Application of oscrrlk34 gene in regulating rice disease resistance, related biological materials and breeding method

Abstract

The application discloses application of an OsCRRLK34 gene in regulation of rice disease resistance, related biological materials and a cultivation method. The application of the OsCRRLK34 gene in regulation of rice disease resistance, wherein the sequence of the OsCRRLK34 gene is shown as SEQ ID NO. 1, and the disease resistance is sheath blight resistance. The amino acid sequence of a protein encoded by the OsCRRLK34 gene is shown as SEQ ID NO. 2. The application of the OsCRRLK34 gene in regulation of rice disease resistance, wherein knocking out the gene weakens the sheath blight resistance of plants, and overexpressing the gene can significantly enhance the sheath blight resistance of plants, indicating that the gene has potential application value in sheath blight resistance molecular breeding, and the gene can provide important gene resources for rice sheath blight resistance breeding.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving the application of the OsCRRLK34 gene in regulating rice disease resistance, related biological materials and cultivation methods. Background Technology

[0002] Rice sheath blight, one of the major fungal diseases of rice, poses a serious threat to rice yield and food security. With increased nitrogen fertilizer application, the promotion of compact varieties, and higher planting densities, the occurrence and spread of sheath blight have shown a trend of increasing severity year by year. Its affected area ranks first among the three major rice diseases, seriously impacting food security. Currently, the control of sheath blight largely relies on chemical agents, which not only increases production costs but also has adverse environmental impacts. Therefore, breeding rice varieties resistant to sheath blight is the most economical and effective method.

[0003] Rice resistance to sheath blight is a quantitative trait controlled by quantitative trait loci (QTLs) or multiple genes. Several QTLs for resistance to sheath blight have been identified, but near-isogenic line and multi-environment experiments have shown that most QTLs exhibit limited effects. In contrast, the combination of reverse genetics with omics technologies such as genomics and transcriptomics offers a new solution to this challenge. By screening differentially expressed genes or gene sets associated with specific traits using omics technologies and then conducting systematic validation, we can more comprehensively and efficiently mine gene resources related to specific biological processes. Summary of the Invention

[0004] This invention provides the application of the OsCRRLK34 gene in regulating rice disease resistance, related biological materials, and cultivation methods, which can effectively solve the problem of difficult control of rice sheath blight in actual production.

[0005] This invention provides the application of the OsCRRLK34 gene in regulating rice disease resistance, the sequence of which is shown in SEQ ID NO.1, and the disease resistance is resistance to rice sheath blight.

[0006] In the above applications, the amino acid sequence of the protein encoded by the OsCRRLK34 gene is shown in SEQ ID NO.2.

[0007] The present invention also provides a recombinant vector comprising the complementary sequence of the OsCRRLK34 gene described in the above-described applications.

[0008] The present invention also provides a recombinant microorganism comprising the OsCRRLK34 gene described in the above-described applications or the above-described recombinant vector.

[0009] The present invention also provides a method for cultivating highly disease-resistant rice, comprising overexpressing the OsCRRLK34 gene described in the above-mentioned application, or increasing the content of the protein described in the above-mentioned application, so as to increase the plant's resistance to sheath blight and reduce its susceptibility to the disease.

[0010] In the above method, the overexpression process includes amplifying the OsCRRLK34 gene, digesting it with enzymes and ligating it into the pCAMBIA1390 vector, transforming it with E. coli and verifying it by sequencing, extracting the plasmid and transforming it into Agrobacterium, and mediating its introduction into the plant.

[0011] In the above method, the sequences of the amplified primer pairs are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0012] This invention relates to the application of the OsCRRLK34 gene in regulating rice disease resistance. Knocking out this gene weakens the plant's resistance to sheath blight, while overexpressing the gene significantly enhances the plant's resistance to sheath blight. This indicates that the gene has potential application value in molecular breeding for rice resistant to sheath blight, and it can provide an important gene resource for breeding rice resistant to sheath blight.

[0013] The recombinant vector and recombinant microorganism of this invention can precisely participate in the regulation of the OsCRRLK34 gene, thereby significantly improving the plant's resistance to sheath blight.

[0014] The present invention describes a method for cultivating highly disease-resistant rice by overexpressing the gene OsCRRLK34, which is used to combat sheath blight, thereby obtaining transgenic cell lines and transgenic plant plants with enhanced resistance to sheath blight. Attached Figure Description

[0015] Figure 1 The expression patterns of the OsCRRLK34 gene are shown in Figure A, where A represents the expression patterns of this gene in different tissues of rice (R, S, L, LS and P represent root, stem, leaf, leaf sheath and panicle tissues, respectively); and B represents the expression level of the OsCRRLK34 gene in wild-type rice after inoculation with Sheath blight fungus at different times.

[0016] Figure 2 In the table, A represents the knockout site changes in three knockout lines of the OsCRRLK34 gene; B represents the lesion length results for the OsCRRLK34 knockout lines and wild-type greenhouse sheath blight resistance identification; C represents the lesion length results for in vitro sheath blight resistance identification; "*" indicates a significant difference at the 5% level, i.e., p≤0.05; "**" indicates an extremely significant difference at the 1% level, i.e., p≤0.01; scale bar = 5cm.

[0017] Figure 3In the table, A represents the protein expression level of the OsCRRLK34 gene in three overexpression lines; B represents the expression level of the OsCRRLK34 gene in three overexpression lines; C represents the lesion length results for the OsCRRLK34 overexpression lines and wild-type greenhouse sheath blight resistance identification; D represents the lesion length results for in vitro sheath blight resistance identification; "*" indicates a significant difference at the 5% level, i.e., p≤0.05; "**" indicates an extremely significant difference at the 1% level, i.e., p≤0.01; scale bar = 5cm. Detailed Implementation

[0018] The present invention will now be described in further detail with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention. Unless otherwise specified, the experimental materials used in the following embodiments are commercially available.

[0019] Application of OsCRRLK34 gene in regulating rice disease resistance. The sequence of the OsCRRLK34 gene is shown as SEQ ID NO.1: ATGCTTAAAGATGGGACAGAAATTGCTGCGAAGAAGCTTCGGGAAACATCACCGATTCATGACAATCAATTTAAAAATGAGGTTGGGAGTCTTATGAAGGTCAACCACAGAAATATAGTCAAGTTAATTGGCTACTGTTATGAAATACAAAAGAAGGTGGTGGAGCATAATGGAAAATATATTCTTACAGAGGCAGTAGAAAAACTGCTGTGCTATGAATATATATCTAATGGAAGCCTTGACAAACACCTTTTCGGTGAATCAAGTCGACTTGATTGGCACACACGCTTCAATATAATTAAGGGGGTTTGTGAGGGTTTGCATTTCCTACACAAAGGATCAGAAAGACCTATTATTCATTTGGATATTAAACCTAGCAACATACTATTGGATGACAACATGGTGCCAAAAATTGCAGATTTTGGTCTATCAAGGCTCTTGGGTGAAGAACAAACCAGAGTTTGCACACAAAATGTCATGGGAGCAATAGGATACATGGCACCGGAATATTTATATCGAGGTGAAATCTCCACTCAATCAGATATATACAGTTTAGGTCTTCTAATTATCGAGATCACAACAGGGGAGAAAAACTTCCCCAATAGAGAGGACATCATTGCTAAGAACTTCATTGAGAATGTACGCCGAAATCGGACCAATATTGTGCATATATCACTGAAGTACCCATCGTTAGACACAAATTGCCTCCAGCAGGTAAAGACATGCATTGAAATTGGACTGAGCTGTGTTCAGACCAACCGGAAGGACAGGCCTTCTATAGGGGAAATTGTCAATATGCTCAGTTGA, and the disease resistance is sheath blight resistance.The amino acid sequence of the protein encoded by the OsCRRLK34 gene is shown in SEQ ID NO.2: MLKDGTEIAAKKLRETSPIHDNQFKNEVGSLMKVNHRNIVKLIGYCYEIQKKVVEHNGKYILTEAVEKLLCYEYISNGSLDKHLFGESSRLDWHTRFNIIKGVCEGLHFLHKGSERPIIHLDIKPSNILLDDNMVPKIADFGLSRLLGEEQTRVCTQNVMGAIGYMAPEYLYRGEISTQSDIYSLGLLIIEITTGEKNFPNREDIIAKNFIENVRRNRTNIVHISLKYPSLDTNCLQQVKTCIEIGLSCVQTNRKDRPSIGEIVNMLS.

[0020] A method for breeding highly disease-resistant rice includes overexpressing the OsCRRLK34 gene used in the above-mentioned application, thereby increasing the plant's resistance to sheath blight and reducing its susceptibility to the disease.

[0021] The overexpression process involves amplifying the OsCRRLK34 gene using primer pairs as shown in SEQ ID NO. 3: 5'-CGAACGATAGCCGGTACCATGCTTAAAGATGGGACA-3' and SEQ ID NO. 4: 5'-ATTGTCAATATGCTCAGTCATGGCATATACGATCTC-3'. The gene is then ligated into a vector, which can be any vector capable of guiding the expression of the exogenous gene in plants, preferably the pCAMBIA1390 vector. Transformation into plant cells or tissues can be mediated through methods such as E. coli transformation, Agrobacterium transformation, Ti plasmid transformation, Ri plasmid transformation, plant virus vector transformation, direct DNA transformation, and electrochemical transformation.

[0022] In the methods described above, any type of enhanced or constitutive promoter can be added, such as the cauliflower mosaic virus (CAMV) 35S promoter. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), or antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.).

[0023] The gene sequence in this example is derived from the rice germplasm YSBR1, which is resistant to rice sheath blight and is preserved in the Rice Germplasm Resource Bank of Yangzhou University. This germplasm originates from a natural variant in the population of indica-japonica hybrids and japonica hybrids. After several generations of self-pollination, the offspring gradually became homozygous. Through resistance identification of rice sheath blight, this variety showed significantly higher resistance than other tested varieties.

[0024] In this example, the rice genetic transformation material was the rice variety NIP (Nipponbare), which is susceptible to rice sheath blight and was provided by the Rice Germplasm Resource Bank of Yangzhou University.

[0025] Example 1: Identification and Cloning of the OsCRRLK34 Gene

[0026] To screen for genes resistant to sheath blight, transcriptome data from seven rice varieties constructed in our laboratory before and after infection with sheath blight pathogens were analyzed. The gene OsCRRLK34, associated with sheath blight resistance, was identified. This gene was downregulated after infection with sheath blight pathogens, and knockout and overexpression studies were conducted.

[0027] The cloning method for the OsCRRLK34 gene includes the following steps:

[0028] Using the genome of rice germplasm YSBR1 resistant to sheath blight, primers were designed for PCR amplification of the OsCRRLK34 gene:

[0029] OsCRRLK34-F:5'-CGAACGATAGCCGGTACCATGCTTAAAGATGGGAC A-3' (SEQ ID NO.3),

[0030] OsCRRLK34-R: 5'-ATTGTCAATATGCTCAGTCATGGCATATACGATCTC-3' (SEQ ID NO. 4).

[0031] Using rice germplasm YSBR1 tissue cDNA as a template, PCR amplification was performed, the PCR amplification products were recovered and purified, and sequenced to screen for the OsCRRLK34 gene.

[0032] The nucleotide sequence encoded by the rice OsCRRLK34 gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.

[0033] Example 2: Expression Characterization Analysis of the OsCRRLK34 Gene

[0034] RNA samples were collected from different tissues (roots, stems, leaves, leaf sheaths, and panicles) during the booting stage of the susceptible rice variety NIP. Total RNA was extracted using Trizol reagent (Invitrogen) according to the experimental procedure in the manufacturer's instructions. Genomic DNA contamination was then removed using DNase I (RNase free, Promega) (see DNase I manufacturer's instructions for the method). Finally, the first strand of cDNA was synthesized using the PrimeScript RT reagent Kit With gDNA Eraser kit (TaKaRa) (see manufacturer's instructions for the method). Using cDNA from the aforementioned different tissues as templates, and the rice Actin gene as an internal reference gene (Actin gene amplification primers F: 5'-CTAAGCCAAGAGGAGCTGTTAT-3' (SEQ ID NO.5) and R: 5'-ATAACAGATAGGCCGGTTGAAA-3' (SEQ ID NO.6)), real-time quantitative PCR was performed using OsCRRLK34 gene-specific quantitative primers QOsCRRLK34-F: 5'-AAGGCTCTTGGG TGAAGAACAA-3' (SEQ ID NO.7) and QOsCRRLK34-R: 5'-TGCTGGAGGCA ATTTGTGTCTA-3' (SEQ ID NO.8) to detect the specificity of the OsCRRLK34 gene in different rice tissues. The reaction conditions were: pre-denaturation at 95℃ for 2 min, followed by the following steps: 95℃, 15 sec, 60℃, 10 sec, 72℃, 10 sec, for a total of 40 cycles.

[0035] NIPs were cultured under normal field conditions until the end of tillering and then inoculated with *Rhizoctonia solani* strain YN-7, a moderately pathogenic strain provided by the Department of Plant Protection, Yangzhou University. Inoculation was performed using the embedding method (Pan Xuebiao, Journal of Jiangsu Agricultural College, 1997, (03): 28-33). A 1cm long and 2mm wide piece of wood covered with *Rhizoctonia solani* hyphae (enough to be fully coated with hyphae) was carefully embedded into the leaf sheath 1-2cm below the second leaf from the top of the rice plant. Leaf sheath tissues from the inoculum, 1cm above and below the inoculum, were harvested before inoculation (0h) and at 12h, 24h, 36h, and 48h after inoculation and frozen in liquid nitrogen. The experimental procedures for RNA extraction, reverse transcription, and qRT-PCR were the same as those for determining the expression levels in rice tissues.

[0036] like Figure 1 As shown in Figure A, the OsCRRLK34 gene is highly expressed in roots and leaves, and also expressed to some extent in leaf sheaths and spikelets, while its expression level is lowest in stems; Figure 1 As shown in B, the OsCRRLK34 gene was induced to be downregulated after infection with Rhizoctonia solani.

[0037] Example 3: Creation of OsCRRLK34 gene knockout material and identification of resistance to sheath blight

[0038] 1. Steps for constructing a CRISPR / Cas9 knockout vector using the rice OsCRRLK34 gene:

[0039] (1) Select a highly efficient knockout target site; design and synthesize an sgRNA that recognizes the target site, with the sequence: 5'-AATTGCTGCGAAGAAGCTT-3' (SEQ ID NO.9).

[0040] (2) The pCXUN-Cas9 vector was cleaved at specific restriction sites using restriction endonuclease Pst1 (Takara) and combined with sgRNA. The reaction system was as follows: 4 μL sgRNA; 2 μL linearized vector template after restriction enzyme digestion; 1 μL recombinase (Exnase II, Novizan Biosciences); 2 μL recombinant buffer (5×CEⅡBuffer, Novizan Biosciences); 1 μL H2O. The PCR instrument was run at 37℃ for 30 min and then stored on ice.

[0041] (3) Transform DH5α. After the competent DH5α cells are dissolved, add the ligation product from the previous step and spread it on an LB plate containing kanamycin. Incubate at 37°C for 1 day.

[0042] (4) Randomly select 12 single clones from the plate and place them into 2mL sterile EP tubes. Add 500μL of liquid LB containing kanamycin beforehand, and shake for 6h. Take 5μL of bacterial culture from each sample for PCR reaction. Select positive clones and sequence them for verification. The primer sequences for the PCR reaction are as follows:

[0043] oscrrlk34-ko-F: 5'-GCCATTTTCAGCCACACATT-3' (SEQ ID NO. 10), oscrrlk34-ko-R: 5'-AAAGAAGGTGGTGGAGCATA-3' (SEQ ID NO. 11);

[0044] For the correct positive clone, extract the plasmid and use the EZNATM Plasmid Midi Kit (OMEGA) to extract the recombinant plasmid.

[0045] (5) The recombinant positive plasmid was transformed into Agrobacterium EHA105. The system consisted of 20 μl Agrobacterium (EHA105) + 1 μL plasmid. The mixture was incubated on ice for 5 min, then flash-frozen in liquid nitrogen for 5 min, then incubated in water at 37°C for 5 min, and finally incubated on ice for 5 min. 100 μl of antibiotic-free LB was added, and the mixture was shaken at 200 rpm for 2 h at 28°C. The mixture was then directly plated on a kanamycin + rifampin plate and incubated at 28°C for two days.

[0046] (6) Verification of positive Agrobacterium single clones: Two days later, pick one single clone and place it in a 5ml sterile EP tube. Add 2ml of the corresponding bacterial antibiotic + rifampin beforehand, and shake the culture overnight. The next day, send the bacterial culture for sequencing. After the sequencing feedback is correct, the prepared Agrobacterium pCXUN-Cas9-OsCRRLK34 can be used for subsequent transformation experiments. The genetic transformation of the transgenes in the examples were all carried out by Wuhan Boyuan Biotechnology Co., Ltd. according to conventional transgenic technology experiments.

[0047] 2. The wild-type (WT) and knockout lines (oscrrlk34-ko1, oscrrlk34-ko2 and oscrrlk34-ko3) of this gene were identified for resistance to sheath blight using both greenhouse inoculation and in vitro inoculation methods.

[0048] (1) The method for identifying resistance to greenhouse sheath blight is as follows:

[0049] When the rice plants reach the 3-leaf stage, transplant them into rectangular pots, 5 plants per pot, and place them in a greenhouse with 14 hours of light (30℃) and 10 hours of darkness (24℃), and use a misting system for humidification. Inoculate the rice plants when they reach the early booting stage. Before inoculation, prune any naturally diseased or dead plants, as well as any small or excessive tillers. The inoculation method is manual embedding. Carefully place a 1cm long and 2mm wide piece of bark (covered with mycelium) containing *Rhizoctonia solani* hyphae into the leaf sheath 1cm below the second leaf from the bottom. Inoculate 5 seedlings per pot, and inoculate 5 stems from the same growth stage on each seedling. Inspect the length of lesions 14 days after inoculation.

[0050] (2) The method for identifying resistance to in vitro sheath blight is as follows:

[0051] When rice plants in the field reached the early heading stage, detached stem samples were taken. The rice stems were cut off, leaving only the flag leaf and the second leaf from the top. The samples were then placed in water overnight to allow the rice to acclimate to the climatic chamber environment and prevent water loss. The next day, inoculation was performed using the same embedding method. A 1cm long and 2mm wide piece of bark (covered with mycelium) was carefully placed 1cm below the leaf sheath of the second leaf from the top. After inoculation, the stems were inserted into test tube racks containing floral foam and then transferred to a nutrient solution. The plants were then placed in an environment with 14 hours of light (30℃), 10 hours of darkness (24℃), and 90% humidity. The length of lesions was assessed 7 days after inoculation.

[0052] The results are as follows Figure 2 As shown in Figure A, three transgenic knockout lines were obtained, named oscrrlk34-ko1, oscrrlk34-ko2, and oscrrlk34-ko3, respectively. oscrrlk34-ko1 has a 1-base deletion, oscrrlk34-ko2 has a 9-base deletion, and oscrrlk34-ko3 has a 4-base deletion. When using artificial inoculation in a greenhouse, such as... Figure 2 As shown in Figure B, the four groups of plants from left to right are wild-type, oscrrlk34-ko1, oscrrlk34-ko2, and oscrrlk34-ko3. The average lesion length of the three transgenic knockout lines oscrrlk34-ko1, oscrrlk34-ko2, and oscrrlk34-ko3 (17.18 cm, 19.09 cm, and 17.00 cm, respectively) was significantly longer than that of the wild-type plant (15.45 cm). When using in vitro inoculation, if... Figure 2 As shown in Figure C, the average lesion length of the three transgenic knockout lines oscrrlk34-ko1, oscrrlk34-ko2, and oscrrlk34-ko3 (14.11 cm, 14.77 cm, and 16.44 cm, respectively) was significantly longer than that of the wild-type plant (10.11 cm). These results indicate that the gene OsCRRLK34 positively regulates rice sheath blight resistance.

[0053] Example 4: Creation of OsCRRLK34 gene overexpression materials and identification of resistance to sheath blight

[0054] 1. The construction steps of the overexpression vector and materials are as follows:

[0055] (1) Using the cDNA of the sheath blight resistant germplasm YSBR1 as a template, primers for amplifying the OsCRRLK34 gene were designed. The primer sequences are as follows:

[0056] OsCRRLK34-F:5'-CGAACGATAGCCGGTACCATGCTTAAAGATGGGA CA-3' (SEQ ID NO.3),

[0057] OsCRRLK34-R: 5'-ATTGTCAATATGCTCAGTCATGGCATATACGATCT C-3' (SEQ ID NO. 4).

[0058] The OsCRRLK34 gene sequence was obtained by amplification using high-fidelity DNA polymerase. The PCR program was as follows: pre-denaturation: 95℃ for 5 min; denaturation: 95℃ for 30 s; annealing: 60℃ for 30 s; extension: 72℃ for 5 min; 34 cycles; total extension for 5 min. The product was stored at 4℃ after the reaction.

[0059] (2) The overexpression vector pCAMBIA1390 with the strong promoter Ubi was linearized by digesting it with the restriction endonuclease PstI (Takara).

[0060] (3) The target gene and the linearized vector digested by enzyme digestion were ligated using homologous recombinase (Novizan ClonExpress II One Step Cloning Kit reagent).

[0061] (4) The ligation product was introduced into competent DH5α cells, and positive single clones were selected and sequenced on LB medium containing kanamycin. After verification, the OsCRRLK34-OE vector was successfully constructed.

[0062] The constructed knockout vector plasmid and overexpression plasmid were sent to Wuhan Boyuan Biotechnology Co., Ltd. for rice genetic transformation. The recipient rice variety was NIP (Nipponbare).

[0063] After the genetic transformation of rice is completed, the primer sequences of the overexpression vector are detected.

[0064] OsCRRLK34-OE-F: AGAGAGGACATCATTGCT (SEQ ID NO. 12),

[0065] OsCRRLK34-OE-R:CGATGTCGTGGTCCTTAT (SEQ ID NO. 13).

[0066] (5) For overexpressing plants, all T0 individual plants were first detected by Western blotting using GFP antibody; then, the RNA level of lines with high protein expression was further detected. The primer sequences for qRT-PCR were: QOsCRRLK34-F: AAGGCTCTTGGGTGAAGAACAA (SEQ ID NO.7), QOsCRRLK34-R: TGCTGGAGGCAATTTGTGTCTA (SEQ ID NO.8).

[0067] 2. Resistance to sheath blight was identified in overexpressing lines of this gene using both greenhouse inoculation and in vitro inoculation methods. The method described in Example 3 above was employed.

[0068] Three independent T0 generation transgenic overexpression lines with significantly increased expression levels of both the OsCRRLK34 gene and protein were obtained by Western blotting and qRT-PCR, and were named OsCRRLK34-OE1, OsCRRLK34-OE2, and OsCRRLK34-OE3, respectively. Figure 3 (As shown in AB). When using artificial inoculation in a greenhouse, such as... Figure 3 As shown in Figure C, the four groups of plants from left to right are: wild type, OsCRRLK34-OE1, OsCRRLK34-OE2, and OsCRRLK34-OE3. The average lesion length of the three transgenic overexpression lines OsCRRLK34-OE1, OsCRRLK34-OE2, and OsCRRLK34-OE3 (11.55 cm, 11.50 cm, and 10.48 cm, respectively) was significantly shorter than that of the wild type plant (15.45 cm). When using in vitro inoculation, if... Figure 3 As shown in Figure D, the average lesion length of the three transgenic overexpression lines OsCRRLK34-OE1, OsCRRLK34-OE2, and OsCRRLK34-OE3 (7.22 cm, 7.42 cm, and 7.44 cm, respectively) was significantly shorter than that of the wild-type plant (10.11 cm). These results indicate that the gene OsCRRLK34 positively regulates rice sheath blight resistance, and overexpression of this gene can significantly enhance rice sheath blight resistance.

[0069] While specific embodiments have been provided in this invention, it should be understood that further modifications can be made to the invention. In summary, in accordance with the principles of this invention, this application is intended to include any changes, uses, or improvements to the invention, including modifications made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. OsCRRLK34 The application of genes in regulating disease resistance in rice is characterized by, The OsCRRLK34 The gene sequence is shown in SEQ ID NO.1, and the disease resistance is resistance to sheath blight.

2. The application according to claim 1, characterized in that, The OsCRRLK34 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

3. A method for cultivating highly disease-resistant rice, characterized in that, Including the application described in claim 1 OsCRRLK34 Genes that increase a plant's resistance to sheath blight and reduce its susceptibility to the disease.

4. The method according to claim 3, characterized in that, The overexpression process includes the following: OsCRRLK34 The gene was amplified, digested with enzymes, and ligated into the pCAMBIA1390 vector. It was then transformed with E. coli and sequenced for verification. The plasmid was extracted and transformed into Agrobacterium, which mediated its introduction into the plant.

5. The method according to claim 4, characterized in that, The sequences of the amplified primer pairs are shown in SEQ ID NO.3 and SEQ ID NO.4.

Images