ZNF467 gene mutant and application thereof

By overexpressing the amino acid deletion mutant (npZNF467) of the ZNF467 gene in human hematopoietic stem cells, the problems of deduction and long-term transplant efficiency during hematopoietic stem cell transplantation were solved, significantly improving its transplant efficiency, and activate the expression of deduction-related genes.

CN120137984AActive Publication Date: 2025-06-13SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202311695224.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-11
Publication Date
2025-06-13
Estimated Expiration
2043-12-11

AI Technical Summary

Technical Problem

In the prior art, the deduction and long-term transplant efficiency of human hematopoietic stem cells (HSCs) during the transplantation process limit their wide application in clinical treatment.

Method used

By introducing the amino acid deletion mutant (npZNF467) of the ZNF467 gene, the mutant is overexpressed in hematopoietic stem cells through gene vectors or recombinant proteins, significantly improving its deduction and transplant efficiency.

Benefits of technology

Experimental results show that overexpression of npZNF467 significantly improves the regression and long-term transplant efficiency of human hematopoietic stem cells, can improve the transplant efficiency by about 13.2 times, and activates the expression of regression-related genes such as MMP9 and ICAM1.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120137984A_ABST
    Figure CN120137984A_ABST
Patent Text Reader

Abstract

The invention provides a ZNF467 gene mutant and application thereof. The sequence of the mutant is as shown in SEQ ID NO. 1. The invention discloses a 216-292 site amino acid truncated mutant of a brand new gene ZNF467 specifically enriched in human hematopoietic stem cells, overexpression of the mutant can significantly improve homing and transplantation efficiency of the human hematopoietic stem cells, and the mutant has great significance in clinical treatment of related diseases based on hematopoietic stem cell transplantation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the fields of bioengineering and biopharmaceuticals, and particularly to a gene mutant for improving the homing and transplantation efficiency of hematopoietic stem cells. Background Art

[0002] Hematopoietic cell transplantation is widely used in the treatment of various malignant and non-malignant hematological diseases and metabolic diseases, and is a relatively mature and effective clinical stem cell treatment method at present. Hematopoietic stem cells (HSCs) play a core role in the process of hematopoietic cell transplantation. Since the proportion of functional HSCs in all blood cells is very low, whether from bone marrow, peripheral blood or umbilical cord blood, especially for the application scenarios of HSCs that need to be genetically engineered, the limited number of HSCs is the main obstacle restricting their more extensive and effective application in clinical treatment. Exploring new strategies to improve the transplantation potential of HSCs is beneficial to solving the source of HSC donors, accelerating the recovery of the hematopoietic system and immune reconstruction after transplantation, and has important scientific significance for expanding the application scope of HSC transplantation, improving the clinical treatment effect and survival rate of patients.

[0003] Improving the transplantation potential of HSCs can target three key steps: the collection, in vitro expansion and homing of HSCs. The homing of HSCs is generally defined as the process in which HSCs migrate and stay in a specific microenvironment or niche in the body. Under physiological conditions, HSCs colonized in the microenvironment proliferate, self-renew and differentiate to maintain a steady-state balance. Our previous research revealed the epigenetic regulation mechanism of the expression of the homing receptor CXCR4 of human umbilical cord blood HSCs. Short-term culture of umbilical cord blood HSCs with glucocorticoids or HDAC5 inhibitors can significantly up-regulate the expression of CXCR4 and improve the homing and long-term transplantation ability of HSCs. At present, the regulation of human HSC homing mainly focuses on the SDF1 / CXCR4 signaling axis. Exploring new genes and molecular mechanisms of human HSC homing regulation is crucial for comprehensively understanding the process of human HSC homing and transplantation and developing drugs to improve human HSC homing. Summary of the Invention

[0004] The object of the present invention is to provide a new gene mutant and its application to improve the homing and long-term transplantation efficiency of human hematopoietic stem cells.

[0005] To achieve the above object, the present invention provides a ZNF467 gene mutant (abbreviated as npZNF467), and the mutant sequence is shown in SEQ ID NO.1.

[0006] The ZNF467 gene mutant is a deletion mutant of amino acids 216-292 of ZNF467, and its cDNA sequence is (SEQ ID NO.1):

[0007]

[0008] The present invention also provides the use of the ZNF467 gene mutant in the preparation of a drug for improving the homing or transplantation efficiency of hematopoietic stem cells. Experiments have shown that overexpression of npZNF467 significantly improves the homing and long-term transplantation efficiency of human hematopoietic stem cells. The npZNF467 gene can be delivered into hematopoietic stem cells by gene vectors such as lentivirus, liposome transfection, electroporation, artificial cell delivery vectors, etc., or overexpression can be achieved by electroporation or directly allowing cells to phagocytize by adding a fusion tag. Or by designing and producing an npZNF467 recombinant protein that can enter cells to directly activate the transcription of target genes, improving the homing and transplantation efficiency of hematopoietic stem cells. Using small molecule compounds or monoclonal antibodies to target the ZNF467 gene, binding to the amino acid sequence at positions 216-299 of the full-length ZNF467, inducing the full-length ZNF467 to localize to the nucleoplasm part of the cell nucleus.

[0009] Hematopoietic stem cell transplantation includes transplantation of hematopoietic stem and progenitor cells from bone marrow, mobilized peripheral blood or umbilical cord blood, as well as transplantation of gene-edited hematopoietic stem and progenitor cells.

[0010] The present invention also provides the use of the ZNF467 gene mutant in the preparation of a humanized mouse model of the hematopoietic system, and the mouse model is constructed based on the use of human CD34 + hematopoietic stem and progenitor cells. Transplanting human CD34 + hematopoietic stem and progenitor cells overexpressing npZNF467 into immunodeficient mice, and the transplanted CD34 + hematopoietic stem and progenitor cells reconstitute the blood in immunodeficient mice to generate human myeloid cells and lymphoid cells, and in this way, a humanized mouse model is constructed to achieve the reconstruction of the hematopoietic system and the immune system, and is used for the evaluation and testing of the therapeutic effect of tumor immunotherapy.

[0011] The present invention also provides the use of the ZNF467 gene mutant in the preparation of a drug for treating diseases related to hematopoietic stem cell transplantation, and the diseases related to hematopoietic stem cell transplantation include leukemia, aplastic anemia, SCID immunodeficiency disease, Fanconi anemia and thalassemia.

[0012] The advantages of the present invention are that the present invention discloses a truncated mutant of the amino acids at positions 216-292 of the brand-new gene ZNF467 that is specifically enriched in human hematopoietic stem cells. Overexpression of this mutant can significantly improve the homing and transplantation efficiency of human hematopoietic stem cells, which has great significance for the clinical treatment of diseases related to hematopoietic stem cell transplantation. Brief Description of the Drawings

[0013] Figure 1.ZNF467 is highly expressed in human hematopoietic stem cells. a. RT-PCR shows that the expression of ZNF467 in hematopoietic stem cells (HSC) is significantly higher than that in multipotent progenitors (MPP); b. Single-cell sequencing transcriptome analysis shows that ZNF467 is highly expressed in the CD34 + CD133 + ADGRG1 + cell population after in vitro expansion; c. RT-PCR shows that the expression level of ZNF467 in CD34 + CD133 + ADGRG1 + cells is significantly higher than that in CD34 + CD133 + ADGRG1 - cells.

[0014] Figure 2 . Expression localization of full-length ZNF467 and the 216-292 amino acid deletion mutant ZNF467 (npZNF467). a. Distribution of the zinc finger (ZnF) domain and IDR region of full-length ZNF467 and npZNF467; b. Confocal fluorescence microscopy images show the intracellular localization of full-length ZNF467 and npZNF467.

[0015] Figure 3 . Overexpression of npZNF467 significantly improves the transplantation efficiency of human hematopoietic stem and progenitor cells. a. ZNF467 or npZNF467 is cloned into a lentiviral vector for packaging lentivirus to infect human CD34 + cells; b-c. LDA limiting dilution assay analyzes the transplantation efficiency of CD34 + cells overexpressing ZNF467 and npZNF467 in immunodeficient mice (NSG), n.s. refers to not significant; ***p < 0.001.

[0016] Figure 4 . Overexpression of npZNF467 significantly improves the homing efficiency of human hematopoietic stem and progenitor cells. a. Flow cytometry plot of the proportion of human CD45 cell chimerism in the bone marrow after transplanting npZNF467-overexpressing hematopoietic stem and progenitor cells into immunodeficient mice for 24 hours; b. Statistical results show that the homing efficiency of CD34 + cells overexpressing npZNF467 is significantly higher than that of the control group; ***p < 0.001.

[0017] Figure 5 . Overexpression of npZNF467 activates the expression of homing genes MMP9 and ICAM1. a. Transcriptome sequencing signal pathway functional annotation enrichment analysis shows that CD34 +The homing-related pathways in hematopoietic stem and progenitor cells were significantly upregulated; b-c. RT-PCR analysis showed that overexpression of npZNF467 significantly upregulated the expression levels of MMP9 and ICAM1.

[0018] Figure 6 . Inhibiting MMP9 and ICAM1 blocked the promoting effect of npZNF67 on homing. a-b. The MMP9 inhibitor JNJ0966 significantly inhibited the upregulated homing efficiency caused by overexpression of npZNF467; c-d. Treatment with anti-ICAM1 antibody significantly blocked the promoting effect of overexpression of npZNF467 on the homing of human hematopoietic stem and progenitor cells. Detailed implementation manners

[0019] Hereinafter, the technology of the present invention will be described in detail in combination with specific implementation manners. It should be known that the following specific implementation manners are only used to help those skilled in the art understand the present invention, rather than limiting the present invention. The materials, reagents, etc. used in the following examples can be obtained from commercial channels without special instructions.

[0020] Example 1. Preparation of lentivirus of amino acid deletion mutant ZNF467 (npZNF467) at positions 216-292

[0021] Single-cell sequencing transcriptome analysis and quantitative PCR were used to verify the high expression of the ZNF467 gene in human HSCs ( Figure 1 ), and the subcellular localization of full-length and npZNF467 in cells was confirmed by fluorescence microscopy ( Figure 2 ). Mutation experiments and confocal microscopy localization experiments found that overexpression of full-length ZNF467 was localized to the nucleolus, while overexpression of the amino acid deletion mutant form of ZNF467 at positions 216-292 (abbreviated as npZNF67) lost nucleolar localization and was significantly enriched in the nucleoplasm of the nucleus. For use in human umbilical cord blood CD34 +Overexpress npZNF467 in cells. First, clone the full-length cDNA of human ZNF467 into the LV165 vector of GeneCopoeia, and the sequence was verified by sequencing. Then, use the following primers (FR: ATCCATACGGGCGAGAGGCC (SEQ ID NO.2); RW: AGGCCGCTCGCCGCGGTGGC (SEQ ID NO.3)) to perform PCR experiments to clone the LV165 lentiviral expression vector of the 216 - 292 amino acid deletion mutant ZNF467 (npZNF467). Generate lentivirus by co-transfecting the above plasmid with psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) into Lenti-X 293T cells (Takara, #632180). Concentrate the lentivirus supernatant by centrifuging at 50,000 g for 2.5 hours at 4°C using a Beckman SW-28 swinging bucket centrifuge. Infect cord blood CD34 + cells in the presence of 8 μg / ml polybrene (EMD Millipore, #TR-1003-G) to achieve overexpression of npZNF467 in CD34 + human hematopoietic stem and progenitor cells.

[0022] Example 2. Use npZNF467 overexpression to improve the transplantation efficiency of human umbilical cord blood hematopoietic stem and progenitor cells

[0023] Isolate fresh cord blood CD34 + cells using an immunomagnetic bead sorting kit (Miltenyi 130-046-703, CD34 MicroBead Kit, human), and culture them in HSC expansion medium (Stem Cell Expansion Medium) (Sigma, S0912) + 100 ng / mL stem cell factor (SCF) (R&D Systems, #7466-SC-010 / CF) + 100 ng / mL thrombopoietin (TPO) (R&D Systems, #288-TP-200 / CF) + 50 ng / mL Fms-like tyrosine kinase 3 ligand (Flt3L) (BioLegend, #710802) + 50 IU / mL penicillin + 50 μg / mL streptomycin for 24 hours. The culture conditions are 5% O 2 , 5% CO 2。The CD34 cells cultured overnight were infected with lentiviruses of LV165 empty vector, LV165-ZNF467, and LV165-npZNF467 vectors respectively according to the method described in Example 1 + cells. After continued culture for 4 days, GFP-positive cells were sorted by flow cytometry and cell counting was performed. 10,000, 50,000, and 100,000 GFP-positive cells of the LV165 group, LV165-ZNF467, and LV165-npZNF467 groups were respectively transplanted into immunodeficient mice irradiated 24 hours in advance (1.5 G) via tail vein injection. After 16 weeks of transplantation, the bone marrow of the recipient mice was taken for human CD45 staining to detect the transplantation efficiency and the functional HSC index was calculated using the LDA algorithm( Figure 3 ). The results of the 16-week bone marrow transplantation experiment found that overexpression of full-length ZNF467 had no significant effect on the transplantation ability of hematopoietic stem cells, while overexpression of npZNF467 could increase the transplantation efficiency of hematopoietic stem cells by about 13.2 times.

[0024] Example 3. Using npZNF467 lentivirus to improve the homing efficiency of hematopoietic stem cells

[0025] The collection, culture, and activation pretreatment of cord blood CD34 + cells were performed according to the method described in Example 2. The CD34 + cells cultured overnight were infected with lentiviruses of LV165 empty vector and LV165-npZNF467 vectors respectively according to the method described in Example 1. After continued culture for 4 days, GFP-positive cells were sorted by flow cytometry and cell counting was performed. 500,000 GFP-positive cells of the LV165 group and LV165-npZNF467 group were respectively transplanted into immunodeficient mice irradiated 24 hours in advance (1.5 G) via tail vein injection. After 24 hours of transplantation, the bone marrow of the recipient mice was taken for human CD45 staining to detect the chimerism ratio and calculate the homing efficiency of hematopoietic stem and progenitor cells( Figure 4 ). The results showed that overexpression of npZNF467 could significantly improve the homing efficiency of human hematopoietic stem and progenitor cells.

[0026] Example 4. Using npZNF467 lentivirus to activate the expression of homing genes in hematopoietic stem cells

[0027] The collection, culture, and activation pretreatment of cord blood CD34 + cells were performed according to the methods described in Examples 2 and 3. The CD34 +Cells. After continued culture for 4 days, GFP-positive cells were sorted by flow cytometry and cell counting was performed. RNA extraction and reverse transcription experiments were respectively carried out on 500,000 GFP-positive cells in the LV165 group and the LV165-npZNF467 group, and the expression levels of the homing genes MMP9 and ICAM1 were detected by fluorescence quantitative PCR ( Figure 5 ). Transcriptome sequencing analysis showed that overexpression of npZNF467 significantly activated the expression of genes related to the hematopoietic stem and progenitor cell homing signaling pathway, including the core genes MMP9 and ICAM1. 500,000 GFP-positive cells in the LV165 group and the LV165-npZNF467 group were respectively pretreated with the MMP9 inhibitor JNJ096 or the anti-ICAM1 neutralizing antibody, and the untreated and treated cells were transplanted into immunodeficient mice irradiated (1.5 G) 24 hours in advance via the tail vein. 24 hours after transplantation, the bone marrow of the recipient mice was taken for human CD45 staining to detect the chimerism ratio and calculate the homing efficiency of hematopoietic stem and progenitor cells ( Figure 6 ). The results showed that treatment with the MMP9 inhibitor JNJ0966 or the ICAM1 neutralizing antibody could significantly block the enhanced homing efficiency of hematopoietic stem and progenitor cells induced by npZNF467 overexpression.

[0028] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A ZNF467 gene mutant, characterized in that, the mutant sequence is as shown in SEQ ID NO.

1.

2. Use of the ZNF467 gene mutant according to claim 1 in the preparation of a drug for improving the homing or transplantation efficiency of hematopoietic stem cells.

3. Use of the ZNF467 gene mutant according to claim 1 in the preparation of a humanized mouse model of the hematopoietic system, characterized in that, The mouse model is based on the use of human CD34 + hematopoietic stem and progenitor cells for construction.

4. Use of the ZNF467 gene mutant according to claim 1 in the preparation of a drug for treating diseases related to hematopoietic stem cell transplantation, characterized in that, the diseases related to hematopoietic stem cell transplantation include leukemia, aplastic anemia, SCID immunodeficiency disease, Fanconi anemia, and thalassemia.

Citation Information

Patent Citations

  • ZNF667 protein RNA (ribonucleic acid) interference plasmid and application method thereof

    CN106636200A

  • Multi-lineage hematopoietic precursor cell production by genetic programming

    CN108431211A

  • Application of ZNF683 as immunosuppression target in inducing T cell immune tolerance regulation

    CN115595361A

  • Methods, kits and arrays for screening for, predicting and identifying donors for hematopoietic cell transplantation, and predicting risk of hematopoietic cell transplant (HCT) to induce graft VS. host disease (GVHD)

    US20120277999A1

  • AU2002330097A1