Chrysanthemum CyMYB14 gene and application thereof
By cloning and identifying the CyMYB14 gene of chrysanthemum and regulating its expression using gene overexpression or silencing technology, the problem of low efficiency in improving the chrysanthemum branching traits in the prior art is solved, and precise regulation of chrysanthemum branching is achieved, and technical support is provided for the cultivation of high-quality chrysanthemum varieties.
Patent Information
- Application Number
- CN202510482767.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-17
- Publication Date
- 2025-06-13
- Estimated Expiration
- 2045-04-17
AI Technical Summary
The prior art has problems of long cycles, low efficiency, and difficulty in improving chrysanthemum branching traits. It lacks in-depth understanding of the molecular mechanism of chrysanthemum branching regulation, which cannot meet the demand of modern flower industry for high-quality chrysanthemum varieties.
By cloning and identifying the CyMYB14 gene of chrysanthemum, bioinformatics analysis was performed, and plant expression vectors were designed to overexpress or inhibit the CyMYB14 gene to regulate the branching formation of chrysanthemum.
Successfully promoting or inhibiting the branching formation of chrysanthemums provides a basis for the branching regulation of chrysanthemums, and provides available genes for the cultivation of new chrysanthemum varieties of different types, improving breeding efficiency.
Smart Images

Figure CN120137995A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a chrysanthemum CyMYB gene, in particular to a chrysanthemum CyMYB14 gene and its application, belonging to the technical field of chrysanthemum CyMYB genes. Background Art
[0002] Currently, the improvement of chrysanthemum branching traits mainly relies on traditional breeding methods such as cross-breeding and mutagenesis breeding. Although these methods have achieved some results to a certain extent, they have the disadvantages of long cycle, low efficiency, and difficulty in directional improvement. Moreover, due to the lack of in-depth understanding of the molecular mechanism of chrysanthemum branching regulation, it is difficult for traditional breeding methods to precisely control the number of branches and plant type, and cannot meet the needs of the modern flower industry for high-quality chrysanthemum varieties. Therefore, a chrysanthemum CyMYB14 gene and its application are designed to solve the above problems. Summary of the Invention
[0003] The main purpose of the present invention is to provide a chrysanthemum CyMYB14 gene and its application.
[0004] The object of the present invention can be achieved by adopting the following technical solutions: A chrysanthemum CyMYB14 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0005] Preferably, the protein amino acid sequence of this gene is shown in SEQ ID NO.2.
[0006] Preferably, after introducing a vector containing the chrysanthemum CyMYB14 gene into a host bacterium, a recombinant bacterium is obtained, and the recombinant bacterium can express the protein encoded by the chrysanthemum CyMYB14 gene.
[0007] Preferably, a vector is provided for the chrysanthemum CyMYB14 gene, and this vector contains the complete coding sequence of the chrysanthemum CyMYB14 gene and can stably exist and express the chrysanthemum CyMYB14 gene in host cells.
[0008] An application of a chrysanthemum CyMYB14 gene, promoting chrysanthemum branching by overexpressing the chrysanthemum CyMYB14 gene, or inhibiting chrysanthemum branching by inhibiting the expression of the chrysanthemum CyMYB14 gene.
[0009] Preferably, the method for overexpressing the chrysanthemum CyMYB14 gene includes the following steps: Construct a plant expression vector containing the chrysanthemum CyMYB14 gene; Transform the vector into Agrobacterium tumefaciens, and then use the Agrobacterium-mediated method to transform chrysanthemum cells; Furthermore, a chrysanthemum plant overexpressing the chrysanthemum CyMYB14 gene is cultivated.
[0010] Preferably, the method for inhibiting the expression of the chrysanthemum CyMYB14 gene includes using virus-induced gene silencing technology; Construct a VIGS vector containing a fragment of the chrysanthemum CyMYB14 gene, transform Agrobacterium, and then infect chrysanthemum plants to achieve silencing of the chrysanthemum CyMYB14 gene.
[0011] Advantageous technical effects of the present invention: The present invention provides a chrysanthemum CyMYB14 gene and its application. By combining transcriptome data, a chrysanthemum CyMYB14 gene was cloned and identified, and bioinformatics analysis was performed.
[0012] Based on qRT-PCR, the expression of CyMYB14 in different tissues of chrysanthemum, empty vector, overexpression, and VIGS in chrysanthemum materials was determined; and the phenotypes of transgenic and VIGS plants were analyzed to verify the function of CyMYB14 in chrysanthemum.
[0013] The results showed that chrysanthemum CyMYB14 promotes the formation of more branches in various chrysanthemum varieties, laying a foundation for the regulation of chrysanthemum branching, and at the same time providing available genes for the cultivation of new chrysanthemum varieties with different plant types. Description of the Drawings
[0014] Figure 1 It is the amplification diagram of the CDS sequence of CyMYB14; Figure 2 It is the conserved domain diagram of the CyMYB14 protein; Figure 3 It is the phylogenetic relationship diagram of CyMYB14 in creeping chrysanthemum and MYB14 in other species; Figure 4 It is the diagram showing the expression of CyMYB14 in different tissues of chrysanthemum; Figure 5 It is the subcellular localization diagram of CyMYB14; Figure 6 It is the phenotypic comparison diagram of CyMYB14 transgenic plants and wild type under tissue culture conditions. The part pointed by the red arrow is the axillary bud; Figure 7 It is the phenotypic comparison diagram of CyMYB14 transgenic plants and wild type under potted planting conditions; Figure 8 It is the relative expression level of the plant after silencing of the CyMYB14 gene and the control group. Different lowercase letters indicate significant differences (P < 0.05) diagram; Figure 9 It is the phenotypic comparison of the plant after silencing of the CyMYB14 gene and the control group. The part pointed by the red arrow is the axillary bud. Detailed Embodiments
[0015] To make the technical solutions of the present invention clearer and more definite to those skilled in the art, the present invention will be further described in detail below in conjunction with embodiments and drawings. However, the implementation manners of the present invention are not limited thereto.
[0016] Embodiment
[0017] Materials and Methods Strains, Vectors and Reagents DH5α Escherichia coli competent cells and GV3101 Agrobacterium competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd. The pCloneEZ-Blunt / TA TOPO Cloning Kit vector cloning kit was purchased from Sino-US Taihe Biotechnology Co., Ltd. The recombinant plasmid pSuper1300:GFP was stored in this laboratory.
[0018] The EASYspin Plus Plant RNA Rapid Extraction Kit, Agarose Gel Purification and Recovery Kit, and Endotoxin-Free Plasmid Mini Midiprep Kit were all purchased from Beijing Aidlab Biotechnologies Co., Ltd.
[0019] The PrimeScript™ II 1st Strand cDNA Synthesis Kit, PrimeSTAR® Max DNA Polymerase, PrimeScript™ FAST RT reagent Kit with gDNA Eraser, TB Green® Premix Ex Taq™ II (Tli RNaseH Plus), and In-Fusion HD Cloning kits were all purchased from Takara Biotechnology (Beijing) Co., Ltd.
[0020] The 2×Rapid Taq Plus Master Mix (Dye Plus) and 2×Rapid Taq Master Mix were purchased from Nanjing Novoprotein Scientific Inc. The restriction endonucleases Kpn I, Apa I, XbaⅠ, and EcoR Ⅰ were purchased from NEB. LB Broth and agar were purchased from Beijing Coolaber Technology Co., Ltd. Kanamycin (Kan), Rifampicin (Rif) were all purchased from INALCO. The MS medium, sucrose, agar powder, 6-BA, NAA, sodium carbenicillin, cefotaxime sodium, 50×TAE electrophoresis buffer, and hygromycin were all purchased from Beijing Biolab Biotechnology Co., Ltd. MgCl2, 2-(N-morpholino)ethanesulfonic acid (MES), and acetosyringone (AS) were all purchased from Beijing Zhongke Yubo Biotechnology Co., Ltd.
[0021] Full-Length Gene Cloning Using chrysanthemum leaf buds as samples, RNA was extracted and reverse-transcribed into cDNA, which was then stored at -20 °C for later use. According to the full-length transcript sequence, full-length primers containing the complete ORF of CyMYB14 were designed using Primer3Plus and synthesized by Beijing Ruibo Xingke Biotechnology Co., Ltd. Using cDNA as a template, high-fidelity enzymes were used for PCR amplification. After gel extraction of the amplification products, they were constructed into the pEASY®-Blunt Cloning Vector, transferred into Escherichia coli DH5α, spread on plates, and single colonies were picked and cultured in a small shaker for 12 h, and then sent to Beijing Ruibo Xingke Biotechnology Co., Ltd. for sequencing and identification.
[0022] Vector construction; Using the correctly identified recombinant plasmid as a template, CyMYB14 was amplified with primers added with the corresponding vector adapters. After gel extraction, they were respectively constructed onto the corresponding digested vectors. Escherichia coli DH5α was transformed, single colonies were picked and sequenced. After confirmation, the plasmids were extracted and transferred into the competent cells of Agrobacterium tumefaciens GV3101. They were spread on plates, single colonies were picked and cultured in a small shaker, and then PCR bacterial inspection was carried out. The qualified transformed single colonies were stored for later use.
[0023] Subcellular localization; The pSuper1300-eGFP and pSuper1300-CyMYB14-eGFP plasmids were transferred into the competent cells of the GV3101 strain. Using Nicotiana benthamiana plants cultured for about 4 weeks as materials, transient overexpression was carried out. The specific steps are as follows: a. Take 100 μL of the GV3101 strain transfected with pSuper1300-eGFP and pSuper1300-CyMYB14-eGFP and spread it on an LB medium supplemented with Rif and Kan antibiotics, and incubate at 28 °C until obvious single colonies are formed; b. Pick a single colony and resuspend it in 1 mL of LB liquid medium, and culture it overnight at 28 °C and 200 rpm; c. Take 0.5 mL of the bacterial liquid and resuspend it in 50 mL of liquid LB medium, and shake and culture at 28 °C and 200 rpm until OD600 = 0.8 - 1.0; d. The obtained bacterial liquid was centrifuged at 5000 rpm for 10 min to collect the bacteria, and the bacteria were resuspended with a resuspension solution (MS + 10 mM MES + 10 mM MgCl 2 + 200 μM acetosyringone), and the OD600 was adjusted to 0.6, and incubated in the dark for 2 - 3 h to obtain an infection solution; e. Inject the infection solution into the back of the tobacco leaves using a 1 mL disposable syringe until obvious water stains are formed; f. Place the injected tobacco in the dark at 25 °C for cultivation; g. After 24 h of injection, take pictures and observe every 12 h.
[0024] Overexpression in chrysanthemum; Use the In-Fusion method to construct the CyMYB14 plant expression vector. Select Apa Ⅰ and Kpn Ⅰ as restriction enzyme sites, and design primers according to the Takara seamless cloning kit (CyMYB14-1300-F: GAAAGCTTCTGCAGGATGGTTAGAGCTCCATGTTG, CyMYB14-1300-R: CCCTTGCTCACCATGTATTTGTGGTAATTCTTCTCC). Construct the CDS sequence of CyMYB14 onto the pSuper1300 vector, and use the plasmid with correct sequencing by the company for subsequent Agrobacterium transformation work.
[0025] Basic medium: 4.4 g / L MS + 30 g / L sucrose + 7 g / L agar + 1 L distilled water, pH = 5.8.
[0026] Pre-culture medium: 4.4 g / L MS + 30 g / L sucrose + 1 ml 6-BA + 700 μL NAA + 7 g / L agar + 1 L distilled water, pH = 5.8.
[0027] Co-culture medium: 4.4 g / L MS + 30 g / L sucrose + 1 ml 6-BA + 700 μL NAA + 7 g / L agar + 1 L distilled water, pH = 5.8 Meristem medium: 4.4 g / L MS + 30 g / L sucrose + 1 ml 6-BA + 700 μL NAA + 7 g / L agar + 1 L distilled water + 4 ml carbenicillin, pH = 5.8 Differentiation medium: 4.4 g / L MS + 30 g / L sucrose + 1 ml 6-BA + 700 μL NAA + 7 g / L agar + 1 L distilled water + 4 ml carbenicillin + 50 μL hygromycin, pH = 5.8 Rooting medium: 4.4 g / L MS + 30 g / L sucrose + 7 g / L agar + 1 L distilled water + 4 ml carbenicillin + 50 μL hygromycin, pH = 5.8 Transformation and infection; Cut the leaves of 'Pudi Danfen' into squares with a size of 0.8 - 1.0 cm and culture them in the intervention culture medium for 1 - 2 d; ② After the pre-culture, place the leaf discs in the infection solution for infection for 7 min. After the infection, place the leaf discs in the co-culture medium for co-culture for 2 d; ③ After co-culture, place the leaf discs in a meristem culture medium for 3 days; ④ After meristem culture, transfer the leaf discs to a differentiation medium and change the medium every 10 - 15 days; ⑤ After adventitious buds appear on the leaf discs, transfer them to a rooting medium.
[0028] VIGS; Using the full-length plasmid of CyMYB14 from Wedelia prostrata as a cDNA template, design primers for the silencing fragment of a 200 - 300 bp fragment in the non-conserved domain of the CDS region (CyMYB14-TRV2-F: TAAGGTTACCGAATTTCAAACAAGTTACAATCAAGTTG, CyMYB14-TRV2-R: ATGGAGGCCTTCTAGACTCGTAAACACATCCACTTGG).
[0029] The PCR amplification system and procedure refer to 2.2.2 (3). After PCR amplification, purify and recover the products, then perform the transformation and screening of Escherichia coli and sequence confirmation of the bacterial liquid for use in transformation.
[0030] Vacuum infiltration for transient transformation of Wedelia prostrata ① Take the bacterial liquid with correct bands identified by bacterial liquid PCR and perform enlarged culture in 25 ml of LB liquid medium containing kanamycin and rifampicin, and shake culture in a shaking incubator at 28 °C for 20 - 24 h.
[0031] ② Place the enlarged bacterial liquid in ① into 300 ml of LB liquid medium containing kanamycin and rifampicin and continue to perform enlarged culture, and shake culture for 24 h.
[0032] ③ Centrifuge at 5000 rpm for 10 min at room temperature to collect the bacteria.
[0033] ④ After centrifugation, remove the supernatant, resuspend the bacteria with buffer, adjust the OD600 value of the bacterial liquid to OD600 = 2.0, and let it stand at 28 °C for 2 - 3 h.
[0034] ⑤ Immerse the one-month-old cuttings of Wedelia prostrata completely in the infection solution and perform vacuum infiltration for 20 min.
[0035] ⑥ After vacuum infiltration, wash the excess bacterial liquid on the plant surface and replant it back into the substrate.
[0036] ⑦ Observe the phenotype and count the data after the plants grow for 1 - 2 months.
[0037] Results and analysis Cloning and analysis of CyMYB4 gene Based on the existing CyMYB14 sequence information in the transcriptome data of the third generation of Erigeron karvinskianus, specific primers CyMYB14-F and CyMYB14-R were designed. Using the cDNA of the stem tissue of Erigeron karvinskianus as a template, PCR amplification of the full length of CyMYB14 was carried out, and a PCR product with a size of approximately 750 bp was obtained ( Figure 1 ). After purification and recovery of the target fragment, it was ligated to the TOPO cloning vector and transformed into Escherichia coli competent cells. Subsequently, single colonies were picked for further culture, and after the culture was completed, it was sent to the company for sequencing. The sequencing results showed that the full length of the CDS region of the CyMYB14 gene was 759 bp, encoding a total of 252 amino acids. It was completely consistent with the reference sequence, and no base deletions, insertions or mutations were found, indicating that the cloning of CyMYB14 was successful.
[0038] The CyMYB14 protein sequence was submitted to the CD-search tool (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi) on the NCBI online website for the prediction of conserved domains. The results are shown in the figure. CyMYB14 has a typical MYB conserved domain at the N-terminus, proving that CyMYB14 belongs to the MYB transcription factor family ( Figure 2 ). Further analyzing its structural characteristics, the DNAMAN software was used to further perform multiple sequence alignments of the CyMYB14 protein sequence of Erigeron karvinskianus with the MYB14 protein sequences from Arabidopsis thaliana, Oryza sativa, Helianthus annuus, Artemisia annua, Lactuca sativa, and Populus alba. The alignment results showed that the CyMYB14 protein sequence had a high degree of similarity with the MYB14 protein sequences of these plants in the conserved region, all containing the typical R2R3-MYB domain characteristics. The R2 domain contained 3 conserved tryptophan residues (W), while the R3 domain contained 2 conserved tryptophan residues (W), and their spacing patterns were highly consistent. These results indicated that CyMYB14 belongs to the R2R3-MYB subfamily of the MYB transcription factor family.
[0039] The CyMYB14 protein sequence of C. yantaiense was compared with Amborellatrichopoda, Aristolochia fimbriata, representative monocot species such as maize (Zeamays) and rice (Oryza sativa), as well as dicot plants such as grape (Vitis vinifera), poplar (Populustrichocarpa), Arabidopsis thaliana, coffee (Coffea arabica), tomato (Solanumlycopersicum), and Asteraceae plants such as lettuce (Lactuca sativa), sunflower (Helianthus annuus), burdock (Arctium lappa), Artemisia tridentata, Artemisia annua, Artemisia argyi, Crossostephium chinense, Chrysanthemumindicum, and Chrysanthemum lavandulifolium and Chrysanthemum indicum'Nankingense' were aligned, and a phylogenetic tree was constructed based on the Neighbor-Joining (NJ) method in MEGA software. Figure 3 ), since C. lavandulifolium is a tetraploid, four copies of CyMYB14 were identified in its three-generation transcriptome. Phylogenetic analysis showed that CyMYB14 of C. lavandulifolium was most closely related to the homologous sequence of C. lavandulifolium, and clustered in the same evolutionary branch with Asteraceae plants such as C. indicum 'Nankingense'. This clustering relationship result shows the high conservation of Asteraceae plants during evolution.
[0040] Analysis of CyMYB14 gene expression pattern Total RNA was extracted from the roots, stems, leaves, and buds of the creeping chrysanthemum and reverse transcribed into cDNA. The relative expression of the CyMYB14 gene in these tissues was then detected by real-time quantitative PCR (qRT-PCR) and statistically analyzed. Figure 4As shown, CyMYB14 is expressed in the roots, stems, leaves, and buds of creeping chrysanthemum, but there are significant differences in its expression levels, with the highest expression in buds, followed by roots and leaves, and the lowest expression in stems (buds > roots > leaves > stems). This expression pattern indicates that the expression of CyMYB14 has obvious tissue specificity, especially showing a significantly high expression level in buds, suggesting that CyMYB14 may play an important role in the growth, development, or physiological regulation of creeping chrysanthemum buds.
[0041] Subcellular localization of CyMYB14 in tobacco The results of subcellular localization showed that in tobacco leaf epidermal cells transfected with the empty vector plasmid, the GFP green fluorescence signal was evenly distributed throughout the cell, including the cell membrane and nucleus. In tobacco leaf epidermal cells transfected with the CyMYB14-GFP recombinant plasmid, the green fluorescence signal was specifically localized only in the nucleus ( Figure 5 ).
[0042] This indicates that the CyMYB14 protein was successfully expressed in Nicotiana benthamiana leaf epidermal cells and specifically localized in the nucleus, and may play its biological function as a transcription factor in the nucleus.
[0043] Overexpression of CyMYB14 promotes branching in chrysanthemum Under tissue culture conditions, obvious axillary bud formation occurred in the transgenic lines, while axillary bud formation was not observed in wild-type plants ( Figure 6 ). Two months after acclimatization and transplantation, the plant type of the transgenic lines was denser than that of the wild type, and the number of branches formed by the elongation growth of axillary buds was significantly higher than that of the wild type ( Figure 7 ).
[0044] These results indicate that overexpression of CyMYB14 promotes axillary bud formation, thereby enhancing the branching ability and further changing the plant type structure of chrysanthemum.
[0045] Silencing of CyMYB14 inhibits the formation of lateral buds in chrysanthemum qRT-PCR analysis found that the expression level of CyMYB14 in gene-silenced plants was significantly downregulated, indicating that gene silencing was effective ( Figure 8 ).
[0046] Compared with the control group, three months after transplantation, lateral buds had emerged in the wild type, while the axillary buds of CyMYB14 gene-silenced plants were severely inhibited, further demonstrating the positive regulatory role of CyMYB14 in axillary bud formation ( Figure 9 ).
[0047] In this invention, combined with transcriptome data, a chrysanthemum CyMYB14 gene was cloned and identified, and bioinformatics analysis was carried out.
[0048] The expression of CyMYB14 in different tissues of chrysanthemum was determined based on qRT-PCR; and the promotion of chrysanthemum branch formation by CyMYB14 was demonstrated by combining transgenic overexpression and virus-induced gene silencing, laying a foundation for the regulation of chrysanthemum branches and providing available genes for the cultivation of new chrysanthemum varieties with different plant types.
[0049] As described above, it is only a further embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the scope disclosed by the present invention, according to the technical solution and its concept of the present invention, makes equivalent substitutions or changes, all belong to the protection scope of the present invention.
Claims
1. A chrysanthemum CyMYB14 gene, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. The chrysanthemum CyMYB14 gene according to claim 1, characterized in that: The protein amino acid sequence of the gene is shown in SEQ ID NO.
2.
3. The chrysanthemum CyMYB14 gene according to claim 2, characterized in that: The recombinant bacteria are obtained by introducing a vector containing the chrysanthemum CyMYB14 gene into a host bacterium, and the protein encoded by the chrysanthemum CyMYB14 gene can be expressed by the recombinant bacteria.
4. The chrysanthemum CyMYB14 gene according to claim 3, characterized in that: A vector is provided for the chrysanthemum CyMYB14 gene, which contains the complete coding sequence of the chrysanthemum CyMYB14 gene and can stably exist and express the chrysanthemum CyMYB14 gene in a host cell.
5. An application of the chrysanthemum CyMYB14 gene, based on the chrysanthemum CyMYB14 gene according to any one of claims 1 to 4, characterized in that: Chrysanthemum branching is promoted by overexpressing the chrysanthemum CyMYB14 gene, or chrysanthemum branching is inhibited by inhibiting the expression of the chrysanthemum CyMYB14 gene.
6. The application of the chrysanthemum CyMYB14 gene according to claim 5, characterized in that: The method for overexpressing the chrysanthemum CyMYB14 gene comprises the following steps: Constructing a plant expression vector containing the chrysanthemum CyMYB14 gene; The vector is transformed into Agrobacterium, and then transformed into chrysanthemum cells using Agrobacterium-mediated method; Then, chrysanthemum plants overexpressing the chrysanthemum CyMYB14 gene were cultivated.
7. The application of chrysanthemum CyMYB14 gene according to claim 6, characterized in that: Methods for inhibiting the expression of the chrysanthemum CyMYB14 gene include using virus-induced gene silencing technology; A VIGS vector containing a gene fragment targeting chrysanthemum CyMYB14 was constructed, transformed with Agrobacterium and then infected into chrysanthemum plants to achieve silencing of the chrysanthemum CyMYB14 gene.
Citation Information
Patent Citations
MYB transcription factor implicated in anthocyanin biosynthesis regulation
CN104774251A
Rhodomyrtus tomentosa MYB transcription factor RtMYB1 and application thereof
CN116410284A
Chrysanthemum morifolium gene CmWOX8 and application thereof
CN116904481A
Application of chrysanthemum transcription factor CmRAX2 in promoting axillary bud growth or increasing bud number
CN119120541A
Constitutively active form of MYB46
US20220340924A1