A fruit body robust type of tricholoma sanguifluum hua8 strain and high-efficiency cultivation technology thereof

Abstract

The present application relates to a Lepista sordida strain and a high-efficiency cultivation technology thereof.The Lepista sordida of the present application has a classification name of Lepista sordida, a strain number of Lepista sordida Hua8, a temporary variety name of "Daxiangmo No.3", is preserved in the China Center for Type Culture Collection (CCTCC) and has a preservation address of No.299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, a preservation number of CCTCC NO:M2025154 and a preservation date of January 15, 2025.The strain has fruiting bodies that are robust, have a neat fruiting, a high conversion rate of head mushroom and strong disease resistance.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbiological technology, in particular to a Lepistasordida strain and a high-efficiency cultivation technology thereof. BACKGROUND

[0002] Lepistasordida is a fungus of the Lepista genus in the Cortinarius family, and is one of rare edible fungi with development potential. The fruiting body has the characteristics of bright color, delicious taste, rich nutrition, and high medicinal value, and is deeply favored by consumers.

[0003] However, Lepistasordida has technical problems in production, such as small fruiting body, unobvious fruiting tide, narrow mycelial growth temperature, and difficult management, which may affect its yield, quality and commercialization process. The present application is based on solving the problems of small Lepistasordida fruiting body, unobvious fruiting tide, and narrow mycelial growth temperature. The cultivation team has carried out wild resource investigation, collection and domestication of new strains of Lepistasordida in Sichuan Province. Through collection of wild Lepistasordida fruiting body, on the basis of systematic research on biological characteristics, culture characteristics and cultivation technology of the isolated strains, a new Lepistasordida strain 'Hua8' with thick stem, large cap, high conversion rate of head tide, high polysaccharide content, high yield, strong disease resistance and wide mycelial growth temperature is obtained. SUMMARY

[0004] The present application aims to provide a Lepistasordida with thick stem, large cap, high nutritional value, high yield, strong disease resistance and wide mycelial growth temperature.

[0005] In order to achieve the above-mentioned application purpose, the present application provides the following technical solutions:

[0006] On the one hand, the present application provides a Lepistasordida strain, characterized in that the classification name of the strain is Lepistasordida, the strain number is Lepistasordida Hua8, the temporary variety name is "Daxiangmo No. 3", the preservation is in China Center for Type Culture Collection (CCTCC), the preservation address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, the preservation number is CCTCC NO: M2025154, and the preservation date is January 15, 2025.

[0007] Further, the ITS sequence of the Lepistasordida Hua8 strain is shown in SEQ ID NO. 3.

[0008] Further, the spores of the Lepistasordida Hua8 strain are colorless, transparent, smooth, cylindrical or oval, with a size of (4.0-7.0) um x (7.0-12.0) um, and the spore print is light pink.

[0009] Further, the mycelium of the Hua8 strain of Volvariella volvacea is light purple and fluffy, and under a microscope, the mycelium is transparent and uniform in thickness, and has lock-like combination; the mycelium grows at a temperature of 3-33℃, and the optimum temperature is 20-25℃.

[0010] Further, the fruiting body of the Hua8 strain of Volvariella volvacea is in clusters or single. The cap is light purple to powder purple, umbrella-shaped to flat, slightly convex in the middle, and has a diameter of 5.1-7.6 cm; the flesh is powder purple, strong and fragrant in taste; the gill is purple, flaky, slightly sparse, and uneven in length; the stipe is thin at the top and thick at the bottom, and the ratio of the thickness of the top to the bottom is 1.48-2.26, the length is 8.9-12.0 cm, the diameter is 0.94-1.80 cm, the base is enlarged, the texture is compact, the growth is bending, and the shape is nearly cylindrical; the surface is the same color as the cap but slightly lighter.

[0011] Further, the growth period of the Hua8 strain of Volvariella volvacea is about 60 days.

[0012] Further, the conversion rate of the Hua8 strain of Volvariella volvacea is 33.5%-38%, and the fruiting body appears in 2-3 tides; after the fruiting body of the previous tide ends, stop spraying water to the soil layer, and after 1 week of cultivation, spraying water can stimulate the fruiting body of the next tide to appear.

[0013] Further, the biological efficiency of the Hua8 strain of Volvariella volvacea is 55%-60%.

[0014] Further, the suitable growth environment of the Hua8 strain of Volvariella volvacea is as follows:

[0015] Temperature: The basidiomycota fungus of Volvariella volvacea is broad-temperature fruiting type. The mycelium grows at a temperature of 3-33℃, and the optimum temperature is 20-25℃; the fruiting temperature range is 8-30℃, and the optimum temperature is 15-26℃. Under natural conditions, the total growth period of the production of the fermentation material in the bag is about 60 days. The normal growth of the fruiting body is not conducive to the normal growth of the fruiting body when the temperature is lower or higher than the growth range.

[0016] Light: During the mycelium growth period, no light is needed. Strong direct light is not conducive to the germination of the mycelium and the differentiation of the fruiting body, and the formation of the primordium needs certain scattered light. During the growth period of the fruiting body, the light intensity is 200-400 lx, and the light is too strong or too weak, and the color of the fruiting body becomes lighter.

[0017] Humidity: The relative humidity of the air during the formation and growth of the fruiting body is 80-90%.

[0018] Air: The mycelium growth needs less oxygen; the fruiting body growth and development need good ventilation.

[0019] Nutrition: grass-rot fungi, mycelium can use glucose and other monosaccharides, protein peptone and other nitrogen sources, and corn cob, straw, soybean stalk, corn stalk and the like can be used as main carbon sources in cultivation, and livestock manure such as cow dung, pig dung or bran, soybean meal, corn meal can be used as nitrogen source, and trace inorganic salts such as potassium dihydrogen phosphate, gypsum and superphosphate are also needed.

[0020] pH: the suitable pH is 6-8.

[0021] In another aspect, the present application provides a cultivation technique of Laccaria laccata, which comprises the following steps:

[0022] 1) Preparation of culture medium

[0023] Corn cob, cow dung, lime and gypsum are mixed to form the culture medium, and the culture medium is subjected to stacking fermentation.

[0024] 2) Bagging and sterilization

[0025] The fermented culture medium is bagged and subjected to high-temperature sterilization.

[0026] 3) Inoculation and culture

[0027] Each bag is inoculated with Laccaria laccata liquid strain or solid strain, and subjected to constant temperature culture (preferably 20-23°C constant temperature culture).

[0028] 4) Bag removal and soil covering

[0029] After the mycelium fills the culture bag, the culture is continued for several days (preferably 8-12 days), the bag is removed and the field is arranged, the bed is arranged and lime is applied before the bag is removed; rice field soil, pine forest soil or vegetable garden soil is selected as the soil covering material, which is pre-wetted to a hand-clumping state and covered with soil, and the soil covering thickness is 3-4 cm.

[0030] 5) Mushroom management

[0031] After soil covering, the film is covered and moisture is maintained, the mycelium crawls to the soil layer, water is sprayed (preferably for 3-5 days), light stimulation is performed after the mycelium is twisted and thickened, and the mushroom management is performed during the mushroom period, the water content of the soil layer is 50%-95%, and the air relative humidity is 60%-90%.

[0032] 6) Harvesting

[0033] The mushroom is round and the edge is slightly involuted, and the mushroom body color is powder purple or light purple, which can be harvested, and large ones are left and small ones are picked.

[0034] Preferably, the weight percentage of each component in the culture medium in step 1) is: corn cob 50-75%, cow dung 20-45%, 1-3% lime, and 1-3% gypsum.

[0035] Further preferably, the weight percentage of each component in the culture medium in step 1) is as follows: corn cob 60-70%, cow dung 25-35%, 1-3% lime, and 1-3% gypsum.

[0036] Preferably, in the application of the L. sordida, the L. sordida is the L. sordida Hua8 strain and its progeny, which is characterized in that: the classification name of the strain is L. sordida, the strain number is L. sordida Hua8, the temporary variety name is "Daxiangmo No. 3", the preservation address is No. 299, Baying Road, Wuchang District, Wuhan City, Hubei Province, China, the preservation number is CCTCC NO: M2025154, and the preservation date is January 15, 2025.

[0037] The application further provides a L. sordida spore, fruiting body or mycelium, which is generated by the aforementioned strain.

[0038] The application further provides a L. sordida stick (or bag), which is generated by the aforementioned strain.

[0039] The application further provides a food or health product or medicine, which contains the aforementioned strain or extract thereof or the aforementioned spore, fruiting body or mycelium.

[0040] The application further provides an ITS sequence for identifying the aforementioned strain, which is shown in SEQ ID NO. 3.

[0041] The application further provides a use of the aforementioned ITS sequence in authenticity or infringement identification of the L. sordida.

[0042] The application further provides an application of the aforementioned strain or extract thereof or the aforementioned spore, fruiting body or mycelium in the preparation of a food or health product or medicine.

[0043] Compared with the prior art, the application has the following advantages:

[0044] The application provides a new L. sordida strain, which has the following characteristics and advantages compared with common existing varieties: thick stem and large cap, high conversion rate of Pholiota nameko, high polysaccharide content, high yield, strong disease resistance, wide mycelial growth temperature, and wide fruiting temperature range. BRIEF DESCRIPTION OF DRAWINGS

[0045] The beneficial effects of the application will be described in detail in combination with the drawings and specific embodiments.

[0046] Figure 1 For spore morphological characteristics, Figure A is Hua8, Figure B is L-2, Figure C is E70, and Figure D is ZD3.

[0047] Figure 2 Spore print morphological characteristics, wherein Figure A is Hua8, Figure B is L-2, Figure C is E70, and Figure D is ZD3.

[0048] Figure 3 Morphological characteristics of mycelium under culture conditions, wherein Figure A is Hua8, Figure B is L-2, Figure C is E70, and Figure D is ZD3.

[0049] Figure 4 Microscopic morphological characteristics of mycelium, wherein Figure A is Hua8, Figure B is L-2, Figure C is E70, and Figure D is ZD3.

[0050] Figure 5 Fruiting and fruiting body morphology of Hua8, wherein Figure A is a Hua8 bag, Figure B is a Hua8 fruiting diagram, and Figure C is a Hua8 fruiting body.

[0051] Figure 6 Fruiting diagram of strains using paddy soil as covering soil, wherein Figure A is Hua8, Figure B is L-2, Figure C is E70, and Figure D is ZD3.

[0052] Figure 7 Fruiting body morphology of strains using paddy soil as covering soil, wherein Figure A is Hua8, Figure B is ZD3, Figure C is E70, and Figure D is L-2. DETAILED DESCRIPTION

[0053] The technical solutions in the embodiments of the present application will be described clearly and completely below. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the scope of protection of the present application.

[0054] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The experimental methods in the following examples are conventional methods, unless otherwise specified. The test materials used in the following examples are commercially available from conventional biochemical reagent stores, unless otherwise specified.

[0055] Example 1: Strain breeding process

[0056] On March 15, 2021, the research group collected umbrella-shaped wild fruiting bodies in Pingchang County, Bazhong City, Sichuan Province, numbered Hua8. The collection site is loamy soil with pH 6. The air temperature at the time of collection was 14-27℃, the altitude was 781 meters, and the wild fruiting bodies were found at the time of collection. The shallow purple, large cap, and wave-shaped opening were found in the tea garden, and there was shade. The Hua8 fruiting bodies were taken back to the laboratory of the Agricultural Science Research Institute of Dazhou City for morphological identification, and inoculated in PDA medium by tissue separation method. Through the continuous purification of the isolated strains, 10 test tube strains (E1-E10) of pure Lepista sordida were obtained. The ITS sequence of the isolated strains was obtained, and the phylogenetic tree was constructed based on the Neighbor-Joining method algorithm. The results showed that E9 was closely related to the Lepista sordida strain, and was separated from the existing strain tree. It was shown that the strain had genetic differences with the existing strain. Combined with the morphological characteristics of the fruiting body, it was determined that the strain was Lepista sordida.

[0057] In the spring of 2021, the original strain and cultivated strain of E1-E10 were produced in the Liujia test base of the Agricultural Science Research Institute of Dazhou City, and the fermentation material was cultivated to grow mushrooms. The 10 test strains and 1 main cultivated strain (E70, main cultivated variety) were compared, and the data of the E9 strain mycelial growth, fruiting body appearance, yield and other agronomic trait indicators were recorded and analyzed. The results showed that E1, E5 and E9 had no significant difference in fruiting body appearance and fruiting period, but had differences in fruiting yield. Further screening and verification tests were carried out in the Beidou Village test base of Luojiang Town, and the three better isolated strains obtained in the preliminary screening were screened to further verify the yield, resistance to impurities and stability of the strains, and to select the target strain. From September 2021 to November 2021, the strains obtained in the preliminary screening were produced and fruiting, and the results were higher than the yield of the main cultivated variety. The conversion rate, fruiting tide, uniformity, single strain weight, stem, cap, biological efficiency, growth cycle and other comprehensive evaluations of the test strains were carried out, and the data were analyzed comprehensively. It was shown that Hua8 was the best strain. Subsequently, the biological characteristics of Hua8 strain were detected and verified in the laboratory, and the antagonistic test was carried out according to the “NY / T1845-2010 Edible Fungus Strain Distinctive Identification Antagonistic Reaction” and the existing strains. Combined with the biological characteristics and fruiting performance of the strain, the results showed that Hua8 strain had high yield of Tricholoma lobayense, thick fruiting body, uniform fruiting, and high temperature resistance, which could be used for subsequent regional tests.

[0058] Combined with the biological characteristics and fruiting performance of Hua8 strain, a new strain of Lepista sordida with high yield of Tricholoma lobayense, thick fruiting body, uniform fruiting, and high temperature resistance was obtained by domestication, named “Daxiangmo No. 3”.

[0059] Example 2 sequence identification of strain Hua8:

[0060] The process comprises the following steps:

[0061] Extraction of fungal genomic DNA: Extracted according to the instructions of the Ezup columnar fungal genomic DNA extraction kit of Pisenlo. The obtained DNA solution was stored at -20℃ for standby.

[0062] The PCR amplification system is 50 μL in total volume, including: genomic template 1 μL, 10×Buffer 5 μL, Taq polymerase 1 μL, dNTP 1.0 μL, ITS1 primer 1.5 μL, ITS4 primer 1.5 μL, and ddH2O to 39 μL.

[0063] The PCR program is as follows: 95℃ for 5 min; 95℃ for 30 s; 58℃ for 30 s; 72℃ for 1 min; 35 cycles of the above temperature and time in turn; and finally 72℃ for 7 min.

[0064] The sequence of the ITS1 primer (forward) is SEQ ID NO. 1: 5'-TCCGTAGGTGAACCTGCGG-3';

[0065] The sequence of the ITS4 primer (reverse) is SEQ ID NO. 2: 5'-TCCTCCGCTTATTGATATGC-3';

[0066] The identification sequence of the strain Hua8 of the application is as follows: SEQ ID NO. 3:

[0067] TCCGGGGCTGTCTACCTGATTTGAGGTCAAAAATGTCATAAATTTGTCCAAGTCAATGGACTGTTAGAAGCTGAACCCCATGTTAAAGCTGCTTCACAACCATGGCGTAGATAATTATCACACCAAAAGCTGGTCCACAAAGGTTCCGCTAATGCATTTAAGAGGAGCCGACTTCTAGAGAAGCCCGCAATAACCTCCACATCCAAGCCAATCCAACTTGCAAAAGCTGAAAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTGTATTAATTTAAAGGCATAAAGCCCATTAATAACATTCTATTACATTCTTATGGGGTATAATAAAAACATAGACTTGAAACACAAGGAAAGCCATGTTTGCACACAGCATTCCTCAAACCGAGTTTCCTCGAGAGTTGTTTCAAATCTACAAAAGGTGCACAGGTGGTAAAAATGGCGCTAGGCGTGCACATGCTCCAAAAAGCCAGCACAACCCAACCAAGTTTATTCAATAATGATCCTTCCGCAGTCCCCCCTATCGGGAAGGGG;

[0068] The ITS sequence of the sequenced result was compared for homology by BLAST on NCBI, and the comparison result was taken as the standard for similarity of 99% or more, the molecular identification of the strain was carried out, and the identification result was Lepista sordida (Lepista sordida).

[0069] The strain isolated in the embodiment was preserved in the China Center for Type Culture Collection (CCTCC) on January 15, 2025, the preservation address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, the preservation number is CCTCC NO: M2025154, and the preservation date is January 15, 2025.

[0070] Example 3 Morphological characteristics and biological characteristics of strain Hua8

[0071] 1. Spores colorless, transparent, smooth surface, cylindrical or oval, size (4.0-7.0) um x (7.0-12.0) um Figure 1 ), spore printing light pink Figure 2 ).

[0072] 2. Mycelium light purple velvet, under the microscope, mycelium transparent, uniform thickness, with lock joint; mycelial growth temperature 3-33℃, optimum temperature 20-25℃ Figure 3 , Figure 4 ).

[0073] 3. Fruit body cluster or single. Cap light purple to purple, umbrella to flat, slightly raised in the middle, diameter 5.1-7.6 cm; flesh purple, strong and fragrant; lamella purple, flaky, slightly sparse, unequal length; stem thin at top and thick at bottom, diameter ratio 1.48-2.26, length 8.9-12.0 cm, diameter 0.94-1.80 cm, base enlarged, flexible, nearly cylindrical; surface color same as cap but slightly lighter Figure 5 , Figure 7 ).

[0074] 4. Growth period

[0075] Growth period is about 60 days.

[0076] 5. Biological efficiency

[0077] Generally 55%-60%.

[0078] 6. Disease resistance

[0079] Mycelial resistance to disease and pests is strong. When the air temperature is continuously higher than 33℃ or lower than 3℃ after sowing, mycelial growth is hindered, and the culture medium is easily infected by penicillium, affecting yield; during the fruiting period, if the air temperature is continuously higher than 30℃, the young mushrooms are easy to die.

[0080] 7. Suitable growth environment

[0081] Temperature: wide temperature mushroom type basidiomycota fungi. Mycelial growth temperature 3-33℃, optimum temperature 20-25℃; fruiting temperature range 8-30℃, optimum temperature 15-26℃. Under natural conditions, the whole growth period of fermented material bag is about 60 days. Temperature lower or higher than the growth range is not conducive to the normal growth of fruiting body.

[0082] Light: during mycelial growth, no light is needed. Strong direct light is not conducive to mycelial germination and fruiting body differentiation, and certain scattered light is needed for primordium formation. During fruiting body growth, light intensity of 200-400 lx is appropriate, and too strong or too weak light will make the fruiting body color lighter.

[0083] Humidity: 80-90% relative humidity of air during fruiting body formation and growth.

[0084] Air: Mycelium growth requires less oxygen; fruiting body growth and development require good aeration.

[0085] Nutrition: It is saprophytic, and the mycelium can utilize monosaccharides such as glucose and nitrogen sources such as peptone. In cultivation, corn cobs, straw, wheat straw, soybean straw, and corn straw can be used as the main carbon source, and livestock manure such as cow dung, pig dung, or bran, soybean meal, and corn meal can be used as the nitrogen source. In addition, trace amounts of inorganic salts such as potassium dihydrogen phosphate, gypsum, and superphosphate are also required.

[0086] pH: The suitable pH is 6-8.

[0087] Example 4: Comparison of strain Hua8 with ‘L-2’, ‘E70 (Daxiangmo No. 1)’, and ‘ZD3’ strains

[0088] In this example, the Hua8 strain of L. drymus was compared with other L. drymus strains ‘L-2’, ‘E70’, and ‘ZD3’ in cultivation. The cultivation methods of edible fungi are mainly divided into mature material cultivation, fermented material cultivation, and raw material cultivation, and different cultivation methods have an impact on the agronomic traits of edible fungi. In this example, the cultivation method used was mature material cultivation, i.e., the fermented material was sterilized and bagged, and then the bag was broken and covered with soil to produce mushrooms. The specific method is described in Example 5. It should be noted that in this example, the cultivation comparison of Hua8, L-2, E70, and ZD3 only differed in the strains themselves, and the rest of the cultivation conditions were consistent.

[0089] The fruiting bodies of Hua8 were single or clustered, the cap was light purple to powder purple, and the umbrella-shaped to flat, slightly raised in the middle, and the water immersion pattern was not obvious. The fruiting bodies of L-2 were clustered, the cap was gray purple to light purple, and the cap was hemispherical to flat, slightly raised in the middle. The cap of E70 was light purple, flat hemispherical, raised in the middle, and the edge showed a water invasion pattern, and the middle was lighter than the edge. The cap of ‘ZD3’ was lotus white, raised in the middle, and the edge showed a water invasion pattern. Figure 6 , Figure 7 The comparison of the descriptions of mycelium and fruiting bodies is shown in Tables 1 and 2.

[0090] The fruiting bodies of Hua8 strain were robust, the cap diameter was 5.1-7.6 cm, the stem length was 8.9-12.0 cm, and the diameter was 0.94-1.80 cm, and the weight of a single plant was 22.13-35.36 g, which was 3.16 times that of L-2, 1.70 times that of E70, and 2.13 times that of ZD3, so the yield was high.

[0091] 2. Mushrooming temperature

[0092] The fruiting temperature range of Hua8 strain is 8-30°C, which is 4°C higher than that of L-2 strain, 5°C higher than that of E70 strain, and 5°C higher than that of ZD3 strain.

[0093] Table 1 Mycelial biological characteristics of the tested strains

[0094]

[0095] Table 2 Comparison of agronomic traits of the tested strains

[0096]

[0097] 3. Biological efficiency

[0098] Under the same cultivation conditions, the biological efficiency of 'Hua8' is 58.50%, the biological efficiency of 'L-2' is 35.18%, the biological efficiency of E70 is 31.61%, and the biological efficiency of ZD3 is 19.06%. Under the same cultivation techniques, the biological efficiency of Hua8 is 1.66 times that of L-2, 1.85 times that of E70, and 3.06 times that of ZD3 (Table 2).

[0099] 4. Fruiting rate

[0100] The fruiting of Hua8 strain is neat, with 2-3 flushes. After the end of the previous flush, stop watering the soil layer, and stimulate the next flush by watering after 1 week of cultivation. The fruiting of L-2 strain is neat, with 4-5 flushes. After the end of the previous flush, stop watering the soil layer, and stimulate the next flush by watering after 1 week of cultivation. The flushes of E70 and ZD3 are not obvious, and continuous management is required from the beginning of fruiting to the end of the fruiting period (about 60 days). Figure 6

[0101] 5. Growth rate

[0102] The growth period of Hua8 is 60 days, and the fruiting body from bud to maturity takes 5-6 days. The growth period of L-2 is about 81 days, and the fruiting body from bud to maturity takes 10-12 days. The growth period of E70 is about 67 days, and the fruiting body from bud to maturity takes about 8-10 days. The growth period of ZD3 is about 65 days, and the fruiting body from bud to maturity takes 8-10 days.

[0103] 6. Quality

[0104] The protein and amino acid contents of Hua8 fruiting body are equivalent to those of E70 and L-2 strains, and are significantly higher than those of ZD3 strain. The crude polysaccharide and selenium contents are significantly higher than those of the other three control strains.

[0105] Table 3 Nutrient content (dry product 200g / sample, 3 replicates)

[0106] ​

[0107] 7. Taste

[0108] Hua8 has better color, aroma, taste, and crispness than L-2, E70, and ZD3. Stir-fry (with only cooking oil and salt), and 10 people were randomly selected to taste it. The fruiting bodies of each strain were scored according to the scoring criteria in Table 4. The scoring results are compared in Table 5.

[0109] Table 4. Fruiting body texture scoring criteria

[0110]

[0111] Table 5. Taste Scoring Results of the Mushrooms with Painted Faces

[0112]

[0113] 8. Resistance to adverse conditions

[0114] Each strain was inoculated onto 50 bags, with 3 replicates. The contamination rate of the bags was calculated, and the comparison of contamination rates is shown in Table 6.

[0115] Table 6 Comparison of Insect Resistance and Contamination Rate of Mushroom 'Painted Face'

[0116]

[0117] 9. Production

[0118] In the autumn of 2024, the *Millettia speciosa* strain was inoculated using a fermentation substrate bagging and sterilization method. Each bag contained 2.0 kg (wet weight), and 30 bags were inoculated using each 750 ml inoculum. Three replicates were set up for each strain. The yield comparison is shown in Table 7.

[0119] Table 7. Comparison of the yield of *Viburnum macrocephalum* (g / bag)

[0120]

[0121] Example 5: Cultivation method of Hua8 mushroom (also known as Flower Face Mushroom).

[0122] 1) Preparation of culture medium

[0123] Culture medium formula: The weight percentage of each component in the culture medium is as follows: corn cob 50-75%, cow manure 20-45%, 1-3% lime, and 1-3% gypsum. Culture medium fermentation: Thoroughly pre-wet the corn cob and dry cow manure until they can be formed into a ball by hand and loose when laid on the ground. Add the lime and gypsum from the formula, mix well, and then pile them up for fermentation.

[0124] 2) Bagging and sterilization

[0125] The fermented culture medium is packed into polyethylene bags, each bag containing 2 kg of wet medium, and then sterilized at high temperature.

[0126] 3) Inoculation and culture

[0127] Each bag of Hua8 liquid spawn 25 ml or solid spawn 20 ~ 25 g, 20 ~ 23 ℃ constant temperature culture.

[0128] 4) bagging and covering soil

[0129] After the mycelium runs out of the culture bag, continue to culture for 12 days to remove the bag and arrange the field. Before removing the bag, arrange the bed and sprinkle with lime disinfectant, and arrange 2 bags in a row. Select rice field soil, pine forest soil or vegetable garden soil with pH value of 5.0 ~ 7.0 as the covering material, pre-wet to a lump in hand and cover the soil, cover the soil with 3cm ~ 4cm thick, cover the coarse soil first, then fill the fine soil to the surface flat.

[0130] 5) mushroom management

[0131] After covering the soil, cover the film and keep it moist. When the mycelium crawls to the soil layer, spray water for 3 ~ 5 days, and then stimulate the mycelium to knot and thicken under light, and then manage the mushrooms. During the mushroom period, the water content of the soil layer is 85% ~ 90%, and the air relative humidity is 90% ~ 95%.

[0132] 6) harvesting

[0133] The mushroom shape is round and the edge is slightly rolled in. The mushroom body color is light purple or light purple, which can be harvested. When harvesting, twist the stem left and right to pick the mushroom, and leave small ones.

[0134] The above is only the preferred embodiment of the present application, and is not intended to limit the present application in any form. Although the present application has been disclosed as above, it is not intended to limit the present application. Any person skilled in the art can make some changes or modifications to the above disclosed technical content to make equivalent embodiments with equivalent changes, but as long as it does not deviate from the technical solution of the present application, any modification, equivalent change and modification of the above embodiments according to the technical essence of the present application are still within the scope of the present application.

Claims

1. A strain of *Mushroomia fuciformis*, characterized in that, The taxonomic name of the strain is Lepista sordida Hua8. Its Latin scientific name is Lepista sordida. The strain is preserved in the China Center for Type Culture Collection (CCTCC), with the preservation address at No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The preservation number is CCTCC NO: M2025154, and the preservation date is January 15, 2025.

2. A type of *Mammillaria famosa* spores, fruiting bodies, or mycelium, characterized in that, The spores, fruiting bodies or mycelia are produced by the strain described in claim 1.

3. A type of *Mushroom arborescens* spawn, characterized in that, The spawn bags are produced by the strain described in claim 1.

4. A food product, characterized in that, The said food contains the strain described in claim 1 or its extract, or the fruiting body or mycelia described in claim 2.

5. Use of the strain described in claim 1 or its extract, or the fruiting body or mycelia described in claim 2 in the preparation of food.

6. Use of the Lepista sordida strain described in claim 1 in the cultivation of Lepista sordida.

7. The application according to claim 6, characterized in that, The said use includes the following steps: 1) Preparation of culture medium Select corncobs, cow dung, lime and gypsum and mix them to form the culture medium; stack and ferment the culture medium. 2) Bagging and sterilization Fill the fermented culture medium into bags and perform high-temperature sterilization. 3) Inoculation and cultivation Inoculate each bag with liquid or solid spawn of Lepista sordida and perform constant-temperature cultivation. 4) Bag removal and soil covering After the mycelia cover the cultivation bags, continue to cultivate for several days and then remove the bags and arrange them in rows. Before arranging the bags, level the ridge bed and sprinkle quicklime for disinfection; select paddy soil, pine forest soil or vegetable garden soil as the soil covering material, pre-wet it until it can be formed into a ball by hand and cover the soil. 5) Mushroom fruiting management Cover the soil with a film to keep moisture. When the mycelia grow towards the soil layer, spray water on the soil covering layer. After light stimulation makes the mycelia twist and thicken, perform mushroom fruiting management. During the mushroom fruiting period, the water content of the soil covering layer is 50% - 95%, and the relative air humidity is 60% - 90%. 6) Harvesting Harvest when the mushroom shape is regular, the edge is slightly involuted, and the mushroom body color is pink-purple or light purple. When harvesting, pick the large mushrooms and leave the small ones.

8. The application as described in claim 7, characterized in that, In the step 1), the weight percentages of each component in the culture medium are: corncobs 50 - 75%, cow dung 20 - 45%, 1 - 3% lime, 1 - 3% gypsum.

Images