Recombinant dsRNA-baculovirus as well as preparation method and application thereof

Abstract

The invention relates to the technical field of pest control, in particular to a recombinant dsRNA-baculovirus as well as a preparation method and application thereof. The recombinant dsRNA-baculovirus disclosed by the invention comprises a baculovirus AcMNPV and a dsRNA fragment (as shown in SEQ ID NO. 2) of a gene introduced into the baculovirus AcMNPV. According to the invention, the assembly structure of recombinant dsRNA-baculovirus is improved, a target gene with a hairpin structure is introduced into baculovirus AcMNPV, and insect RNAi is carried out based on an AcMNPV expression vector, so that the influence of Lepidoptera insect lymphocytes on RNAi efficiency is solved, and the RNAi efficiency of Lepidoptera insects is improved; the problems of double-stranded ribonucleic acid dsRNA off-target, non-target effect, high cost and the like in the application of RNAi in pest prevention and control are solved, and a new mode and means are provided for prevention and control of lepidoptera insects.

Description

Technical Field

[0001] The present invention relates to the technical field of pest control, in particular to a recombinant dsRNA-baculovirus and a preparation method and application thereof. Background Art

[0002] Fall armyworm, commonly known as fall armyworm, belongs to the genus Spodoptera of the family Noctuidae in the order Lepidoptera. It is a parasitic pest on plants and has a wide range of host plants. The common means of prevention and control currently include agricultural prevention, physical prevention, chemical prevention and biological prevention. Physical and agricultural prevention have limited effects on controlling diseases and can only be limited to certain specific diseases. They also require auxiliary facilities and are time-consuming and labor-intensive. Chemical prevention has the disadvantages of increasing pest resistance, causing serious environmental pollution, and destroying the ecological balance. Biological control is safe for humans and animals and can reduce pest resistance. After a period of continuous application of biological pesticides, it also has a continuous and lasting inhibitory effect on some pests. RNAi pesticides belong to this category and have broad application prospects.

[0003] RNAi biopesticides refer to the use of exogenously designed and synthesized dsRNA, which causes RNA interference in the body through the ingestion of pathogens or pests, leading to the death of pests. It has the advantages of strong targeting, ecological safety, and environmental friendliness. However, RNAi also faces many problems in the application of pest control, such as the introduction method, reliability and stability of dsRNA, the trade-off between control efficiency and cost, and the problem of off-target and non-target effects. For the stability problem of dsRNA application, the nanomaterial encapsulation technology has been well solved, but the cost is relatively high. At present, it is considered that the more feasible and highly potential technologies are bacterial-mediated RNAi and transgenic crops expressing target gene dsRNA. However, since both involve bacterial vectors and transgenic technology, there may be biosafety issues, so there are also many restrictions in their application. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a recombinant dsRNA-baculovirus and a preparation method and application thereof, which solves the problems of off-target, non-target effects and high cost of double-stranded RNA dsRNA in RNAi pest control applications, and provides technical support for the control of Lepidoptera insects.

[0005] In order to achieve the above object, the present invention provides the following technical solutions: The present invention provides a recombinant dsRNA-baculovirus, comprising a baculovirus AcMNPV and a dsRNA segment of a gene introduced into the baculovirus AcMNPV; the nucleotide sequence of the dsRNA segment of the gene is shown in SEQ ID NO.2.

[0006] The present invention provides a method for preparing the recombinant dsRNA-baculovirus described in the above technical solution, comprising the following steps: Insert the dsRNA fragment of the gene into the pFastBac1 vector to obtain a recombinant vector; Transfer the recombinant vector into DH10Bac cells for transformation to obtain the recombinant dsRNA-baculovirus.

[0007] Preferably, after obtaining the recombinant dsRNA-baculovirus, it further includes: transfecting the recombinant dsRNA-baculovirus into lepidopteran engineering cells for replication of the recombinant dsRNA-baculovirus.

[0008] Preferably, the lepidopteran engineering cells are Sf21 cells.

[0009] Preferably, the dsRNA fragment of the gene is inserted between the BamH I and Hind III restriction enzyme sites of the pFastBac1 vector.

[0010] The present invention provides an RNAi biological pesticide, the active ingredient of which comprises a recombinant dsRNA-baculovirus; the recombinant dsRNA-baculovirus is the recombinant dsRNA-baculovirus described in the above technical solution or the recombinant dsRNA-baculovirus prepared by using the preparation method described in the above technical solution.

[0011] Preferably, the titer of the recombinant dsRNA-baculovirus in the RNAi biological pesticide is ≥8×10 5 IFU / mL.

[0012] The present invention provides the application of the recombinant dsRNA-baculovirus described in the above technical solution or the recombinant dsRNA-baculovirus prepared by using the preparation method described in the above technical solution or the RNAi biological pesticide described in the above technical solution in controlling lepidopteran insects.

[0013] Preferably, the lepidopteran insects include Spodoptera frugiperda.

[0014] The present invention provides a method for controlling lepidopteran insects, comprising: applying the recombinant dsRNA-baculovirus or the RNAi biological pesticide described in the above technical solution to the plants to be controlled; the recombinant dsRNA-baculovirus is the recombinant dsRNA-baculovirus described in the above technical solution or the recombinant dsRNA-baculovirus prepared by using the preparation method described in the above technical solution; the application method includes spraying.

[0015] Beneficial effects: The present invention provides a recombinant dsRNA-baculovirus, comprising a baculovirus AcMNPV and a dsRNA fragment of a gene introduced into the baculovirus AcMNPV; the nucleotide sequence of the dsRNA fragment of the gene is shown as SEQ ID NO.2. The recombinant dsRNA-baculovirus provided by the present invention is a dsRNA insecticide delivery system mediated by the recombinant dsRNA-baculovirus AcMNPV. By improving the assembly structure of the recombinant dsRNA-baculovirus, a target gene with a hairpin structure is introduced into the baculovirus AcMNPV. Based on the AcMNPV expression vector, insect RNAi can be carried out, so that the coding gene of peptidoglycan recognition protein in Lepidoptera insects can be silenced, thereby causing the reduction of the immunity of Lepidoptera insects and death, improving the RNAi efficiency of Lepidoptera insects; it helps to solve problems such as off-target of double-stranded ribonucleic acid dsRNA, non-target effects and high costs in the application of RNAi to control pests, helps to break through bottlenecks such as obvious drug resistance and chemical pesticide pollution in pest control, and the baculovirus AcMNPV is harmless to humans, livestock and the environment, and can also greatly reduce the harmful effects on non-target organisms and the environment, providing a new mode and means for the control of Lepidoptera insects. Brief Description of the Drawings

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.

[0017] Figure 1 It is the change in the mRNA expression of peptidoglycan recognition protein after the recombinant dsRNA-baculovirus AcMNPV-PGRP-hs infects Sf21 cells for 1 to 3 days; Figure 2 It is the change in the number of live cells after the recombinant dsRNA-baculovirus AcMNPV-PGRP-hs infects Sf21 cells for 1 to 3 days; Figure 3 It is the change in the cell viability after the recombinant dsRNA-baculovirus AcMNPV-PGRP-hs infects Sf21 cells for 1 to 3 days; Figure 4 It is the appearance change of the recombinant dsRNA-baculovirus AcMNPV-PGRP-hs feeding the 2nd instar Spodoptera frugiperda for 1 to 13 days; Figure 5 It is the change in the body weight of the recombinant dsRNA-baculovirus AcMNPV-PGRP-hs feeding the Spodoptera frugiperda for 7 to 13 days; Figure 6 It is the change in the mRNA expression of peptidoglycan recognition protein after the recombinant dsRNA-baculovirus AcMNPV-PGRP-hs feeds the Spodoptera frugiperda for 1 to 3 days; Figure 7 Appearance of Spodoptera frugiperda dead after feeding with recombinant dsRNA-baculovirus AcMNPV-PGRP-hs; Figure 8 Survival curve of Spodoptera frugiperda fed with recombinant dsRNA-baculovirus AcMNPV-PGRP-hs for 1 - 13 days; Figure 9 mRNA expression changes of peptidoglycan recognition protein in Spodoptera frugiperda after feeding with recombinant dsRNA-baculovirus AcMNPV-PGRP-hs for 7 - 13 d; Figure 10 mRNA expression changes of peptidoglycan recognition protein in dead Spodoptera frugiperda after feeding with recombinant dsRNA-baculovirus AcMNPV-PGRP-hs; Figure 11 mRNA expression changes of peptidoglycan recognition protein in Sf21 cells infected with recombinant dsRNA-baculovirus AcMNPV-PGRP for 1 - 3 d. Detailed implementation mode

[0018] The present invention provides a recombinant dsRNA-baculovirus, comprising a baculovirus AcMNPV and a dsRNA fragment of a gene introduced into the baculovirus AcMNPV; the nucleotide sequence of the dsRNA fragment of the gene is as shown in SEQ ID NO.2.

[0019] By improving the assembly structure of the recombinant dsRNA-baculovirus, the present invention introduces a target gene with a hairpin structure into the baculovirus AcMNPV, and conducts insect RNAi based on the AcMNPV expression vector. It can efficiently infect a variety of Lepidoptera insects, solve the problem of off-target of the target gene, has the characteristics of high specificity and no environmental pollution, can avoid environmental degradation, improve the targeting delivery efficiency, and is an ideal biological pesticide. The recombinant dsRNA-baculovirus provided by the present invention can directly infect other tissues of insects, solves the problem that the composition of hemolymph components in Lepidoptera insects hinders the success rate of RNAi, and provides a new mode and means for the control of Lepidoptera insects.

[0020] The present invention provides a preparation method of the recombinant dsRNA-baculovirus described in the above technical solution, comprising the following steps: Insert the dsRNA fragment of the gene into the pFastBac1 vector to obtain a recombinant vector; Transfer the recombinant vector into DH10Bac cells for transformation to obtain the recombinant dsRNA-baculovirus.

[0021] As an implementation method, after obtaining the recombinant dsRNA-baculovirus, it further includes: transfecting the recombinant dsRNA-baculovirus into Lepidoptera engineering cells for replication of the recombinant dsRNA-baculovirus.

[0022] As an implementation method, the Lepidoptera engineering cells are Sf21 cells.

[0023] As an implementation method, the dsRNA fragment of the gene is inserted between the BamH I and HindIII restriction enzyme sites of the pFastBac1 vector.

[0024] Based on the above advantages, the present invention provides an RNAi biological insecticide, the active ingredient of which includes recombinant dsRNA-baculovirus; the recombinant dsRNA-baculovirus is the recombinant dsRNA-baculovirus described in the above technical solution or the recombinant dsRNA-baculovirus prepared by using the preparation method described in the above technical solution.

[0025] As an implementation method, the titer of the recombinant dsRNA-baculovirus in the RNAi biological insecticide is ≥8×10 5 IFU / mL. As another implementation method, the titer of the recombinant dsRNA-baculovirus in the RNAi biological insecticide is 8×10 5 IFU / mL. The RNAi biological insecticide provided by the present invention can silence the coding gene of peptidoglycan recognition protein in Lepidoptera insects, thereby causing the death of Lepidoptera insects due to reduced immunity.

[0026] Based on the above advantages, the present invention provides the application of the recombinant dsRNA-baculovirus described in the above technical solution or the recombinant dsRNA-baculovirus prepared by using the preparation method described in the above technical solution or the RNAi biological insecticide described in the above technical solution in controlling Lepidoptera insects.

[0027] As an implementation method, the Lepidoptera insects include Spodoptera frugiperda.

[0028] Based on the above advantages, the present invention provides a method for controlling Lepidoptera insects, including: applying the recombinant dsRNA-baculovirus or the RNAi biological insecticide described in the above technical solution to the plants to be controlled; the recombinant dsRNA-baculovirus is the recombinant dsRNA-baculovirus described in the above technical solution or the recombinant dsRNA-baculovirus prepared by using the preparation method described in the above technical solution; the application method includes spraying.

[0029] As an implementation method, the Lepidoptera insects include Spodoptera frugiperda.

[0030] By applying the recombinant dsRNA-baculovirus or RNAi biopesticide to the plants to be controlled, after being eaten by lepidopteran insects, the encoding gene of the peptidoglycan recognition protein of lepidopteran insects can be silenced, resulting in the reduction of the immunity of lepidopteran insects and their death, which is an efficient control method.

[0031] To further illustrate the present invention, the recombinant dsRNA-baculovirus provided by the present invention, its preparation method and application will be described in detail below with reference to the drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0032] Example 1 In the present invention, apoptosis of Spodoptera frugiperda cells Sf21 is induced by exogenous virus infection. Through transcriptome sequencing analysis and verification, it is found that peptidoglycan recognition proteins (PGRPs) are involved in the regulation of Toll and Imd signaling pathways and play an important role in the innate immune response process of cells, and can be used as effective target genes for recombinant virus assembly.

[0033] Based on the above findings, the present invention provides an RNAi biopesticide based on the AcMNPV expression vector, and the construction method is as follows: According to the encoding gene of the peptidoglycan recognition protein of Spodoptera frugiperda PGRPs (NCBI reference sequence: XM_035572809.2), a target sequence with more interference sites is designed and determined as follows: 5'-cacactgtcagtcccgagtgcaatttgttcgtgaattgcgcagctgagatggtcaaccttcagaattattttaccacccattatggatacgatttaccgtataacttcgtgataggaaatgaaggaagagtttatgaaggccgtagttgggagataattggtgcacacaccagtggatacaaccgttgctctcttggcttagcgtttataggtgactaccgcgagggtttaccatcttactcaaaagtgacaagtctacaactgcaaagagcacaaatgttattagacaagggtgtcgagcttggatatatagacaaagactaccaagtcgtcggagcgaaagatctggcttcctcatatagtcctggcaccaacctatacagagagatacaaaaatggccccactacgc-3' (SEQ ID NO.1).

[0034] After comparing the RNAi effects of multiple assembly schemes, the assembly method of the recombinant AcMNPV was determined to be a hairpin structure, that is, based on the above-mentioned target sequence with more interference sites, a sequence with a hairpin structure was synthesized, specifically as follows: 5'-cacactgtcagtcccgagtgcaatttgttcgtgaattgcgcagctgagatggtcaaccttcagaattattttaccacccattatggatacgatttaccgtataacttcgtgataggaaatgaaggaagagtttatgaaggccgtagttgggagataattggtgcacacaccagtggatacaaccgttgctctcttggcttagcgtttataggtgactaccgcgagggtttaccatcttactcaaaagtgacaagtctacaactgcaaagagcacaaatgttattagacaagggtgtcgagcttggatatatagacaaagactaccaagtcgtcggagcgaaagatctggcttcctcatatagtcctggcaccaacctatacagagagatacaaaaatggccccactacgcTTTCGAAAGAGGTGCGCCCCCAGAAGCAATTTCGTGTAAATTAGATAAATCGTATTTGTCAATCAGAGTGCTTTTGGCGAAGAATGAAAATAGGGTTGGTACTAGCAACGCAGAATTCgcgtagtggggccatttttgtatctctctgtataggttggtgccaggactatatgaggaagccagatctttcgctccgacgacttggtagtctttgtctatatatccaagctcgacacccttgtctaataacatttgtgctctttgcagttgtagacttgtcacttttgagtaagatggtaaaccctcgcggtagtcacctataaacgctaagccaagagagcaacggttgtatccactggtgtgtgcaccaattatctcccaactacggccttcataaactcttccttcatttcctatcacgaagttatacggtaaatcgtatccataatgggtggtaaaataattctgaaggttgaccatctcagctgcgcaattcacgaacaaattgcactcgggactgacagtgtg-3' (SEQ ID NO.2); wherein, the lower-case un-bolded sequence (5'-cacactgtcagtcccgagtgcaatttgttcgtgaattgcgcagctgagatggtcaaccttcagaattattttaccacccattatggatacgatttaccgtataacttcgtgataggaaatgaaggaagagtttatgaaggccgtagttgggagataattggtgcacacaccagtggatacaaccgttgctctcttggcttagcgtttataggtgactaccgcgagggtttaccatcttactcaaaagtgacaagtctacaactgcaaagagcacaaatgttattagacaagggtgtcgagcttggatatatagacaaagactaccaagtcgtcggagcgaaagatctggcttcctcatatagtcctggcaccaacctatacagagagatacaaaaatggccccactacgc-3', SEQ ID NO.1) is the target sequence of the peptidoglycan recognition protein of Spodoptera frugiperda; the upper-case sequence (5'-TTTCGAAAGAGGTGCGCCCCCAGAAGCAATTTCGTGTAAATTAGATAAATCGTATTTGTCAATCAGAGTGCTTTTGGCGAAGAATGAAAATAGGGTTGGTACTAGCAACGCAGAATTC-3', SEQ IDNO.3) is the intermediate spacer sequence; the sequence in lowercase and bold (5'-gcgtagtggggccatttttgtatctctctgtataggttggtgccaggactatatgaggaagccagatctttcgctccgacgacttggtagtctttgtctatatatccaagctcgacacccttgtctaataacatttgtgctctttgcagttgtagacttgtcacttttgagtaagatggtaaaccctcgcggtagtcacctataaacgctaagccaagagagcaacggttgtatccactggtgtgtgcaccaattatctcccaactacggccttcataaactcttccttcatttcctatcacgaagttatacggtaaatcgtatccataatgggtggtaaaataattctgaaggttgaccatctcagctgcgcaattcacgaacaaattgcactcgggactgacagtgtg-3', SEQ ID NO.4) is the sequence that is complementary base-paired with the target sequence.

[0035] Nanjing Zhongding Biotechnology Co., Ltd. was commissioned to construct the recombinant bacmid, including the following steps: The gene fragment shown in SEQ ID NO.2 was inserted behind the polyhedrin promoter of the pFastBac1 vector (i.e., inserted between the BamH I and Hind III restriction enzyme sites of the pFastBac1 vector), and then transformed into DH10Bac cells to obtain the recombinant bacmid.

[0036] The recombinant bacmid was transfected into Sf21 cells using LipoInsect Transfection Reagent (Beyotime Biotechnology, product number: C0551) to obtain the recombinant dsRNA-baculovirus (AcMNPV-PGRP-hs) solution with a titer of 8×10 5 IFU / mL.

[0037] Example 2 The recombinant dsRNA-baculovirus (AcMNPV-PGRP-hs) prepared in Example 1 was used to infect Spodoptera frugiperda cells Sf21 at a concentration of MOI = 10. The relative expression levels of peptidoglycan recognition protein mRNA and cell viability were detected at 1 d, 2 d, and 3 d after infection. Spodoptera frugiperda cells Sf21 not infected with the recombinant dsRNA-baculovirus were set as the control group (denoted as Control), and the internal reference gene was Spodoptera frugiperda Actin , and the primer sequences used were as follows: PGRP-F: 5'-GTTGAGTTAGCCCTGAACGTG-3' (SEQ ID NO.5); PGRP-F: 5'-CCGCTTGGAGTTCTGGGG-3' (SEQ ID NO.6); Actin-F: 5'-CCTGTAGCTGAGGGCTATGTAA-3' (SEQ ID NO.7); Actin-R: 5'-CTGGTGGGATGCCTACTTCA-3' (SEQ ID NO.8).

[0038] The results are shown in Figures 1 - 3 and Tables 1 to 3. Among them, compared with the Control group, ** indicates P <0.01, *** indicates P <0.001.

[0039] Table 1 Relative expression levels of peptidoglycan recognition protein mRNA after recombinant dsRNA-baculovirus infects Sf21 cells

[0040] Table 2 Statistical results of the number of live cells after recombinant dsRNA-baculovirus infects Sf21 cells (cells / mL)

[0041] Table 3 Cell viability after recombinant dsRNA-baculovirus infects Sf21 cells (%)

[0042] The results showed that after the recombinant dsRNA-baculovirus AcMNPV-PGRP-hs infected Sf21 cells for 1 to 2 d, it could significantly reduce the expression of the peptidoglycan recognition protein gene in Sf21 cells ( P <0.01), and reduce the cell viability, indicating that AcMNPV-PGRP-hs could infect Sf21 cells and reduce the cell viability, resulting in a decrease in the expression of the peptidoglycan recognition protein gene and playing a certain RNAi role.

[0043] Example 3 The 2nd instar Spodoptera frugiperda larvae were infected by feeding with the recombinant dsRNA-baculovirus (AcMNPV-PGRP-hs) solution prepared in Example 1. The titer of AcMNPV-PGRP-hs was 8×10 5 IFU / mL. The food of Spodoptera frugiperda was corn leaves. The feeding method was to add the test solution to the corn leaves. An infected group (AcMNPV-PGRP-hs) and a control group (Control) were set up. The infected group was fed with the AcMNPV-PGRP-hs solution, and the control group was fed with the Sf21 cell culture medium without virus. There were 30 individuals in each group, and each was fed separately. The addition amount of the test solution was 150 μl / head / day. The appearance changes of Spodoptera frugiperda were observed, the weight changes were detected, the mRNA expression changes of peptidoglycan recognition protein were detected, and the survival curve was drawn. The results are shown in Figures 4 - 10 and Tables 4-7. Among them, compared with the Control group, * indicates P <0.08, *** indicates P <0.001.

[0044] Table 4 Weight changes (g) of Spodoptera frugiperda after feeding with the recombinant dsRNA-baculovirus solution for 7-13 d

[0045] Table 5 Relative expression levels of mRNA of peptidoglycan recognition protein after feeding with the recombinant dsRNA-baculovirus solution for 1-3 d

[0046] Table 6 Relative expression levels of mRNA of peptidoglycan recognition protein after feeding with the recombinant dsRNA-baculovirus solution for 7-13 d

[0047] Table 7 Relative expression levels of mRNA of PGRPs of dead Spodoptera frugiperda after feeding with the recombinant dsRNA-baculovirus

[0048] The results showed that after continuously feeding the 2nd instar larvae of Spodoptera frugiperda with the AcMNPV-PGRP-hs solution for 13 d, it was found that both the infected group and the control group of Spodoptera frugiperda continued to grow. However, after feeding for 7 d, the body length and weight of the infected group were lower than those of the control group ( Figures 4 - 5, Table 4), indicating that AcMNPV-PGRP-hs can infect Spodoptera frugiperda and cause its growth rate to slow down. Since there were no significant differences in the appearance and status between the infected group and the control group when feeding AcMNPV-PGRP-hs solution for 1-3 days, the present invention used fluorescence quantitative PCR to detect the mRNA expression of peptidoglycan recognition protein and found that AcMNPV-PGRP-hs infection could significantly reduce the mRNA expression of peptidoglycan recognition protein ( P <0.001) ( Figure 6 , Table 5), indicating that AcMNPV-PGRP-hs can infect Spodoptera frugiperda larvae and cause RNAi interference. From 7 to 13 days after infection, no deaths occurred in the control group, but different degrees of growth retardation and a small number of deaths began to appear in the infected group ( Figures 7 - 8 ), compared with the control group, the body length and weight of Spodoptera frugiperda larvae that died after infecting with AcMNPV-PGRP-hs were significantly lower ( Figure 5 ), and the survival curve also began to show a downward trend after 7 days ( Figure 8 ). Subsequently, fluorescence quantitative PCR was used to detect the mRNA expression of peptidoglycan recognition protein in surviving and dead Spodoptera frugiperda from 7 to 13 days after infection, and it was found that in the surviving group, the mRNA expression of peptidoglycan recognition protein in Spodoptera frugiperda infected for 7-13 days was significantly reduced ( P <0.001) ( Figure 9 , Table 6); in the dead group, the mRNA expression of peptidoglycan recognition protein in Spodoptera frugiperda infected for 8-11 days was significantly reduced ( P <0.01, P <0.001) ( Figure 10 , Table 7), indicating that AcMNPV-PGRP-hs exerted a certain RNAi effect.

[0049] From the above results, it can be seen that the recombinant dsRNA-baculovirus (AcMNPV-PGRP-hs) can infect Spodoptera frugiperda, cause growth retardation and partial death of Spodoptera frugiperda 7-13 days after infection, and these phenomena are related to the reduction of peptidoglycan recognition protein caused by AcMNPV-PGRP-hs. It can be seen that AcMNPV-PGRP-hs can exert a certain degree of RNAi effect in Spodoptera frugiperda larvae and has the feasibility for realizing the green prevention and control of Spodoptera frugiperda.

[0050] Comparative Example 1 A recombinant dsRNA-baculovirus (AcMNPV-PGRP) similar to Example 1 was constructed using a commonly used method for assembling recombinant dsRNA-baculoviruses. A gene fragment with more interference sites for peptidoglycan recognition protein in Spodoptera frugiperda (shown as SEQ ID NO.1) was directly introduced. The construction method was similar to that of Example 1, with the only difference being that when constructing the recombinant bacmid, the gene fragment shown as SEQ ID NO.2 was replaced with the gene fragment shown as SEQ ID NO.1.

[0051] The recombinant dsRNA-baculovirus (AcMNPV-PGRP) was used to infect Spodoptera frugiperda cells Sf21 at a concentration of MOI 10. The relative expression levels of peptidoglycan recognition protein mRNA were detected at 1d, 2d, and 3d after infection (the detection method was the same as in Example 2). Spodoptera frugiperda cells Sf21 not infected with the recombinant dsRNA-baculovirus were set as the control group (denoted as Control). The results showed that after the recombinant dsRNA-baculovirus AcMNPV-PGRP infected Sf21 cells for 1 - 3 days, there was no significant difference in the peptidoglycan recognition protein gene between the infected Sf21 cells and the control group ( P >0.05) ( Figure 11 , Table 8), indicating that it did not show a significant RNAi effect and was not as effective as AcMNPV-PGRP-hs constructed in Example 1.

[0052] Table 8 Relative expression levels of peptidoglycan recognition protein mRNA in Sf21 cells infected with AcMNPV-PGRP

[0053] By modifying the assembly structure of the recombinant dsRNA-baculovirus, the present invention for the first time conducts insect RNAi based on the AcMNPV expression vector. The packaging of dsRNA by AcMNPV solves the influence of RNAi efficiency on lepidopteran insect lymphocytes and improves the RNAi efficiency of lepidopteran insects, providing a new model and means for the green prevention and control of pests.

[0054] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments without creative efforts based on these embodiments, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A recombinant dsRNA-baculovirus, characterized in that: It comprises a baculovirus AcMNPV and a dsRNA fragment of a gene introduced into the baculovirus AcMNPV; the nucleotide sequence of the dsRNA fragment of the gene is shown in SEQ ID NO.

2.

2. The method for preparing the recombinant dsRNA-baculovirus according to claim 1, characterized in that: The following steps are involved: Inserting the dsRNA fragment of the gene into the pFastBac1 vector to obtain a recombinant vector; The recombinant vector is transferred into DH10Bac cells for transformation to obtain the recombinant dsRNA-baculovirus.

3. The preparation method according to claim 2, characterized in that: After obtaining the recombinant dsRNA-baculovirus, the method further comprises: transfecting the recombinant dsRNA-baculovirus into Lepidoptera engineering cells to replicate the recombinant dsRNA-baculovirus.

4. The preparation method according to claim 3, characterized in that: The Lepidoptera engineering cells are Sf21 cells.

5. The preparation method according to claim 2, characterized in that: The dsRNA fragment of the gene is inserted between the BamH I and Hind III restriction sites of the pFastBac1 vector.

6. A RNAi biopesticide, characterized in that: The active ingredient comprises recombinant dsRNA-baculovirus; the recombinant dsRNA-baculovirus is the recombinant dsRNA-baculovirus according to claim 1 or the recombinant dsRNA-baculovirus prepared by the preparation method according to any one of claims 2 to 5.

7. The RNAi biopesticide according to claim 6, characterized in that: The titer of the recombinant dsRNA-baculovirus in the RNAi biopesticide is ≥ 8×10 5 IFU / mL.

8. Use of the recombinant dsRNA-baculovirus according to claim 1, or the recombinant dsRNA-baculovirus prepared by the preparation method according to any one of claims 2 to 5, or the RNAi biopesticide according to claim 6 or 7 in controlling lepidopteran insects.

9. The use according to claim 8, characterized in that: The lepidopteran insects include fall armyworm.

10. A method for controlling lepidopteran insects, characterized in that: include: The recombinant dsRNA-baculovirus or the RNAi biopesticide according to claim 6 or 7 is applied to the plant to be controlled; the recombinant dsRNA-baculovirus is the recombinant dsRNA-baculovirus according to claim 1 or the recombinant dsRNA-baculovirus prepared by the preparation method according to any one of claims 2 to 5; the application method includes spraying.

Images