A vector for preparing circular RNA and application thereof
By constructing and optimizing a type II intron self-splicing system, the problems of insufficient circular RNA circularization efficiency and exogenous protein expression were solved, achieving efficient circularization and protein expression. This system is suitable for the preparation of circular RNA and the expression of exogenous proteins, making it suitable for industrial production.
Patent Information
- Application Number
- CN202510254305.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2024-03-14
- Filing Date
- 2025-03-04
- Publication Date
- 2026-01-13
- Estimated Expiration
- 2045-03-04
AI Technical Summary
In the existing technology, the type II intron self-splicing system has insufficient circularization efficiency and exogenous protein expression level in the preparation of circular RNA, and requires the addition of additional excipients such as GTP, which limits its application scope and efficiency.
By constructing and optimizing IIC, IIE, and IIF type intron self-splicing systems, circular RNA can be prepared using wild-type or modified type II intron sequences, achieving efficient circularization and exogenous protein expression without the need for additional GTP.
It improves the cyclization efficiency and protein expression level of the type II intron self-splicing system, with mild conditions suitable for in vitro and in vivo applications and industrial production.
Smart Images

Figure BDA0005298586080000171 
Figure BDA0005298586080000181 
Figure BDA0005298586080000191
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a vector for preparing circular RNA and its application. Background Technology
[0002] Circular RNA (RRNA) is a type of closed RNA molecule without naked 5' and 3' ends. It is not easily degraded by exonucleases and is therefore relatively stable in vivo and in vitro. RRNA exists in most organisms; in eukaryotes, RRNA is mainly formed through back-splicing.
[0003] With the widespread application of high-throughput sequencing technology, the regulatory role of circular RNA (circRNA) in vivo has gradually attracted the attention of scientists. This includes its role as a sponge molecule for microRNAs, inhibiting the regulation of mRNA by microRNAs, binding to specific proteins and regulating the function of related proteins, and regulating gene transcription in the cell nucleus. Analysis of circRNA sequences has revealed that some circRNA sequences contain complete open reading frames, suggesting that some circRNAs may encode proteins or small peptides. In 2015, a research team edited ribosome binding sites (IRES) into circRNAs, demonstrating that circRNAs, like mRNAs, can be translated into proteins. In 2017, Israeli researchers systematically analyzed the translational ability of circRNAs in Drosophila cells, indicating that circRNAs can serve as templates for ribosome translation, producing peptides, etc. In 2018, MIT researchers used the permute intron-exon (PIE) method to synthesize highly pure circRNAs in vitro and demonstrated that in vitro synthesized circRNA molecules also have translational function in mammalian cells, opening up applications for circRNAs in the medical field. In 2023, researchers delivered circular RNA carrying the trimer sequence of the SARS-CoV-2 virus S protein into mice and rhesus monkeys via LNP, obtaining effective cellular and humoral immunity results, demonstrating that circular RNA can be applied in the field of vaccines.
[0004] Ribozymes in nature are mainly classified into small ribozymes and large ribozymes according to sequence length. Small ribozymes are generally derived from satellite RNA of certain animal and plant viruses, such as hammerhead ribozymes, hairpin ribozymes, hepatitis D virus RNA, Varkud satellite ribozymes, and GlmS nuclear switches. Large ribozymes mainly include type I introns, type II introns, RNase P, and ribosomal large and small subunit RNAs. Type I introns are widely used in in vitro RNA circularization, while type II introns are relatively less common. This patent focuses on type II introns, systematically studying their application in in vitro RNA circularization technology. The preparation of circular RNA using IIB intron sequences has been reported, but the circularization efficiency needs further improvement. In addition to IIB, type II introns also include IIC, IIE, and IIF. Currently, there are no reports on the preparation of circular RNA expressing exogenous proteins based on other type II intron self-splicing systems, nor on their application in disease prevention and treatment. Summary of the Invention
[0005] This disclosure relates to a class of nucleic acid molecules based on type II intron self-splicing systems for the in vitro preparation of circular RNA, their applications, and preparation methods. By constructing and optimizing IIC, IIE, and IIF intron self-splicing systems, this invention has determined that other type II intron self-splicing systems can be used to form circular RNA and express exogenous proteins in vivo and in vitro, improving the circumduction efficiency and protein expression levels of type II intron self-splicing systems. This invention confirms that wild-type or optimized IIC introns from different sources (such as *Bacillus marineis*, *Bacillus tetanus*, halophilic *Bacillus*, and *Streptococcus agalactiae*) possess self-splicing capabilities, producing circular RNA with high circumduction efficiency, mild reaction conditions, and without the need for excipients such as GTP. Simultaneously, it successfully prepared circular RNA expression systems capable of carrying exogenous sequences of different lengths or without exogenous intron sequences, and successfully achieved efficient expression of exogenous proteins in vivo and in vitro. The IIE and IIF intron self-splicing systems also achieve efficient circumduction.
[0006] In a first aspect, the present invention provides a nucleic acid molecule comprising a 3' type II intron fragment, a 5' type II intron fragment, and a protein-coding or non-coding region, wherein the nucleic acid molecule is capable of producing biologically active circular RNA.
[0007] In some embodiments, the 3' type II intron fragment and the 5' type II intron fragment are derived from type IIC introns, type IIE introns, or type IIF introns.
[0008] In some embodiments, the nucleic acid molecule may be a chain of deoxyribonucleic acid (DNA) or a chain of ribonucleic acid (RNA).
[0009] In some embodiments, the nucleic acid molecule further comprises one or more elements selected from the following: a 5' spacer sequence, a Kozak sequence, and a 3' spacer sequence.
[0010] In some embodiments, the nucleic acid molecule comprises the following elements operatively linked to each other:
[0011] (1) 3' type II intron fragment;
[0012] (2) Optional 5' interval subsequence;
[0013] (3) Internal ribosome entry site (IRES);
[0014] (4) Optional Kozak sequence;
[0015] (5) Protein-coding or non-coding regions;
[0016] (6) Optional 3' interval subsequence;
[0017] (7) 5'II type intron fragment;
[0018] The nucleic acid molecule can generate circular RNA through its self-splicing.
[0019] In some embodiments, the 3' type II intron fragment and the 5' type II intron fragment are derived from type II intron sequences.
[0020] In some preferred embodiments, the 3' type II intron fragment and the 5' type II intron fragment are derived from type IIC introns, type IIE introns, or type IIF introns.
[0021] In some embodiments, the 3' type II intron fragment and the 5' type II intron fragment are derived from *Oceanobacillus iheyensis*, *Bacillus halodurans*, *Streptococcus pneumoniae*, *Streptococcus agalactiae*, *Thermoanerobacter italicus*, *Pseudomonas putida*, *Pseudomonas alcaligenes*, *Geobacillus stearothermophilus*, *Clostridium acetobutylicum*, *Microscilla sp.*, *Azotobacter vinelandii*, *Serratia marcescens*, *Nitrosomonas europaea*, and *Dechloromonas*. Type II introns of the following bacteria, including *Aromatica*, *Geobacter uranium-reducens*, *Myxocous xanthus*, *Nitrobacter hamburgensis*, *Pelotomaculum thermopropionicum*, *Candidatus Solibacter usitatus*, *Bradyrhizobium diazoefficiens*, *Chlorobium phaeobacteroides*, *Photorhabdus iuminescens*, *Sinorhizobium meliloti*, *Bradyrhizobium japonicum*, or *Clostridium beijerinckii*, or type II introns with one or more nucleotide deletions, substitutions, or additions.
[0022] In some preferred embodiments, the 3' type II intron fragment and the 5' type II intron fragment are derived from type II introns such as *Thermosynthetiocytogenes itariica*, *Bacillus marineus*, *Bacillus halophilus*, *Streptococcus agalactiae*, *Rhizobium japonicum*, *Geobacterium uranium-reducing*, or *Clostridium bengalicum*, or type II introns having one or more nucleotide deletions, substitutions, or additions.
[0023] In some embodiments, the IRES are derived from: Coxsackievirus B3 (CVB3), Coxsackievirus B1 (CVB1), Coxsackievirus B5 (CVB5), echovirus, human rhinovirus (HRV), poliovirus (PV), simian enterovirus SA5 (SimianA5), simian enterovirus SV4 (SimianV4), aura syndrome virus, blood-sucking assassin bug virus, Tyrell's encephalomyelitis virus, simian virus 40, red imported fire ant virus 1, grain constrictor aphid virus, reticuloendotheliosis virus, and Forman's disease virus. Poliovirus 1, Soybean Lobe Virus, Kashmir Bee Virus, Human Rhinovirus 2, Glass Leafhopper Virus-1, Human Immunodeficiency Virus Type 1, Glass Leafhopper Virus-1, Lice P Virus, Hepatitis C Virus, Hepatitis A Virus, GB Hepatitis Virus, Foot-and-Mouth Disease Virus, Human Enterovirus 71, Equine Rhinovirus, Tea Lobe-like Virus, Encephalocarditis Virus (EMCV), Fruit Fly C Virus, Cruciferae Tobacco Virus, Cricket Paralysis Virus, Bovine Viral Diarrhea Virus 1, Black Queen Cell Virus, Aphid Lethal Paralysis Virus, Avian Encephalomyelitis Virus, Acute Bee Paralysis Virus, Hibiscus Yellow spot virus, classical swine fever virus, human FGF2, human SFTPA1, human AML1 / RUNX1, Drosophila antennae, human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAPl, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kipl, human PDGF2 / c-sis, human p53, human Pim-1, mouse Rbm3 IRES of Drosophila reaper, canine camper, Drosophila Ubx, salivary viruses, Coxsackieviruses, bi-Echoviruses, human UNR, mouse UtrA, human VEGF-A, human XIAP, Drosophila hairless, Saccharomyces cerevisiae TFIID, Saccharomyces cerevisiae YAP1, human c-src, human FGF-1, simian microRNA virus, turnip shrunkenness virus, aptamers of eIF4G, or Coxsackievirus A (CVB1 / 2), or IRES having one or more nucleotide deletions, substitutions, or additions.
[0024] In some preferred embodiments, the IRES is derived from IRES of human rhinovirus, enterovirus, Coxsackievirus, poliovirus, monkey enterovirus, or echovirus, or IRES having one or more nucleotide deletions, substitutions, or additions.
[0025] In some preferred embodiments, the IRES further comprises one or more nucleotide modifications selected from deletion, substitution, and addition.
[0026] In some embodiments, the protein-coding or non-coding region is a protein-coding or non-coding region that encodes a eukaryotic or prokaryotic protein.
[0027] In some preferred embodiments, the protein-coding region is a protein-coding region that encodes human or non-human proteins.
[0028] In some preferred embodiments, the protein-coding region encodes an antibody.
[0029] In some preferred embodiments, the protein-coding region encodes green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), cGFP, Gaussian luciferase (Gluc), firefly luciferase (Fluc), nanoLuc, human erythropoietin (hEPO), or Cas9 endonuclease.
[0030] In some preferred embodiments, the protein is a protein intended for use as a therapeutic or preventative vaccine in protein replacement therapy.
[0031] In some preferred embodiments, the protein is a protein intended for use as a vaccine against a pathogen or a tumor vaccine.
[0032] In some embodiments, the nucleic acid molecule further comprises:
[0033] (1) The 5' homologous arm located upstream of the 3' type II intron fragment; and,
[0034] (2) The 3' homologous arm located downstream of the 5' type II intron fragment.
[0035] In some preferred embodiments, the 5' homologous arm and the 3' homologous arm can form a stem-ring structure.
[0036] In some preferred embodiments, the lengths of the 5' homologous arm and the 3' homologous arm are independently 5-50 nucleotides.
[0037] In some implementations, the spacer subsequence is a polyA-C or polyA sequence.
[0038] In some preferred embodiments, the spacer sequence is 15-50 nucleotides in length.
[0039] In some embodiments, the nucleic acid molecule further includes an RNA polymerase promoter located upstream of the 3'II type intron fragment.
[0040] In some preferred embodiments, the RNA polymerase promoter is located upstream of the 5' homologous arm.
[0041] In some preferred embodiments, the RNA polymerase promoter is selected from RNA polymerase promoters of T7 virus, T6 virus, SP6 virus, T3 virus or T4 virus.
[0042] In some embodiments, the nucleic acid molecule further comprises a signal peptide sequence located upstream of the protein-coding or non-coding region and / or a trimer sequence or ferritin sequence located downstream of the protein-coding or non-coding region.
[0043] In some embodiments, the 3' type II intron fragment comprises the full length or a portion thereof of the type II intron stem-loop domains D4, D5 and / or D6; and / or, the 5' type II intron fragment comprises the full length or a portion thereof of the type II intron stem-loop domains D1, D2, D3 and / or D4.
[0044] In some alternative embodiments, the 3' type II intron fragment includes a portion of the type II intron stem-loop domain D4, the full length of the stem-loop domain D5, and / or the full length of the stem-loop domain D6; and / or, the 5' type II intron fragment includes the full length of the type II intron stem-loop domain D1, the full length of the stem-loop domain D2, the full length of the stem-loop domain D3, and / or a portion of D4.
[0045] In some embodiments, the 3' type II intron fragment comprises a sequence from the 3' proximal type II intron; and / or, the 5' type II intron fragment comprises a sequence from the 5' proximal type II intron.
[0046] In some preferred embodiments, the sequence from the 3' proximal type II intron includes a portion of the sequence of the exon adjacent to its corresponding natural type II intron; and / or, the sequence from the 5' proximal type II intron includes a portion of the sequence of the exon adjacent to its corresponding natural type II intron.
[0047] In some embodiments, the upstream of the 3' type II intron fragment; and / or the downstream of the 5' type II intron fragment further comprises a polyA sequence.
[0048] In some preferred embodiments, the polyA sequence is 15-50 nucleotides in length.
[0049] In some preferred embodiments, the nucleic acid molecule comprises the following elements operatively linked to each other:
[0050] (1) 3' type II intron fragment;
[0051] (2) 5' interval subsequence;
[0052] (3) Internal ribosome entry site (IRES);
[0053] (4) Protein-coding or non-coding regions;
[0054] (5) 3' spacer subsequence;
[0055] (6) 5'II type intron fragment.
[0056] In some preferred embodiments, the nucleic acid molecule comprises the following elements operatively linked to each other:
[0057] (1) 5' homologous arm;
[0058] (2) 3'II type intron fragment;
[0059] (3) 5' interval subsequence;
[0060] (4) Internal ribosome entry site (IRES);
[0061] (5) Protein-coding or non-coding regions;
[0062] (6) 3' spacer subsequence;
[0063] (7) 5'II type intron fragment;
[0064] (8) 3' homologous arm.
[0065] Secondly, the present invention provides a carrier comprising the nucleic acid molecule of the first aspect.
[0066] Thirdly, the present invention provides a circular RNA precursor molecule, or a circular RNA produced, obtained by in vitro transcription from a nucleic acid molecule of the first aspect or a vector of the second aspect.
[0067] Fourthly, the present invention provides the use of the nucleic acid molecule of the first aspect or the carrier of the second aspect in the preparation of circular RNA precursor molecules and / or circular RNA.
[0068] Fifthly, the present invention provides a method for preparing circular RNA, comprising:
[0069] Circular RNA precursor molecules are prepared using the nucleic acid molecules of the first aspect or the vectors of the second aspect.
[0070] The circular RNA precursor molecule was circularized to obtain circular RNA.
[0071] In a sixth aspect, the present invention provides a method for expressing a protein in a cell, comprising transfecting the circular RNA into the cell.
[0072] In some preferred embodiments, the cells are eukaryotic cells.
[0073] The beneficial effects of this invention are as follows:
[0074] 1. This invention confirms that type II introns, especially type IIC intron sequences from other species, can self-splice and circularize the target sequence, and the circularized product sequence does not carry an exogenous self-splicing ribozyme sequence, providing a new direction for RNA in vitro circularization strategies.
[0075] 2. This invention confirms that the circularization efficiency of circular RNA prepared by the self-splicing system of type II introns, especially type IIC introns, from other species is higher than that of the previously reported type IIB intron self-splicing system.
[0076] 3. This invention confirms that type II intron self-splicing systems from different species can all be constructed using the same strategy to carry exogenous protein sequences for efficient circularization.
[0077] 4. The preparation method of the present invention is simple and efficient, the obtained RNA has high cyclization efficiency, and the reaction conditions are mild (cyclization temperature can be as low as 45°C). The in vitro reaction can be linearly scaled up, making it suitable for process development and industrial production. Attached Figure Description
[0078] The accompanying drawings, which are incorporated in and form part of this specification, illustrate embodiments consistent with this specification and, together with the description, serve to explain the principles of this specification.
[0079] Figure 1 The comparison of the circularization effect of wild-type IIC introns and positive control IIB sequences is shown.
[0080] Figure 2 This demonstrates that ribozymes derived from type IIC introns possess autocatalytic function and can be applied to the in vitro circularization of RNA.
[0081] Figure 3 Other types of type II intron-derived ribozymes are shown to have autocatalytic functions and can be applied to the in vitro circularization of RNA.
[0082] Figure 4This demonstrates that the IIC circularization system can mediate the efficient circularization of long RNA fragments. Inserted sequences ranging from 1300 nt to 3000 nt can undergo efficient circularization to generate circular RNA, with high circularization efficiency.
[0083] Figure 5 The identification and purification of the IIC circularization system are shown. The IVT product contained only one linear product. After circularization, two distinct bands appeared: linear RNA (top) and circular RNA (bottom). After RNase R digestion, only one circular RNA band remained. The center figure shows HPLC purification using an SEC column, and the right figure shows the CE identification results of the sample after SEC column purification.
[0084] Figure 6 The cyclization results of IIC-Fluc at different temperatures are shown.
[0085] Figure 7 The expression and detection of cGFP and cNluc are shown.
[0086] Figure 8 The in vivo experiments and protein expression monitoring of cFluc are shown. It can be expressed in mice 8 hours after intramuscular injection.
[0087] Figure 9 A schematic diagram and results are shown of circular RNA constructed from a vector containing a polyA sequence purified using oligo dT magnetic beads.
[0088] Figure 10 IRES screening based on the IIC embedded subsystem is shown. Detailed Implementation
[0089] I. Definition
[0090] In this disclosure, unless otherwise stated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are all widely used terms and routine procedures in their respective fields. To better understand this disclosure, definitions and explanations of relevant terms are provided below.
[0091] As used herein and unless otherwise stated, the terms “about” or “approximately” mean within 10% of a given value or range. Where an integer is required, the term means within 10% of a given value or range, rounded up or down to the nearest integer.
[0092] As used herein, the terms “circRNA” or “circular polynucleotide” or “circular RNA” are used interchangeably and refer to polynucleotides that form a circular structure by covalent bonds. As a type of single-stranded RNA, unlike linear RNA, it contains a covalently closed continuous loop, lacking a 5' cap and a 3' tail. circRNAs are naturally present in mammalian cells and play important roles in a variety of biological processes. circRNAs possess greater stability and resistance to intracellular and extracellular RNases than mRNA, making them suitable for delivering critical payloads persistently expressed therein.
[0093] Although most natural circular RNAs are non-coding RNAs that cannot translate proteins, circular RNAs with IRES (internal ribosome entry site) sequences can be translated in vivo by artificial synthesis.
[0094] The activation of innate immunity by circRNA depends on the type of intron used to generate the circRNA, determining whether it is autoimmune or non-autoimmune recognition. circRNAs generated from exogenous introns are recognized by the immune system as "non-autoimmune" and trigger innate immunity; circRNAs generated from endogenous introns are recognized by the immune system as "autoimmune" and usually do not trigger an innate immune response, even if they carry exons containing exogenous RNA.
[0095] Therefore, circRNAs can be generated from endogenous or exogenous introns, thereby controlling autoimmune or non-autoimmune recognition. Various introns are known in the prior art, originating from multiple organisms and viruses, from protein-coding genes, ribosomal RNA (rRNA), or transfer RNA (tRNA). Representative intron sequences can be obtained from various known databases.
[0096] circRNA can be generated from linear RNA in various ways. In some implementations, circRNA is obtained from linear RNA via backsplicing. Therefore, linear RNA containing self-splicing introns can be circularized.
[0097] As used herein, the term "intron" refers to a nucleotide sequence present in a given nucleic acid molecule that is removed by RNA splicing during the maturation of the final RNA product. As used herein, the term "exon" refers to a nucleotide sequence present in a nucleic acid molecule that, after intron removal during transcription, forms the mature form of the RNA molecule. Exons can be translated into proteins (e.g., in the case of messenger RNA (mRNA)).
[0098] In some implementations, during transcription, introns are removed from the precursor messenger RNA (mRNA precursor), and exons are joined via RNA splicing.
[0099] As used herein, the terms “internal ribosome entry site” and “IRES” are used interchangeably and refer to a cis-element of viral or human cellular RNA (e.g., messenger RNA (mRNA) and / or circRNA) that does not employ a typical eukaryotic cap-dependent translation initiation step. IRES typically contain a long and highly structured 5'-UTR that mediates the binding of the translation initiation complex to and catalyzes the formation of a functional ribosome.
[0100] As used herein, the term "type II intron" refers to a class of ribozymes that possess autocatalytic ribozyme activity and therefore self-splicing capability. The autocatalytic splicing reaction of type II introns can prepare circular RNA. By inverting the D1-D4 and D4-D6 sequences in the six domains of the type II intron, a self-splicing ribozyme can be formed. Preferably, the circular RNA prepared by this method does not contain any residual foreign sequences.
[0101] As used herein, the term "3' type II intron fragment" refers to a sequence having at least 75% identity with the 3'-proximal end of a natural type II intron, wherein the 3' type II intron fragment contains a 3' splice site. In some embodiments, the 3' type II intron fragment also contains an adjacent exon fragment of the natural type II intron. In some embodiments, the 3' splice site is a 3' splice site dinucleotide.
[0102] As used herein, the term "5' type II intron fragment" refers to a sequence having at least 75% identity with the 5'-proximal end of a natural type II intron, wherein the 5' type II intron fragment contains a 5' splice site. In some embodiments, the 5' type II intron fragment also contains an adjacent exon fragment of the natural type II intron. In some embodiments, the 5' splice site is a 5' splice site dinucleotide.
[0103] As used herein, the term "splicing site dinucleotide" refers to two nucleotides that are partially or completely contained within a type II intron and whose phosphodiester bond is cleaved during RNA cyclization and which are bound to the splicing site.
[0104] In some implementations, circular RNA is obtained by splicing RNA generated from the transcription of recombinant nucleic acid molecules.
[0105] As used herein, the term "nucleotide" refers to ribonucleotides, deoxyribonucleotides, their modified forms, or analogs. Nucleotides include purines (e.g., adenine, hypoxanthine, guanine, and their derivatives and analogs) and pyrimidines (e.g., cytosine, uracil, thymine, and their derivatives and analogs). Nucleotide analogs include nucleotides having modified chemical structures in their bases, sugars, and / or phosphate groups, including but not limited to 5'-position pyrimidine modifications, 8'-position purine modifications, modifications at the amine site of the cytosine ring, and substitution of 5-bromo-uracil; and 2'-position sugar modifications, including but not limited to sugar-modified ribonucleotides, wherein the 2'-OH group is substituted with a group such as H, OR, R, a halogen, SH, SR, NH2, NHR, NR2, or CN, wherein R is an alkyl moiety as defined herein. Nucleotide analogs also include nucleotides with bases, such as inosine, piracetam, and xanthine; sugars, such as 2'-methylribose; non-natural phosphodiester bonds, such as methylphosphonates, thiophosphates, and peptide bonds. Nucleotide analogs include 5-methoxyuridine, 1-methylpseuuridine, and 6-methyladenosine.
[0106] As used herein, the terms “polynucleotide” and “nucleic acid molecule” refer to oligomers or polymers comprising at least two linked nucleotides or nucleotide derivatives, including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) typically linked together by phosphodiester bonds. As used herein, the term “nucleic acid molecule” is intended to include both DNA and RNA molecules. Nucleic acid molecules can be single-stranded or double-stranded and can be cDNA. The terms “polynucleotide” and “nucleic acid molecule” are used interchangeably herein to describe polymers of any length (e.g., greater than about 2 bases, greater than about 10 bases, greater than about 100 bases, greater than about 500 bases, greater than 1000 bases, or more bases) composed of nucleotides (e.g., deoxyribonucleotides or ribonucleotides) and which can be produced enzymatically or synthetically, and which can hybridize with naturally occurring nucleic acids in a sequence-specific manner similar to that of two naturally occurring nucleic acids. Naturally occurring nucleic acids are composed of nucleotides, including guanine, cytosine, adenine, thymine, and uracil (G, C, A, T, and U, respectively).
[0107] As used in this article, the terms “ribonucleic acid” and “RNA” refer to polymers composed of ribonucleotides.
[0108] As used in this article, the terms “deoxyribonucleic acid” and “DNA” refer to polymers composed of deoxyribonucleotides.
[0109] As used herein, a linear nucleic acid molecule is referred to as having a “5’-terminus” (5’ end) and a “3’-terminus” (3’ end), with phosphodiester bonds present at the 5’ and 3’ carbons of the sugar moiety of the substituted mononucleotide. The terminal nucleotide of a polynucleotide is its 5’-terminal nucleotide, at which a new bond would be a bond to the 5’ carbon. The terminal nucleotide of a polynucleotide is its 3’-terminal nucleotide, at which a new bond would be a bond to the 3’ carbon. As used herein, a terminal nucleotide is a nucleotide located at the 3’- or 5’-terminal end.
[0110] As used herein, a “homologous arm” is selected from the following consecutive sequences: (1) predicted to form base pairs with at least about 75% (e.g., at least about 80%, at least about 85%, at least about 90%, at least about 95%, about 100%) of another sequence (such as another homologous arm) in RNA; (2) at least 5 nt and no more than 50 nt in length, located before and near or contained within a 3' intron fragment, and / or after and near or contained within a 5' intron fragment; (3) predicted to have less than 50% (e.g., less than 45%, less than 40%, less than 35%, less than 30%, less than 25%) of base pairs with an unexpected sequence (e.g., a non-homologous arm sequence) in RNA.
[0111] As used herein, a "spacer" refers to a continuous nucleotide sequence selected from the following: (1) predicted to avoid interference with proximal structures, such as those from IRES, coding or non-coding regions, or introns; (2) approximately 20 nucleotides in length (optionally not exceeding 100 nucleotides); (3) located downstream and near a 3' intron fragment and / or upstream and near a 5' intron fragment; and / or (4) containing one or more of the following: a) an unstructured region at least 5 nt long; b) a region predicted to pair with a distal (i.e., non-adjacent) sequence at least 5 nt long, which includes another spacer; and / or c) a structured region at least 7 nt long, the extent of which is limited to the spacer sequence.
[0112] As used herein, a "vector" is a reproducible nucleic acid from which one or more heterologous proteins can be expressed when the vector is transformed into a suitable host cell. Vectors include those into which nucleic acids encoding polypeptides or fragments thereof can typically be introduced via restriction enzyme digestion and ligation. Vectors also include those containing nucleic acids encoding polypeptides. Vectors are used to introduce nucleic acids encoding polypeptides into host cells for amplification of nucleic acids or for expression / display of the polypeptide encoded by the nucleic acid. Vectors are typically kept free but can be designed to integrate genes or portions thereof into the chromosome of the genome. Vectors for artificial chromosomes, such as yeast artificial vectors and mammalian artificial chromosomes, are also considered. The selection and use of such vectors are well known to those skilled in the art.
[0113] As used herein, “expression” refers to the process by which a polypeptide is produced through the transcription and translation of polynucleotides. The expression level of a polypeptide can be evaluated using any method known in the art, including, for example, methods for determining the amount of polypeptide produced from host cells. Such methods may include, but are not limited to, quantifying polypeptides in cell lysates by ELISA, Coomassie blue staining following gel electrophoresis, Lowry protein assays, and Bradford protein assays.
[0114] As used herein, “treatment” for an individual suffering from a disease or disease condition means that the individual’s symptoms are partially or completely relieved, or remain unchanged after treatment. Therefore, treatment includes prevention, treatment, and / or cure. Prevention refers to preventing underlying disease and / or preventing the worsening of symptoms or the development of disease. Treatment also includes any antibodies or antigen-binding fragments thereof provided, and any pharmaceutical use of the compositions provided herein.
[0115] As used in this article, “therapeutic effect” refers to the effect resulting from treatment of an individual, which alters, usually improves or enhances the symptoms of a disease or condition, or cures a disease or condition.
[0116] As used herein, "therapeutic effective amount" or "therapeutic effective dose" refers to an amount of substance, compound, material, or composition containing a compound that, when applied to a subject, is at least sufficient to produce a therapeutic effect. Therefore, it is the amount necessary to prevent, cure, improve, block, or partially block the symptoms of a disease or condition.
[0117] As used herein, "preventive effective dose" or "preventive effective amount" refers to the amount of a substance, compound, material, or composition containing a compound that, when applied to a subject, would have the intended preventive effect, such as preventing or delaying the onset or recurrence of a disease or symptom, or reducing the likelihood of the onset or recurrence of a disease or symptom. A fully preventive effective dose does not necessarily occur through the administration of a single dose and can occur only after a series of doses have been administered. Therefore, a preventive effective dose can be administered in one or more applications.
[0118] As used in this article, the term "patient" refers to a mammal, such as a human.
[0119] As used herein, the term "from" refers to the original source of the nucleic acid molecule, but does not limit the method of preparation of the nucleic acid molecule, such as chemical synthesis or recombinant synthesis. A polynucleotide "from" a sequence means that the polynucleotide contains a continuous nucleotide sequence of at least about 6 nucleotides from the sequence, preferably at least 8 nucleotides, more preferably at least about 10-12 nucleotides, and even more preferably at least about 15-20 nucleotides.
[0120] II. Detailed Implementation Plan
[0121] In a first aspect, the present invention provides a nucleic acid molecule comprising a 3' type II intron fragment, a 5' type II intron fragment, and a protein-coding or non-coding region, wherein the nucleic acid molecule is capable of producing biologically active circular RNA.
[0122] In some alternative embodiments, the 3' type II intron fragment or the 5' type II intron fragment is derived from a type IIC intron, a type IIE intron, or a type IIF intron.
[0123] In some embodiments, the nucleic acid molecule further comprises one or more elements selected from the following: a 5' spacer sequence, a Kozak sequence, and a 3' spacer sequence.
[0124] In some embodiments, the nucleic acid molecule comprises the following elements operatively linked to each other:
[0125] (1) 3' type II intron fragment;
[0126] (2) Optional 5' interval subsequence;
[0127] (3) Internal ribosome entry site (IRES);
[0128] (4) Optional Kozak sequence;
[0129] (5) Protein-coding or non-coding regions;
[0130] (6) Optional 3' interval subsequence;
[0131] (7) 5'II type intron fragment;
[0132] The nucleic acid molecule can generate circular RNA through its self-splicing.
[0133] In some alternative implementations, an IRES and Kozak sequence is added to the 5' end of the target protein sequence (such as GFP). The target gene may be codon-optimized as needed, with spacer sequences added to the beginning and end of the IRES-Kozak-GFP sequence. The IIC stem-loop domain D4-D6 sequence is linked to the 5' end of the spacer-IRES-GFP sequence, and the IIC stem-loop domain D1-D4 sequence is linked to the 3' end of the spacer 1-IRES-Kozak-GFP-spacer 2 sequence, forming a PIE structure.
[0134] In some alternative implementations, the IRES sequence is sometimes modified or altered to facilitate the translation of the target protein. To promote the secretion of the target protein, a signal peptide sequence (SP) is sometimes inserted into the 5' end of the target protein sequence (such as GFP). To obtain multimers of the target protein, a trimer-motif sequence and / or a ferritin sequence is sometimes inserted into the 3' end of the target protein sequence. To further purify the circularized RNA, a 15-50 nt polyA sequence is simultaneously added upstream of the 3' type II intron fragment and downstream of the 5' type II intron fragment.
[0135] In some embodiments, the 3' type II intron fragment and the 5' type II intron fragment are derived from type II intron sequences.
[0136] In some preferred embodiments, the 3' type II intron fragment and the 5' type II intron fragment are derived from type IIC introns, type IIE introns, or type IIF introns.
[0137] In some embodiments, the 3' type II intron fragment and the 5' type II intron fragment are derived from *Oceanobacillus iheyensis*, *Bacillus halodurans*, *Streptococcus pneumoniae*, *Streptococcus agalactiae*, *Thermoanerobacter italicus*, *Pseudomonas putida*, *Pseudomonas alcaligenes*, *Geobacillus stearothermophilus*, *Clostridium acetobutylicum*, *Microscilla sp.*, *Azotobacter vinelandii*, *Serratia marcescens*, *Nitrosomonas europaea*, and *Dechloromonas*. Type II introns of the following bacteria, including *Aromatica*, *Geobacter uranium-reducens*, *Myxocous xanthus*, *Nitrobacter hamburgensis*, *Pelotomaculum thermopropionicum*, *Candidatus Solibacter usitatus*, *Bradyrhizobium diazoefficiens*, *Chlorobium phaeobacteroides*, *Photorhabdus iuminescens*, *Sinorhizobium meliloti*, *Bradyrhizobium japonicum*, or *Clostridium beijerinckii*, or type II introns with one or more nucleotide deletions, substitutions, or additions.
[0138] In some preferred embodiments, the 3' type II intron fragment and the 5' type II intron fragment are derived from type II introns such as *Thermosynthetiocytogenes itariica*, *Bacillus marineus*, *Bacillus halophilus*, *Streptococcus agalactiae*, *Rhizobium japonicum*, *Geobacterium uranium-reducing*, or *Clostridium bengalicum*, or type II introns having one or more nucleotide deletions, substitutions, or additions.
[0139] In some embodiments, the IRES are derived from: Coxsackievirus B3 (CVB3), Coxsackievirus B1 (CVB1), Coxsackievirus B5 (CVB5), echovirus, human rhinovirus (HRV), poliovirus (PV), simian enterovirus SA5 (SimianA5), simian enterovirus SV4 (SimianV4), aura syndrome virus, blood-sucking assassin bug virus, Tyrell's encephalomyelitis virus, simian virus 40, red imported fire ant virus 1, grain constrictor aphid virus, reticuloendotheliosis virus, and Forman's disease virus. Poliovirus 1, Soybean Lobe Virus, Kashmir Bee Virus, Human Rhinovirus 2, Glass Leafhopper Virus-1, Human Immunodeficiency Virus Type 1, Glass Leafhopper Virus-1, Lice P Virus, Hepatitis C Virus, Hepatitis A Virus, GB Hepatitis Virus, Foot-and-Mouth Disease Virus, Human Enterovirus 71, Equine Rhinovirus, Tea Lobe-like Virus, Encephalocarditis Virus (EMCV), Fruit Fly C Virus, Cruciferae Tobacco Virus, Cricket Paralysis Virus, Bovine Viral Diarrhea Virus 1, Black Queen Cell Virus, Aphid Lethal Paralysis Virus, Avian Encephalomyelitis Virus, Acute Bee Paralysis Virus, Hibiscus Yellow spot virus, classical swine fever virus, human FGF2, human SFTPA1, human AML1 / RUNX1, Drosophila antennae, human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAPl, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kipl, human PDGF2 / c-sis, human p53, human Pim-1, mouse Rbm3 IRES of Drosophila reaper, canine camper, Drosophila Ubx, salivary viruses, Coxsackieviruses, bi-Echoviruses, human UNR, mouse UtrA, human VEGF-A, human XIAP, Drosophila hairless, Saccharomyces cerevisiae TFIID, Saccharomyces cerevisiae YAP1, human c-src, human FGF-1, simian microRNA virus, turnip shrunkenness virus, aptamers of eIF4G, or Coxsackievirus A (CVB1 / 2), or IRES having one or more nucleotide deletions, substitutions, or additions.
[0140] In some preferred embodiments, the IRES is derived from IRES of human rhinovirus, enterovirus, Coxsackievirus, poliovirus, monkey enterovirus, or echovirus, or IRES having one or more nucleotide deletions, substitutions, or additions.
[0141] In some preferred embodiments, the IRES further comprises one or more nucleotide modifications selected from deletion, substitution, and addition.
[0142] In some embodiments, the protein-coding or non-coding region is a protein-coding or non-coding region that encodes a eukaryotic or prokaryotic protein.
[0143] In some preferred embodiments, the protein-coding region is a protein-coding region that encodes human or non-human proteins.
[0144] In some preferred embodiments, the protein-coding region encodes an antibody.
[0145] In some preferred embodiments, the protein-coding region encodes green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), cGFP, Gaussian luciferase (Gluc), firefly luciferase (Fluc), nanoLuc, human erythropoietin (hEPO), or Cas9 endonuclease.
[0146] In some preferred embodiments, the protein is a protein intended for use as a therapeutic or preventative vaccine in protein replacement therapy.
[0147] In some preferred embodiments, the protein is a protein intended for use as a vaccine against a pathogen or a tumor vaccine.
[0148] In some preferred embodiments, the protein is used as an antigen in the preparation of viral or bacterial vaccines.
[0149] In some embodiments, the nucleic acid molecule further comprises:
[0150] (1) The 5' homologous arm located upstream of the 3' type II intron fragment; and,
[0151] (2) The 3' homologous arm located downstream of the 5' type II intron fragment.
[0152] In some preferred embodiments, a stem-ring structure can be formed.
[0153] In some preferred embodiments, the lengths of the 5' homologous arm and the 3' homologous arm are independently 5-50 nucleotides.
[0154] In some implementations, the spacer subsequence is a polyA-C or polyA sequence.
[0155] In some preferred embodiments, the spacer sequence is 15-50 nucleotides in length.
[0156] In some embodiments, the nucleic acid molecule further includes an RNA polymerase promoter located upstream of the 3'II type intron fragment.
[0157] In some preferred embodiments, the RNA polymerase promoter is located upstream of the 5' homologous arm.
[0158] In some preferred embodiments, the RNA polymerase promoter is selected from RNA polymerase promoters of T7 virus, T6 virus, SP6 virus, T3 virus or T4 virus.
[0159] In some embodiments, the nucleic acid molecule further comprises a signal peptide sequence located upstream of the protein-coding or non-coding region and / or a trimer sequence or ferritin sequence located downstream of the protein-coding or non-coding region.
[0160] In some embodiments, the nucleic acid molecule is used to transcribe a target sequence of 1000-3000 bp or more.
[0161] In some embodiments, the 3' type II intron fragment comprises the full length or a portion thereof of the type II intron stem-loop domains D4, D5 and / or D6; and / or, the 5' type II intron fragment comprises the full length or a portion thereof of the type II intron stem-loop domains D1, D2, D3 and / or D4.
[0162] In some alternative embodiments, the 3' type II intron fragment includes a portion of the type II intron stem-loop domain D4, the full length of the type II intron stem-loop domain D5, and / or the full length of the type II intron stem-loop domain D6; and / or, the 5' type II intron fragment includes the full length of the type II intron stem-loop domain D1, the full length of the type II intron stem-loop domain D2, the full length of the type II intron stem-loop domain D3, and / or a portion of the type II intron stem-loop domain D4.
[0163] In some embodiments, the 3' type II intron fragment comprises a sequence from the 3' proximal type II intron; and / or, the 5' type II intron fragment comprises a sequence from the 5' proximal type II intron.
[0164] In some preferred embodiments, the sequence from the 3' proximal type II intron includes a portion of the sequence of the exon adjacent to its corresponding natural type II intron; and / or, the sequence from the 5' proximal type II intron includes a portion of the sequence of the exon adjacent to its corresponding natural type II intron.
[0165] In some embodiments, the upstream of the 3' type II intron fragment; and / or, the downstream of the 5' type II intron fragment, further comprises a polyA sequence.
[0166] In some preferred embodiments, the polyA sequence is 15-50 nucleotides in length.
[0167] In some preferred embodiments, the nucleic acid molecule comprises the following elements operatively linked to each other:
[0168] (1) 3' type II intron fragment;
[0169] (2) 5' interval subsequence;
[0170] (3) Internal ribosome entry site (IRES);
[0171] (4) Protein-coding or non-coding regions;
[0172] (5) 3' spacer subsequence;
[0173] (6) 5'II type intron fragment.
[0174] In some preferred embodiments, the nucleic acid molecule comprises the following elements operatively linked to each other:
[0175] (1) 3' type II intron fragment;
[0176] (2) 5' interval subsequence;
[0177] (3) Internal ribosome entry site (IRES);
[0178] (4) Kozak sequence (optional);
[0179] (5) Protein-coding or non-coding regions;
[0180] (6) 3' spacer subsequence;
[0181] (7) 5'II type intron fragment.
[0182] In some preferred embodiments, the nucleic acid molecule comprises the following elements operatively linked to each other:
[0183] (1) 5' homologous arm;
[0184] (2) 3'II type intron fragment;
[0185] (3) 5' interval subsequence;
[0186] (4) Internal ribosome entry site (IRES);
[0187] (5) Kozak sequence (optional);
[0188] (6) Protein-coding or non-coding regions;
[0189] (7) 3' interval subsequence;
[0190] (8) 5'II type intron fragment;
[0191] (9) 3' homologous arm.
[0192] In some embodiments, the element can be split at specific sites. For example, after a 3' type II intron fragment is split at a certain site, 3intron5 and 3inron3 are obtained, representing the upstream and downstream segments of the 3' end sequence of the type II intron, respectively; after an IRES sequence is split at a certain site, ires5 and ires3 sequences are obtained; after a protein coding region or non-coding region is split at a certain site, orf5 and orf3 sequences are obtained; or after a 5' type II intron fragment is split at a certain site, 5intron5 and 5inron3 sequences are obtained. Meanwhile, the arrangement order of the elements can be flexibly changed, such as being constructed in the following concentrated arrangement order from 5' to 3': (a) 3intron3 - optional 5' spacer sequence - IRES - optional Kozak sequence - protein coding region or non-coding region - optional 3' spacer sequence - 5' type II intron fragment - 3intron5; (b) ires3 - optional Kozak sequence - protein coding region or non-coding region - optional 3' spacer sequence - 5' type II intron fragment - 3' I (c) orf3 - optional 3' spacer sequence - 5' type II intron fragment - 3' type II intron fragment - optional 5' spacer sequence - IRES - optional Kozak sequence - orf5; (d) 5intron3 - 3' type II intron fragment - optional 5' spacer sequence - IRES - optional Kozak sequence - protein coding or non-coding region - optional 3' spacer sequence - 5intron5, etc.
[0193] Secondly, the present invention provides a carrier comprising the nucleic acid molecule of the first aspect.
[0194] Thirdly, the present invention provides a circular RNA precursor molecule, or a circular RNA produced, obtained by in vitro transcription from a nucleic acid molecule of the first aspect or a vector of the second aspect.
[0195] Fourthly, the present invention provides the use of the nucleic acid molecule of the first aspect or the carrier of the second aspect in the preparation of circular RNA precursor molecules and / or circular RNA.
[0196] Fifthly, the present invention provides a method for preparing circular RNA, comprising:
[0197] Circular RNA precursor molecules are prepared using the nucleic acid molecules of the first aspect or the vectors of the second aspect.
[0198] The circular RNA precursor molecule was circularized to obtain circular RNA.
[0199] In a sixth aspect, the present invention provides a method for expressing a protein in a cell, comprising transfecting the circular RNA into the cell.
[0200] In some preferred embodiments, the cells are eukaryotic cells.
[0201] On the other hand, the present invention provides a method for preparing circular RNA in vitro based on a type II intron self-splicing system, comprising the steps of:
[0202] (1) Add the IRES and Kozak sequences to the 5' end of the target protein sequence (e.g., GFP). The target gene may undergo codon optimization as needed. Add spacer sequences to the beginning and end of the IRES-Kozak-GFP sequence to obtain spacer 1-IRES-Kozak-GFP-spacer 2. Link the IIC intron stem-loop domain D4-D6 sequence to the 5' end of the spacer 1-IRES-Kozak-GFP-spacer 2 sequence, and link the IIC intron stem-loop domain D1-D4 sequence to the 3' end of the spacer 1-IRES-Kozak-GFP-spacer 2 sequence to form a PIE structure. Intron stem-loop domain D4 refers to a part of the intron stem-loop domain D4 sequence. Insert the above sequences after the T7 promoter sequence of the pVAX.1 vector through BmtI and AflII restriction sites to construct the pVAX.1-IIC-IRES-Kozak-GFP recombinant plasmid. To insert restriction enzyme sites, the DNA sequence corresponding to the amino acids of the target protein sequence is sometimes mutated. To promote the translation of the target protein, the IRES sequence is sometimes modified or altered. To promote the secretion of the target protein, a signal peptide sequence (SP) is sometimes inserted into the 5' end of the target protein sequence. To obtain multimers of the target protein, a trimer-motif sequence and / or ferritin sequence is sometimes inserted into the 3' end of the target protein sequence. To further purify circularized RNA, a 20-30 nt polyA sequence is simultaneously added upstream of the 3' type II intron fragment and downstream of the 5' type II intron fragment.
[0203] (2) The recombinant plasmid was linearized using Hind III restriction enzyme, and the linearized template was recovered. Transcription was then performed under the catalysis of T7 RNase. The transcription product was purified by RNA column purification or LiCl precipitation after treatment with DNase I to obtain the linear RNA precursor. The RNA precursor was denatured at 70℃ for 5 min, and immediately treated at 4℃ to open the structure of the linear RNA precursor. Tris-HCl and Mg were added. 2+ NH 4+ RNA was circularized in vitro in an intron self-splicing reaction buffer composed of equal components and incubated at 45-55℃ for 8-15 min.
[0204] (3) Purification of circular RNA using RNase R and HPLC. Specifically, the cyclized product was treated with RNase R and then directly purified by HPLC. In some cases, the cyclized product was treated with RNase R and then purified by RNA column purification or LiCl precipitation to obtain preliminarily purified circular RNA. The circular RNA was incubated at 70℃ for 5 min, then transferred to ice and placed for 3 min before HPLC purification. The column used for purifying the circular RNA was a 4.6 × 300 mm SEC column with a particle size of 5 μm and a pore size of [missing information]. The liquid phase conditions used were RNase-free PB buffer. RNA was detected by UV 260nm. After determining the peak time of circular RNA, the product was recovered under UV-free detection conditions. The obtained circular RNA was concentrated by ultrafiltration tube and recovered with RNase-free water.
[0205] (4) If the intron sequences at both ends of the circular RNA contain a continuous polyA sequence of 15-50 nt, the circular RNA can be purified by affinity chromatography. Specifically, the cyclized product is treated with RNase R and then directly purified by HPLC. In some embodiments, the cyclized product is treated with RNase R and then purified by RNA column purification or LiCl precipitation to obtain preliminarily purified circular RNA. The circular RNA is then incubated at 70°C for 5 min, transferred to ice for 3 min, and purified by affinity chromatography using oligo dT magnetic beads / packing material / pre-packed columns, etc. The resulting circular RNA is concentrated using ultrafiltration and recovered with RNase-free water.
[0206] (5) The following methods were used to identify whether RNA was circular and whether it could express the target protein in vivo: First, the bands separated on the gel electrophoresis pattern of the products after RNase R treatment were compared to determine whether the product was circular RNA. Reverse PCR primers were designed, and cDNA after reverse transcription of the RNA product was used as a template for PCR amplification. The size of the product was analyzed to determine whether the reverse transcription template contained circular RNA. The target band of the product amplified by reverse PCR primers was sequenced, and the sequence splicing site was analyzed to determine whether the circularization site was as designed. The proportion and purity of the circularized product were analyzed using capillary electrophoresis (CE). Cell transfection experiments were performed, and 293T and HCC1569 cells were transfected with circular RNA. The expression level of the target protein was determined based on fluorescent protein signals, Luciferase chemiluminescence intensity, Western blot, and ELISA.
[0207] For the purpose of clarity and concise description, the features are described herein as part of some identical or separate embodiments; however, it will be understood that the scope of this disclosure may include some embodiments having a combination of all or some of the features described.
[0208] Example
[0209] Example 1: Preparation of expression constructs for IIC introns
[0210] To compare the self-splicing and circularization effect of the IIC intron, the IIB intron sequence derived from the existing patent (CN115404240A) of natural Clostridium tetani was used as a positive control to evaluate the in vitro self-splicing and circularization ability of the IIC intron sequence derived from natural Oceanobacillus iheyensis to circumulate the 250bp target sequence (SEQ ID NO:42).
[0211] First, DNA sequences were directly synthesized based on the natural sequences of type II introns. The IIB sequence (SEQ ID NO:43) includes, in addition to the IIB intron sequences (SEQ ID NO:9 and SEQ ID NO:10) of natural Clostridium tetani, the sequences of exons E1 (6bp, GCCATA) and E2 (4bp, AGCA) naturally present on the flanks, which help determine the accuracy of the intron self-splicing sites, as well as the homologous arms homology1 (SEQ ID NO:23) and homology2 (SEQ ID NO:24). Similarly, the IIC sequence (SEQ ID NO:44) includes, in addition to the IIC intron sequences (SEQ ID NO:1 and SEQ ID NO:2) of natural Marine Bacillus, the sequences of exons E1 (4bp, TTAT) and E2 (2bp, TT), as well as the homologous arms homology1 (SEQ ID NO:23) and homology2 (SEQ ID NO:24). The DNA sequence and the pseudo-circularized 250bp target sequence were cloned into the vector pVAX.1 containing the T7 promoter using molecular biology techniques. In this embodiment, to avoid the introduction of redundant restriction enzyme sites affecting the secondary structure stability of the intron, homologous recombination was used to construct the cloning vector.
[0212] Using primers targeting the simulated in vitro transcription sequence (F: taatacgactcactataggGCGCGC(SEQ ID NO:45); rev: GCCGGTAACGCATAATAGCCG(SEQ ID NO:46)), high-fidelity PCR amplification was performed on the vector to obtain the DNA template required for transcription. The obtained template was purified by DNA gel electrophoresis and gel recovery.
[0213] The purified DNA template was transcribed in vitro using commercial T7 RNA polymerase (Yisheng Biotechnology, 10623ES50) at 37°C for 2 hours, followed by a hold period at 4°C. The resulting transcript was then digested with DNase I at 37°C for 15 minutes to degrade the DNA template in the reaction system. RNA was then precipitated with LiCl and washed with 75% ethanol to obtain high-purity linear RNA.
[0214] The purified linear RNA was subjected to a reaction at 70°C for 5 min, then at 4°C for 2 min, and maintained at 4°C to open the higher-order structure of the RNA. 10× self-splicing circularization buffer (in this example, 500 mM Tris-HCl, pH 7.5, 300 mM MgCl2, 600 mM (NH4)2SO4) was added to bring the final buffer concentration to 1×. The reaction conditions were 55°C for 15 min, maintained at 4°C. The RNA was then precipitated with LiCl and washed with 75% ethanol to obtain a high-purity RNA product free of salt ions.
[0215] After the in vitro self-splicing and circularization reaction was completed, 2 μg of linear RNA and the product RNA were respectively subjected to electrophoresis on a 2% agarose gel to analyze the intron self-splicing and circularization efficiency. Samples that successfully underwent circularization will produce RNA bands above or below the linear RNA band. Figure 1 The displayed IVT sample is linear RNA obtained from in vitro transcription, and the circ sample is a purified sample of linear RNA after self-splicing circularization. The IIC intron sequence from natural marine Bacillus can also produce circularized RNA bands, and has a circularization effect that is no less than that of the IIB intron sequence from the positive control natural Clostridium tetani.
[0216] After preparing the circular RNA synthesized using the IIC intron sequence, the results of Sanger sequencing of the RT-PCR product were obtained. Figure 1 This confirms that the splicing sites of the prepared circular RNA meet the expectations.
[0217] Example 2: Preparation of expression constructs of IIC introns from different sources
[0218] In addition to IIC intron sequences from natural marine Bacillus sources, this embodiment involves the evaluation of the in vitro self-splicing and circularization capabilities of IIC intron sequences from different species, such as Bacillus halodurans (SEQ ID NO: 3 and SEQ ID NO: 4), Streptococcus agalactiae (SEQ ID NO: 5 and SEQ ID NO: 6), and T. teritalicus (SEQ ID NO: 7 and SEQ ID NO: 8).
[0219] Similar to Example 1, DNA sequences (SEQ ID NO: 47, SEQ ID NO: 48, and SEQ ID NO: 49, respectively) were directly synthesized based on the natural sequences of type II introns. These DNA sequences, along with the pseudo-circularized 250 bp target sequence, were cloned into the vector pVAX.1 containing the T7 promoter using molecular biology techniques. The DNA template required for transcription was obtained by high-fidelity PCR amplification. The purified DNA template was then transcribed in vitro using a commercial T7 RNA polymerase (Yisheng Biotechnology, 10623ES50). After digestion of the DNA template with DNase I, RNA was precipitated with LiCl to obtain high-purity linear RNA.
[0220] The purified linear RNA was subjected to a reaction at 70°C for 5 min, then at 4°C for 2 min, and held at 4°C to open the higher-order structure of the RNA. 10× self-splicing circularization buffer (in this example, 500 mM Tris-HCl, pH 7.5, 300 mM MgCl2, 600 mM (NH4)2SO4) was added to bring the final buffer concentration to 1×. The reaction conditions were 55°C for 15 min, then held at 4°C. Subsequently, the RNA was precipitated with LiCl to obtain a high-purity RNA product free of salt ions.
[0221] After the in vitro self-splicing and circularization reaction was completed, 2 μg of linear RNA and the product RNA were respectively subjected to electrophoresis on a 2% agarose gel to analyze the self-splicing and circularization efficiency of introns. Figure 2 The displayed IVT samples are linear RNA obtained from in vitro transcription, and the circ samples are purified samples of linear RNA after self-splicing and circularization. The in vitro self-splicing and circularization effect of the IIC intron sequence from natural Bacillus harolosum is slightly inferior to that of the IIC intron sequence from natural marine Bacillus. Moreover, at the target circularization sequence of 250bp, the in vitro self-splicing and circularization effect of the IIC intron sequence from natural Thermosynthetobacter itariformis is the best.
[0222] Example 3: Verification of IIE and IIF Intron Self-Splicing Systems
[0223] In addition to the existing patent (CN 115404240 A) on the IIB intron sequence of natural Clostridium tetani, Examples 1 and 2 have demonstrated that natural IIC intron sequences from different species also have the ability to self-splicing and circularize in vitro under certain conditions. This example mainly confirms the ability of natural type II introns to self-splicing and circularize in vitro, with particular emphasis on IIE and IIF introns.
[0224] Similarly, using the IIB intron sequence of the existing patent (CN 115404240 A) derived from natural Clostridium beijerinckii (SEQ ID NO: 13 and SEQ ID NO: 14), Bradyrhizobium japonicum (SEQ ID NO: 11 and SEQ ID NO: 12), Sinorhizobium meliloti (SEQ ID NO: 15 and SEQ ID NO: 16), and IIF sequences derived from natural Geobacter uranium reducers (SEQ ID NO: 17 and SEQ ID NO: 18) and Pelotomaculum thermopropionicum (SEQ ID NO: 19 and SEQ ID NO: 20) as positive controls, the in vitro self-splicing circularization ability of 250bp sequences from natural Clostridium beijerinckii (SEQ ID NO: 13 and SEQ ID NO: 14), Bradyrhizobium japonicum (SEQ ID NO: 11 and SEQ ID NO: 12), Sinorhizobium meliloti (SEQ ID NO: 15 and SEQ ID NO: 16), and IIF sequences from natural Geobacter uranium reducers (SEQ ID NO: 17 and SEQ ID NO: 18) and Pelotomaculum thermopropionicum (SEQ ID NO: 19 and SEQ ID NO: 20) was evaluated.
[0225] Similar to Examples 1 and 2, DNA sequences (SEQ ID NO: 50-54) were directly synthesized based on the natural sequences of type II introns, and cloning vectors were constructed using molecular biology techniques. After obtaining the purified DNA template, in vitro transcription was performed. Following DNase I digestion of the DNA template, RNA was precipitated with lithium chloride to obtain high-purity linear RNA.
[0226] The purified linear RNA was subjected to a reaction at 70°C for 5 min, then at 4°C for 2 min, and maintained at 4°C to open the higher-order structure of the RNA. 10× self-splicing circularization buffer (in this example, 500 mM Tris-HCl / MOPS, pH 7.5, 200-300 mM MgCl2, 600-1000 mM (NH4)2SO4) was added to bring the final buffer concentration to 1×. The reaction conditions were 55°C for 15-60 min, maintained at 4°C. Subsequently, the RNA was precipitated with LiCl to obtain a high-purity RNA product free of salt ions.
[0227] After the in vitro self-splicing and circularization reaction was completed, 2 μg of linear RNA and the product RNA were respectively subjected to electrophoresis on a 2% agarose gel to analyze the self-splicing and circularization efficiency of introns. Figure 3 The displayed IVT sample is linear RNA obtained from in vitro transcription, and the circ sample is a purified sample of linear RNA after self-splicing circularization. Under the target circularization sequence of 250bp, the in vitro self-splicing circularization effect of the IIE sequence from Japanese slow-growing soybean rhizobium and alfalfa rhizobium, and the IIF intron sequence from natural uranium-reducing Geobacterium and thermophilic propionic acid anaerobic enterobacteria is no less than that of the IIB intron sequence from natural tetanus spores.
[0228] Example 4: Circulation Results of Target Sequences of Different Lengths
[0229] Based on the methods in Examples 1 and 2, the in vitro self-splicing and circularization effects of target fragments of different lengths were further explored using IIC intron sequences derived from natural marine Bacillus. These target fragments were eGFP containing approximately 1500 nucleotides, including the IRES sequence (SEQ ID NO: 25), with its nucleotide sequence shown in SEQ ID NO: 26; Fluc containing approximately 2400 nucleotides, with its nucleotide sequence shown in SEQ ID NO: 28; and Pfizer RSV vaccine preF protein (pXCS847) (WO 2017 / 109629) containing 3000 nucleotides of ferritin, with its nucleotide sequence shown in SEQ ID NO: 29.
[0230] Similarly, after constructing the cloning vector through homologous recombination, the DNA template required for in vitro transcription was amplified by high-fidelity PCR. The purified DNA template was reacted with commercial T7 RNA polymerase (Yisheng Biotechnology, 10623ES50) to obtain linear RNA. After purification, the linear RNA was obtained by in vitro self-splicing and circularization reaction. The purified RNA product without salt ions was further used for circularization effect analysis.
[0231] Gel electrophoresis results showed that all tested fragments could undergo efficient self-splicing to obtain circular RNA products. Figure 4 Furthermore, compared to the 250bp small fragment self-splicing and circularization in vitro in Example 1, the in vitro self-splicing and circularization effect of the IIC intron sequence from natural marine Bacillus is better on long target sequences in the range of 1500-3000bp. According to the grayscale analysis of the gel electrophoresis bands, the efficiency of in vitro self-splicing and circularization of approximately 2400 nucleotides of Fluc containing the IRES sequence from the IIC intron sequence from natural marine Bacillus is as high as 88%.
[0232] Example 5: Preparation of high-purity circular RNA
[0233] Based on the methods in Examples 1 and 4, after constructing a cloning vector via homologous recombination, Nanoluc (nucleotide sequence shown in SEQ ID NO: 27), containing 1300 nucleotides including the IRES sequence, was circularized in vitro using the IIC intron sequence from natural marine Bacillus. The resulting salt-free RNA circularization product was further digested with RNase R at 37°C for 30 min, maintained at 4°C. The RNase R-treated RNA circularization product was then purified using an RNA recovery column and analyzed by gel electrophoresis. Figure 5 (Left) It was determined that the purified RNA product had virtually no obvious linear RNA bands, proving that the sample was further purified after treatment with RNase R.
[0234] The cNanoLuc cyclized product obtained after RNase R treatment was further purified by HPLC-SEC. The SEC column used was a Sepax SRT SEC-1000PEEK with a particle size of 5 μm and a pore size of [missing information]. The operating conditions were: flow rate: 5.3 min / ml; elution conditions: 0-30 min; 100% buffer A (150 mM PB, pH 7.0, prepared with DEPC water). Figure 5 As shown in the center figure, after in vitro self-splicing and circularization treatment, compared with linear RNA, the peak of the product clearly shifted to the right. After treatment with RNase R, the peak position response value of the circularized RNA decreased significantly. This was achieved by collecting... Figure 5 The green dashed line in the center of the graph marks the sample corresponding to the peak time of the cNanoLuc circularization product. This allows for the production of highly pure circular RNA. The CE assay of the purified sample was performed using IVT, circularization, and SEC. Figure 5 The red dashed line in the right figure marks the band size corresponding to the cNanoLuc cyclization product.
[0235] In simple terms, CE identification includes the following steps: using an Agilent 4200 TapeStation system equipped with an Agilent RNA ScreenTape chip for analysis and testing, diluting the sample to be tested to 100-300 ng / uL, taking 1uL of sample and adding 3uL of RNA ScreenTape sample buffer, vortexing thoroughly (1 min) and centrifuging to the bottom of the tube, performing a denaturation program at 70℃ for 5 min - 4℃ for 3 min, vortexing thoroughly again (1 min) and centrifuging to the bottom of the tube, and then testing on the instrument.
[0236] Example 6: Cycloning results at different cyclization temperatures
[0237] Based on the methods in Examples 1 and 2, to minimize the impact of temperature on the stability of linear RNA, the inventors also used the IIC intron sequence containing natural marine Bacillus spp. obtained in Example 4, along with the IRES-Fluc target fragment (SEQ ID NO: 55), to experiment with the in vitro self-splicing and circularization effects at different temperatures. In this example, the 10× self-splicing and circularization buffer was 500 mM Tris-HCl, pH 7.5, 300 mM MgCl2, and 600 mM (NH4)2SO4 to achieve a final buffer concentration of 1×. The reaction conditions were 45°C, 50°C, and 55°C for 15 min, followed by a maintenance at 4°C. Figure 6 As shown, circular RNA bands can also be obtained at 45℃, and the proportion of circularized bands increases accordingly with increasing reaction temperature.
[0238] Example 7: In vitro expression of the target gene using the construct of the present invention
[0239] Based on this, the expression of the corresponding target protein was further tested after transfection of cells by in vitro self-splicing and circularization of IIC intron sequences from natural marine Bacillus species into circular RNA products containing different target sequences, including the IRES sequence.
[0240] Based on the methods in Examples 4 and 5, after constructing cloning vectors through homologous recombination, the IIC intron sequences from natural marine Bacillus were used to in vitro self-splicing and circularize approximately 1500 nucleotides of eGFP, 1300 nucleotides of Nanoluc, and 2400 nucleotides of Fluc, including the IRES sequence.
[0241] As a control, mRNA-Fluc (SEQ ID NO:55) was constructed on the pVAX.1 vector, with the 3' end of the sequence containing the restriction enzyme site ApaI. The constructed plasmid was digested with ApaI and then transcribed in vitro, and purified by LiCl.
[0242] To minimize immune degradation caused by linear RNA, the RNA product was purified after obtaining a salt-free, in vitro circularized product, following the procedure in Example 5. The target RNA was then transfected into HEK293T cells using MessengerMAX (Invitrogen) (LMRNA001), following the supplier's instructions, with a transfection time of 24-48 hours.
[0243] The expression level of eGFP can be visually assessed by observing green fluorescence under a fluorescence microscope. Figure 7a shows the bright-field and green fluorescence channels of cells 24 hours after RNA transfection; when transfecting cNanoLuc, 1 μg and 2 μg of circular RNA were transfected respectively to confirm the dose-response relationship. 48 hours after transfection, the protein expression of NanoLuc was detected using a specific luciferase assay kit (Promega) on a microplate reader. The results... Figure 7 (b) This demonstrates that cNanoLuc effectively mediates protein expression, and its response value increases exponentially with increasing transfection dose; similarly, 48 hours after transfection with cFLuc, a specific luciferase assay kit (Promega) was used to verify on a microplate reader that transfection with cFLuc effectively regulates FLuc protein expression. Figure 7 c).
[0244] Example 8: Preparation of optimized IIC intron expression construct and in vivo expression assay of target protein.
[0245] This embodiment tested the in vivo expression of a circular RNA product containing the target sequence, including the IRES sequence, after in vitro self-splicing and circularization of the IIC intron sequence from natural marine Bacillus.
[0246] cFLuc is obtained based on the methods in Examples 5 and 7.
[0247] In vivo assay implementation: IIC-cFLuc, prepared and purified based on optimized IIC, was packaged as LNP. In short, LNP delivery was performed using a molar ratio of SM-102:DSPC:Cholesterol:PEG2000 = 50:10:38.5:1.5, with reagents from SM-102 (TargetMol), DSPC and Cholesterol (Nippon Seika Co., Ltd.), and PEG2000 (AVT). Encapsulation was performed using a Bluebird microfluidic encapsulator equipped with a chip (Feather Microfluidic Chip APE×BIO RM1002-1).
[0248] 20 μg of cFLuc was diluted to a specific concentration with PBS or physiological saline and then administered intramuscularly. Following the intramuscular injection, the Luc substrate (Progema) was injected, and protein expression was monitored using a small animal in vivo imaging system. Figure 8 As shown, protein expression can be detected as early as 8 hours after immunization, and the signal intensity is high.
[0249] Example 9: Preparation of polyA-containing IIC intron expression construct plasmids and further purification of circular RNA
[0250] Circular RNA constructed using the pVAX.1 vector with a 25nt polyA sequence can be purified after circularization using oligodT magnetic beads, packing material, or pre-packed columns. Since the circularized RNA no longer contains the polyA sequence, it will not bind to oligodT. Instead, the intron sequences or linear precursors cleaved from both ends will bind to oligodT, resulting in higher purity circular RNA obtained during flow-through. Taking circularized luciferase (cFluc) as an example, purification was performed using the pVAX.1 vector with and without the polyA sequence, respectively, employing the purification method described in Example 5 and the oligodT magnetic bead purification method.
[0251] The oligo dT magnetic bead purification method is performed as follows: After circularization, the RNA is pre-denatured at 70℃ for 5 min and 4℃ for 5 min. Then, 100 μL of 10× binding buffer is added to every 900 μL of RNA, and the RNA is co-incubated with Oligo dT coated magnetic beads (Shanghai Lingyin Biotechnology) at 4℃ for 30 min in a high-salt ion buffer environment (10× binding buffer: 100 mM Tris, 500 mM NaCl, pH 7.5). After the reaction, the sample tube is placed in a magnetic separator, so that the magnetic beads and the bound sample are concentrated on one side of the tube (about 30 seconds). The supernatant is carefully aspirated (without centrifugation). Since the circularized RNA does not contain the polyA sequence, it does not bind to the magnetic beads. At this time, the supernatant is aspirated to recover line 3. The sample tube is removed from the magnetic separator, and elution buffer (10 mM Tris, pH 7.5) is added to elute the sample bound to the magnetic beads to obtain line 4.
[0252] The results are as follows Figure 9 As shown, adding 25nt polyA sequences to both ends does not affect the circularization efficiency of type II introns (line 2), and after incubation with magnetic beads, more circular RNA is enriched in the flow sample (line 3).
[0253] Example 10: Screening different IRES sequences based on the IIC intron expression system
[0254] This embodiment tested the effects of different IRES sequences on the IIC intron expression system.
[0255] Based on the methods of Examples 1, 2, and 4, GFP linked to IRES(1-12) (SEQ ID NO:30-41) was constructed into an IIC intron self-splicing system derived from natural marine Bacillus. Based on the method of Example 7, the obtained circular RNA product was transfected into human 293T cells and mouse C2C12 cells using MessengerMAX (Invitrogen) (LMRNA001).
[0256] Flow cytometry was used to analyze the ability of constructed circular RNAs containing different IRES sequences to express GFP protein in human 293T cells and mouse C2C12 cells, and to screen for IRES sequences that showed good expression levels in both human and mouse cells. Figure 10 As shown, the IRES11-based expression construct exhibited higher proportions of GPF-positive cells and higher mean fluorescence intensity (MFI) in both mouse and human cells. Sequence listing:
[0257]
[0258]
[0259]
[0260]
[0261]
[0262]
[0263]
[0264]
[0265]
[0266]
[0267]
[0268]
[0269]
Claims
1. A nucleic acid molecule comprising a 3' Group II intron fragment, a 5' Group II intron fragment, and a protein coding or non-coding region, said nucleic acid molecule capable of obtaining a circular RNA having a biological activity; The 3' Group II intron fragment and the 5' Group II intron fragment are from a IIC-type intron of Bacillus marinus (ATCC 23184) Oceanobacillus iheyensis , a IIC-type intron of Thermus itaipicus (ATCC 33914) Thermoanerobacter italicus , a IIE-type intron of Bradyrhizobium japonicum USDA 6 (ATCC 10390) Bradyrhizobium japonicum , a IIE-type intron of Sinorhizobium meliloti 1021 (ATCC 33113) Sinorhizobium meliloti , a IIF-type intron of Geobacter uraniophilus Rn-15 (ATCC BAA-897) Geobacter uraniumreducens , or a IIF-type intron of Anaerofustis thermohydrosulfuricium (ATCC BAA-815) Pelotomaculum thermopropionicum . said 3' Group II intron fragment comprising a portion of Group II intron stem loop domain D4, a full length of stem loop domain D5, and a full length of stem loop domain D6; and, said 5' Group II intron fragment comprising a full length of Group II intron stem loop domain D1, a full length of stem loop domain D2, a full length of stem loop domain D3, and a portion of stem loop domain D4.
2. The nucleic acid molecule of claim 1, said nucleic acid molecule being a deoxyribonucleic acid strand or a ribonucleic acid strand.
3. The nucleic acid molecule of claim 1, further comprising an internal ribosome entry site (IRES) from: Coxsackievirus B3 (CVB3), Coxsackievirus Bl (CVBl), Coxsackievirus B5 (CVB5), Echo virus, Human rhinovirus (HRV), Poliovirus (PV), Simian enterovirus SA5 (Simian A5), Simian enterovirus SV4 (Simian V4), Aura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, Simian virus 40, Solenopsis invicta virus 1, Rhabdothrips cressi virus, Reticulendotheliosis virus, Fovman poliovirus 1, Operophtera brumata virus, Kashmir bee virus, Erythroneura campbeli virus-1, Human immunodeficiency virus type 1, Erythroneura campbeli virus-1, Pediculus P virus, Hepatitis C virus, Hepatitis A virus, Hepatitis GB virus, Foot-and-mouth disease virus, Human enterovirus 71, Equine rhinovirus, Ectropis oblique-like virus, Encephalomyocarditis virus (EMCV), Drosophila C virus, Crucifer tobamovirus, Laodelphax striatellus virus, Bovine viral diarrhea virus 1, Black queen cell virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus, Acute bee paralysis virus, Rosa rugosa chlorotic ring spot virus, Swine fever virus, Human FGF2, Human SFTPA1, Human AMM / RUNXl, Drosophila antennapedia, Human AQP4, Human AT1R, Human BAG-1, Human BCL2, Human BiP, Human c-IAPl, Human c-myc, Human eIF4G, Mouse NDST4L, Human LEF1, Mouse HIF1 alpha, Human n.myc, Mouse Gtx, Human p27kipl, Human PDGF2 / c-sis, Human p53, Human Pim-1, Mouse Rbm3, Drosophila reaper, Canine camper, Drosophila Ubx, Salivary virus, Coxsackievirus, Double echo virus, Human UNR, Mouse UtrA, Human VEGF-A, Human XIAP, Drosophila hairless, Saccharomyces cerevisiae TFIID, Saccharomyces cerevisiae YAP1, Human c-src, Human FGF-1, Simian minute virus, Turnip crinkle leaf virus, aptamer of eIF4G, or IRES of Coxsackievirus A (CVBl / 2).
4. The nucleic acid molecule of claim 3, the IRES from Human rhinovirus 2.
5. The nucleic acid molecule of claim 3, the IRES from an IRES of a Human rhinovirus, Enterovirus, Coxsackievirus, Poliovirus, Simian enterovirus, or Echo virus.
6. The nucleic acid molecule of claim 1, further comprising one or more elements selected from the group consisting of: a 5' spacer sequence, a Kozak sequence, and a 3' spacer sequence.
7. The nucleic acid molecule of claim 1, the protein coding region encoding a eukaryotic protein or a prokaryotic protein.
8. The nucleic acid molecule of claim 1, the protein coding region encoding a human protein or a non-human protein.
9. The nucleic acid molecule of claim 1, wherein the protein-coding region encodes an antibody.
10. The nucleic acid molecule of claim 1, wherein the protein-coding region encodes a protein for therapeutic or prophylactic vaccine use in protein replacement therapy.
11. The nucleic acid molecule of claim 1, wherein the protein-coding region encodes a protein for vaccine use against a pathogen or a tumor vaccine.
12. The nucleic acid molecule of claim 1, wherein the protein-coding region encodes green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), cGFP, Gaussian luciferase (Gluc), firefly luciferase (Fluc), nanoLuc, human erythropoietin (hEPO), or Cas9 endonuclease.
13. The nucleic acid molecule of any one of claims 1-12, wherein, The nucleic acid molecule further comprises: (1) a 5' homology arm upstream of the 3' Group II intron fragment; and, (2) a 3' homology arm downstream of the 5' Group II intron fragment.
14. The nucleic acid molecule of claim 13, wherein the 5' homology arm and the 3' homology arm are capable of forming a stem-loop structure.
15. The nucleic acid molecule of claim 13, wherein the 5' homology arm or the 3' homology arm is independently 5-50 nucleotides in length.
16. The nucleic acid molecule of claim 6, wherein, The spacer sequence is a polyA-C sequence or a polyA sequence.
17. The nucleic acid molecule of claim 6, wherein the spacer sequence is 15-50 nucleotides in length.
18. The nucleic acid molecule of any one of claims 1-12, 14-17, wherein, The nucleic acid molecule further comprises a RNA polymerase promoter upstream of the 3' Group II intron fragment.
19. The nucleic acid molecule of claim 18, wherein the RNA polymerase promoter is upstream of the 5' homology arm; and / or The RNA polymerase promoter is a RNA polymerase promoter from a T7 virus, a T6 virus, a SP6 virus, a T3 virus, or a T4 virus.
20. The nucleic acid molecule of claim 13, wherein, The nucleic acid molecule further comprises a RNA polymerase promoter upstream of the 3' Group II intron fragment.
21. The nucleic acid molecule of claim 20, wherein the RNA polymerase promoter is upstream of the 5' homology arm; and / or The RNA polymerase promoter is a RNA polymerase promoter from a T7 virus, a T6 virus, a SP6 virus, a T3 virus, or a T4 virus.
22. The nucleic acid molecule of any one of claims 1-12, 14-17, 19-21, wherein, The nucleic acid molecule further comprises a signal peptide sequence upstream of the protein-coding region or non-coding region, and / or a trimer sequence or ferritin sequence downstream of the protein-coding region or non-coding region.
23. The nucleic acid molecule of claim 13, wherein, The nucleic acid molecule further comprises a signal peptide sequence upstream of the protein-coding region or non-coding region, and / or a trimer sequence or ferritin sequence downstream of the protein-coding region or non-coding region.
24. The nucleic acid molecule of claim 18, wherein, The nucleic acid molecule further comprises a signal peptide sequence upstream of the protein-coding region or non-coding region, and / or a trimer sequence or ferritin sequence downstream of the protein-coding region or non-coding region.
25. The nucleic acid molecule of any one of claims 1-12, 14-17, 19-21, 23-24, wherein, The 3' Group II intron fragment comprises a sequence from a 3' proximal Group II intron, and / or the 5' Group II intron fragment comprises a sequence from a 5' proximal Group II intron.
26. The nucleic acid molecule of claim 25, wherein the sequence from the 3’ proximal Group II intron comprises a portion of the sequence of the adjacent exon of the corresponding native Group II intron; and / or, the sequence from the 5’ proximal Group II intron comprises a portion of the sequence of the adjacent exon of the corresponding native Group II intron.
27. The nucleic acid molecule of claim 13, wherein, The 3’ Group II intron fragment comprises sequence from the 3’ proximal Group II intron, and / or, the 5’ Group II intron fragment comprises sequence from the 5’ proximal Group II intron.
28. The nucleic acid molecule of claim 27, wherein the sequence from the 3’ proximal Group II intron comprises a portion of the sequence of the adjacent exon of the corresponding native Group II intron; and / or, the sequence from the 5’ proximal Group II intron comprises a portion of the sequence of the adjacent exon of the corresponding native Group II intron.
29. The nucleic acid molecule of claim 18, wherein, The 3’ Group II intron fragment comprises sequence from the 3’ proximal Group II intron, and / or, the 5’ Group II intron fragment comprises sequence from the 5’ proximal Group II intron.
30. The nucleic acid molecule of claim 29, wherein the sequence from the 3’ proximal Group II intron comprises a portion of the sequence of the adjacent exon of the corresponding native Group II intron; and / or, the sequence from the 5’ proximal Group II intron comprises a portion of the sequence of the adjacent exon of the corresponding native Group II intron.
31. The nucleic acid molecule of claim 22, wherein, The 3’ Group II intron fragment comprises sequence from the 3’ proximal Group II intron, and / or, the 5’ Group II intron fragment comprises sequence from the 5’ proximal Group II intron.
32. The nucleic acid molecule of claim 31, wherein the sequence from the 3’ proximal Group II intron comprises a portion of the sequence of the adjacent exon of the corresponding native Group II intron; and / or, the sequence from the 5’ proximal Group II intron comprises a portion of the sequence of the adjacent exon of the corresponding native Group II intron.
33. The nucleic acid molecule of any one of claims 1-12, 14-17, 19-21, 23-24, 26-32, wherein, The 3’ Group II intron fragment further comprises a polyA sequence upstream and / or the 5’ Group II intron fragment further comprises a polyA sequence downstream.
34. The nucleic acid molecule of claim 33, wherein the polyA sequence is 15-50 nucleotides in length.
35. The nucleic acid molecule of claim 13, wherein, The 3’ Group II intron fragment further comprises a polyA sequence upstream and / or the 5’ Group II intron fragment further comprises a polyA sequence downstream.
36. The nucleic acid molecule of claim 35, wherein the polyA sequence is 15-50 nucleotides in length.
37. The nucleic acid molecule of claim 18, wherein, The 3’ Group II intron fragment further comprises a polyA sequence upstream and / or the 5’ Group II intron fragment further comprises a polyA sequence downstream.
38. The nucleic acid molecule of claim 37, wherein the polyA sequence is 15-50 nucleotides in length.
39. The nucleic acid molecule of claim 22, wherein, The 3’ Group II intron fragment further comprises a polyA sequence upstream and / or the 5’ Group II intron fragment further comprises a polyA sequence downstream.
40. The nucleic acid molecule of claim 39, wherein the polyA sequence is 15-50 nucleotides in length.
41. The nucleic acid molecule of claim 25, wherein, The 3’ Group II intron fragment further comprises a polyA sequence upstream and / or the 5’ Group II intron fragment further comprises a polyA sequence downstream.
42. The nucleic acid molecule of claim 41, wherein the polyA sequence is 15-50 nucleotides in length.
43. The nucleic acid molecule of claim 1, comprising the following elements operably linked to each other: (1) a 3' group II intron fragment; (2) a 5' spacer sequence; (3) an internal ribosome entry site (IRES); (4) optionally a Kozak sequence; (5) a protein coding region or non-coding region; (6) a 3' spacer sequence; (7) a 5' group II intron fragment.
44. The nucleic acid molecule of claim 1, comprising the following elements operably linked to each other: (1) a 5' homology arm; (2) a 3' group II intron fragment; (3) a 5' spacer sequence; (4) an internal ribosome entry site (IRES); (5) optionally a Kozak sequence; (6) a protein coding region or non-coding region; (7) a 3' spacer sequence; (8) a 5' group II intron fragment; and (9) a 3' homology arm.
45. A vector comprising the nucleic acid molecule of any one of claims 1-44.
46. Use of the nucleic acid molecule of any one of claims 1-44 or the vector of claim 45 in the manufacture of a circular RNA precursor molecule and / or a circular RNA.
47. A method of making a circular RNA, comprising: using the nucleic acid molecule of any one of claims 1-44 or the vector of claim 45 to make a circular RNA precursor molecule; circularizing the circular RNA precursor molecule to obtain a circular RNA.
Citation Information
Patent Citations
Construction body for preparing circular RNA, method and application thereof
CN115404240A
RSV f protein mutants
WO2017109629A1
Construction body for preparing circular RNA, method and application thereof
CN117413065A