3 times, 3 min each time; (6) Incubation with secondary antibody: Add the ready-to-use secondary antibody working solution (purchased from Sinot, product number SD3100), and incubate at room temperature for 25 min; Remove the secondary antibody working solution, quickly rinse once with PBS buffer and soak and wash 3 times, 3 min each time; (7) Chromogenic reaction: Add the chromogenic working solution, closely observe the color change under the microscope. After obtaining an appropriate staining intensity, immerse the slices in a large amount of distilled water to terminate the chromogenic reaction, and then wash with running water for 10 min; (8) Counterstaining: Immerse the slightly drained tissue slices in Mayer's hematoxylin for counterstaining for 1 min and wash with running water for 3 min; (9) Blueing: Immerse the slightly drained slices in a saturated aqueous solution of lithium carbonate for blueing for 3 s and wash with running water for 3 min; (10) Dehydration: Immerse the slices in absolute ethanol 2 times, and lift them up and down several times during the immersion. Take them out after 10 s; Dry the slices at a high temperature (54-58 °C); (11) Sealing: Drop an appropriate amount of neutral gum in the center of the slices and cover with a coverslip. The amount of gum added should be appropriate. After covering the coverslip, it should completely cover the tissue and there should be no overflow of the gum. Finally, scan the slices.

[0105] The IHC detection results of antibody 1D9 for positive tissue human spleen (left figure) and negative tissue human brain (right figure) are shown in Figure 7 . TRAIL-R3 / CD263 protein is highly expressed in the spleen, bone marrow, lung, and pancreas, etc., and is not expressed in human brain tissue. Figure 7In the left middle figure, the staining of the positive tissue human spleen sample showed an obvious brownish-yellow color reaction. The darker the color, the stronger the reaction degree. However, there was no obvious clear brownish-yellow color reaction in the negative human brain tissue sample, which proved that antibody 1D9 had good specificity in recognizing TRAIL-R3 / CD263 protein in tissue detection and was not affected by tissue complexity. When used for pathological tissue sample detection, it was beneficial to improve the accuracy and reliability of the detection.

[0106] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A rabbit antibody against human TRAIL-R3 protein, characterized in that: It comprises a light chain variable region and a heavy chain variable region, wherein the amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region are shown as SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, respectively.

2. The rabbit-derived antibody against human TRAIL-R3 protein according to claim 1, characterized in that: The amino acid sequence of the light chain variable region is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

7.

3. The rabbit-derived antibody against human TRAIL-R3 protein according to claim 2, characterized in that: The amino acid sequence of the antibody light chain is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

6.

4. The rabbit-derived antibody against human TRAIL-R3 protein according to claim 1, characterized in that: The antibody is a full-length antibody or an antigen-binding region thereof; the antigen-binding region is selected from at least one of a Fab fragment, a F(ab)2 fragment, a Fv fragment, a (Fv)2 fragment, a scFv fragment and a sc(Fv)2 fragment.

5. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the rabbit antibody against human TRAIL-R3 protein as described in any one of claims 1-4.

6. The nucleic acid molecule according to claim 5, characterized in that The nucleic acid sequence of the antibody light chain variable region is shown as SEQ ID NO.12 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.14 or a sequence complementary thereto.

7. The nucleic acid molecule according to claim 6, characterized in that The nucleic acid sequence of the antibody light chain is shown as SEQ ID NO.11 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO.13 or a sequence complementary thereto.

8. Use of the rabbit antibody or antibody conjugate thereof against human TRAIL-R3 protein according to any one of claims 1 to 4 in the preparation of a human TRAIL-R3 protein immunoassay kit, characterized in that: The antibody conjugate is formed by linking the antibody to a detection label.

9. A human TRAIL-R3 protein immunoassay kit, characterized in that: The invention comprises the rabbit antibody against human TRAIL-R3 protein or its antibody conjugate as claimed in any one of claims 1 to 4, wherein the antibody conjugate is formed by connecting the antibody to a detection marker.

10. The human TRAIL-R3 protein immunoassay kit according to claim 9, characterized in that: The kit is an immunoblotting kit, an immunohistochemistry kit or a flow cytometry kit, and the kit also includes a fluorescence-coupled anti-rabbit IgG secondary antibody.

Images