Erigeron breviscapus Cas9 gene editing system construction method and application

Abstract

The invention discloses a construction method and application of an erigeron breviscapus Cas9 gene editing system, and the construction method comprises the following steps: selecting an erigeron breviscapus EbPDS gene sequence and designing a target site, amplifying a target fragment by taking a PGTR plasmid as a template, and connecting the fragment to an expression vector PV58-Cas9 through homologous recombination to obtain the erigeron breviscapus Cas9 gene editing system. An erigeron breviscapus leaf explant is placed in a suspension infection solution containing PV58-Cas9-EbPDS agrobacterium to be infected, and then is respectively cultured in an erigeron breviscapus co-culture medium, a delayed screening culture medium and a screening culture medium to obtain a new callus with successful transgenosis. The method has the advantages that (1) a gene editing system constructed by the recombinant plasmid PV58-Cas9-EbPDS is efficient and feasible; (2) the EbPDS gene is successfully applied to CRISPR / cas9 mediated genome editing, and individuals with specific genotypes can be quickly screened out by observing whether offspring plants have a whitening phenotype phenomenon or not, so that an important means is provided for erigeron breviscapus gene function research and gene editing breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic breeding, and particularly relates to a construction method and application of a CRISPR / Cas9 gene editing system for Erigeron breviscapus. Background Art

[0002] The CRISPR / Cas9 gene editing system can specifically recognize target sequences adjacent to the PAM (NGG) motif and cleave at 3 nt upstream of it. At the same time, it cleaves at 3 - 8 nt upstream of the PAM region to form DSB (double strains break, double-strand break). Subsequently, the body repairs the damaged DNA through its own repair mechanisms such as homologous recombination and non-homologous recombination, thereby generating the phenomenon of Indel (including deletion and insertion). Genome editing technology is a powerful tool for studying gene functions and performing directed modification of organism genes. With the rapid development of CRISPR / Cas9 technology in recent years, genome editing technology plays an increasingly important role in the field of crop breeding. Excellent traits are often associated with multiple genes or multiple loci of a single gene, and it is necessary to construct a multi-target CRISPR / Cas9 vector system that can simultaneously edit two or more loci. For example, knocking out the OsAAP3 gene in japonica rice was found to significantly increase the tiller number, thus improving the grain yield. Knocking out the gene encoding granule-bound starch synthase (GBSS) in potatoes selected potatoes that produce amylopectin.

[0003] As an emerging genome editing technology, the CRISPR / Cas9 technology has not yet established an effective CRISPR / Cas9 editing system in most medicinal plants. Researchers usually use the reporter gene PDS (phytoene desaturase) or other special target genes to verify the effectiveness and feasibility of the CRISPR / Cas9 editing system. The PDS gene is a key gene in the process of plant chlorophyll synthesis. If the function of this gene is edited, it will cause albinism in the green tissues of plants. Therefore, the PDS gene is often used as a marker gene for the application of the CRISPR / Cas9 gene editing technology. In recent years, researchers have obtained completely albino or chimeric albino plants in multiple medicinal plants, including Rehmannia glutinosa, Rehmannia chingii, Dioscorea opposita, Hemerocallis fulva, and Cannabis sativa, by constructing a CRISPR / Cas9 knockout vector for the PDS gene and using the Agrobacterium tumefaciens infection method. The construction of the CRISPR / Cas9 editing system for the PDS gene can provide a reference for gene editing in other medicinal plants and also provide a basis for the verification and identification of other functional genes. In recent years, the CRISPR / Cas9 vector construction systems applied to plants by researchers include the vector construction system based on gene gun transformation and the vector construction system based on Agrobacterium transformation. However, the CRISPR / Cas9-mediated gene editing system for Erigeron breviscapus has not been reported, which limits the study of gene function. Summary of the Invention

[0004] In view of the above problems, the object of the present invention is to provide a method for constructing an efficient and feasible CRISPR / Cas9 gene editing system for Erigeron breviscapus.

[0005] To achieve the above object, the technical solution adopted by the present invention is:

[0006] A method for constructing a CRISPR / Cas9 gene editing system for Erigeron breviscapus, comprising the following steps:

[0007] First, according to the phylogenetic tree homology analysis, select the Erigeron breviscapus EbPDS gene with high homology to Nicotiana tabacum NtPDS, design target sites according to the sequence, and combine with the target site design website http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR to design 2 target sites T1 and T2 for the EbPDS gene. Design PCR amplification primers according to the target sites.

[0008] After the target site PCR amplification primers were synthesized, the EbPDS gene was amplified using the PGTR plasmid as a template. The amplification system was as follows: 15 μl of Novi 2×Rapid Taq Master Mix, 0.3 μl of Primer F (10 μM), 0.3 μl of Primer R (10 μM), 1.5 μl of PGTR template, and the volume was made up to 30 μl with water. The reaction program was 95°C for 3 min; 95°C for 20 s, 55°C for 20 s, 72°C for 10 s, for 35 cycles; 72°C for 3 min; 25°C for 1 s. The vector PV58-Cas9 was digested with KpnI, the fragment was recovered using a gel recovery kit, and the amplified fragment of the EbPDS gene was ligated to the expression vector PV58-Cas9 by homologous recombination to obtain the recombinant plasmid PV58-Cas9-EbPDS.

[0009] The nucleotide sequence of the said EbPDS gene is shown in SEQ ID NO: 1.

[0010] The present invention also provides the protein encoded by the EbPDS gene, and the amino acid sequence of the said protein is shown in SEQ ID NO: 2.

[0011] In addition, when the EbPDS gene fragment was subjected to homologous recombination with the vector PV58-Cas9, the EbPDS gene needed to be amplified and recovered using PCR amplification primers with homologous arms.

[0012] The present invention also provides a genetically engineered bacterium, which contains the above-mentioned recombinant plasmid or the exogenous EbPDS gene is integrated into the genome of the said genetically engineered bacterium.

[0013] Preferably, the said genetically engineered bacterium is Escherichia coli DH5α strain and Agrobacterium tumefaciens EHA105 strain.

[0014] The constructed recombinant plasmid PV58-Cas9-EbPDS was electrotransformed into Escherichia coli DH5α, screened by colony PCR, and the plasmid was extracted for Sanger sequencing to confirm the successful construction of the vector. Then the recombinant plasmid PV58-Cas9-EbPDS was transformed into Agrobacterium tumefaciens EHA105, positive clones were screened by colony PCR, and then transgenic transformation was carried out to obtain Agrobacterium tumefaciens PV58-Cas9-EbPDS.

[0015] The Erigeron breviscapus leaf explants were placed in the infection solution containing Agrobacterium tumefaciens PV58-Cas9-EbPDS for infection, and then cultured in the Erigeron breviscapus co-culture medium, recovery medium, and screening medium in sequence to obtain transgenic newly proliferated transgenic callus;

[0016] The method for preparing the infection solution of the Agrobacterium tumefaciens PV58-Cas9-EbPDS comprises the following steps: adding a single colony of positive Agrobacterium tumefaciens containing the recombinant plasmid PV58-Cas9-EbPDS into 5 mL of LB medium containing 40-65 mg / mL kanamycin and 40-70 mg / mL rifampicin, culturing overnight at 28 °C on a shaker at 200 rpm, sucking 500 μL of the bacterial solution into 50 mL of LB liquid medium containing 40-65 mg / mL kanamycin and 40-70 mg / mL rifampicin, culturing at 28 °C on a shaker at 200 rpm, when the bacterial solution becomes turbid and the OD value reaches 1-2, centrifuging at 5000 rpm for 8 min at room temperature to collect the bacterial cells, discarding the supernatant, and adding a resuspension solution in a laminar flow hood to centrifuge and dilute to an OD600 value of 0.2-0.3 to prepare the infection solution.

[0017] Preferably, the amplification system is: 15 μL of Novi 2×Rapid Taq Master Mix, 0.3 μL of Primer F (10 μM), 0.3 μL of Primer R (10 μM), 1.5 μL of PGTR template, and make up the volume to 30 μL with water;

[0018] The amplification reaction program is: 95 °C for 3 min; 95 °C for 20 s, 55 °C for 20 s, 72 °C for 10 s, for 35 cycles; 72 °C for 3 min; 25 °C for 1 s.

[0019] Preferably, before plasmid extraction, colony PCR verification is carried out using the primers EbPDS-U26-F and EbPDS-inf-T2as-R.

[0020] Preferably, the transformation and culture method of the Agrobacterium tumefaciens PV58-Cas9-EbPDS is: sucking 70 μL of the bacterial solution and spreading it on an LB plate containing Kan and Rif, and culturing it upside down in an incubator at 28 °C for 2-3 days.

[0021] Another object of the present invention is to provide an application of the above-mentioned Agrobacterium tumefaciens PV58-Cas9-EbPDS in the propagation of Erigeron breviscapus.

[0022] The present invention also provides a method for propagating Erigeron breviscapus using Agrobacterium tumefaciens PV58-Cas9-EbPDS, comprising the following steps: placing the explants of Erigeron breviscapus leaves in the infection solution containing Agrobacterium tumefaciens PV58-Cas9-EbPDS for infection, and then culturing them in the co-culture medium, delayed screening medium and screening medium of Erigeron breviscapus respectively to obtain successfully transgenic new callus. The new callus is respectively cultured in a bud initiation medium, a bud differentiation medium and a rooting medium to obtain transgenic plants.

[0023] Preferably, the method for preparing the infection solution comprises the following steps: adding Agrobacterium PV58-Cas9-EbPDS into an LB medium supplemented with 40-65 mg / ml kanamycin and 40-70 mg / ml rifampicin, shaking overnight at 28°C on a shaker, waiting until the bacterial solution becomes turbid with an OD value of 1-2, centrifuging and diluting to an OD600 value of 0.2-0.3 to prepare the infection solution, and adding AS to prepare a suspension infection solution; the infection solution comprises: MS basal medium, 30 g / L of sucrose, and 10-40 g / L of glucose.

[0024] Preferably, the method for preparing the Erigeron breviscapus explant comprises the following steps:

[0025] (1) Culturing sterile seedlings: inoculating the disinfected and sterilized Erigeron breviscapus seeds in sequence into an MS basal medium, a seed germination medium, and a rooting medium for culture to obtain sterile seedlings;

[0026] (2) Preparing the Erigeron breviscapus explant: culturing the sterile seedlings in an Erigeron breviscapus callus medium for one day of pre-culture to obtain Erigeron breviscapus leaf explants, and then using the leaf explants for transgenic infection.

[0027] Preferably, the co-culture medium for Erigeron breviscapus is: MS, 0.004 mg / mL 6-BA, 0.0005 mg / mL TDZ, 0.002 mg / mL NAA, 3% sucrose, 0.8% agar, 100 μmol / L AS; the co-culture is a dark culture at a temperature of 22-25°C for 2 days;

[0028] The delayed screening medium is: MS, 0.004 mg / mL 6-BA, 0.0005 mg / mL TDZ, 0.002 mg / mL NAA, 3% sucrose, 0.8% agar, 0.27 mg / mL Tmt; the conditions for the delayed screening culture are: light culture at 25°C for 14 days in a light culture room;

[0029] The screening medium is: MS, 0.002 mg / mL 6-BA, 0.005 mg / mL TDZ, 0.001 mg / mL NAA, 3% sucrose, 0.8% agar, 0.27 mg / mL Tmt, 10 mg / L Hyg; the conditions for the screening culture are: light culture at 25°C for 2-4 weeks.

[0030] Preferably, the shoot initiation medium is: SH, 0.001 mg / mL 6-BA, 0.001 mg / mL NAA, 0.08 g / L AD, 0.05 g / L Glu, 2 g / L CH, 3% sucrose, 0.8% agar, 0.27 mg / ml Tmt, 5 mg / L Hyg; light culture at 25°C;

[0031] The described bud differentiation medium is: MS, 0.0005 mg / mL KT, 0.0003 mg / mL NAA, 3% sucrose, 0.8% agar, 0.27 mg / mL Tmt, 5 mg / L Hyg; cultured under light at 25°C;

[0032] The described rooting medium is: MS, 0.1 mg / L NAA, 1% sucrose, 0.8% agar, 0.27 mg / ml Tmt.

[0033] The present invention has the following beneficial effects:

[0034] (1) The gene editing system constructed with the recombinant plasmid PV58-Cas9-EbPDS is highly efficient and feasible; (2) The EbPDS gene has been successfully applied to CRISPR / cas9-mediated genome editing, effectively knocking out the phytoene desaturase (PDS) gene. In plant breeding and variety improvement, the albino trait can be used as an obvious marker. By observing whether the albino phenotype appears in the offspring plants, individuals with specific genotypes can be quickly screened out, accelerating the breeding process. The present invention provides an important means for the study of the gene function of Erigeron breviscapus and gene editing breeding, and also has the potential for wide application in the genetic transformation and genome editing genetic improvement of other medicinal plants. Description of the Drawings

[0035] Figure 1 It is a schematic diagram for the construction of the Cas9 gene editing system of Erigeron breviscapus;

[0036] Figure 2 It is the vector map of the vector PV58-Cas9;

[0037] Figure 3 It is the vector map of the recombinant plasmid PV58-Cas9-EbPDS;

[0038] Figure 4 It is a schematic diagram of the agrobacterium of PV58-Cas9-EbPDS knocking out the target gene;

[0039] Figure 5 It is the regenerated albino shoots of the Erigeron breviscapus gene transformed by the agrobacterium of PV58-Cas9-EbPDS;

[0040] Figure 6 It is the PCR detection of the transgenic plants of the agrobacterium of PV58-Cas9-EbPDS; Detailed Embodiments

[0041] The following further describes the specific embodiments of the present invention. It should be noted here that the description of these embodiments is used to help understand the present invention, but does not limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0042] Example 1

[0043] A method for constructing a gene editing system of Erigeron breviscapus Cas9, comprising the following steps:

[0044] First, according to the phylogenetic tree homology analysis, select the Erigeron breviscapus EbPDS gene with high homology to tobacco NtPDS. Design target sites according to the sequence, and combine the target site design website http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR to design 2 target sites T1 and T2 of the EbPDS gene (Table 1). Design PCR amplification primers according to the target sites (Table 2). After the synthesis of the target site PCR amplification primers, use the PGTR plasmid as a template to amplify the EbPDS gene, and perform amplification, recovery, homologous recombination, Agrobacterium transformation, bacterial water detection, preparation of transgenic infection solution, Agrobacterium-mediated genetic transformation of Erigeron breviscapus, PCR detection of PV58-Cas9-EbPDS Agrobacterium transgenic plants, and gene editing site analysis of PV58-Cas9-EbPDS Agrobacterium transgenic plants. The operation steps of each stage are as follows:

[0045] (1) Construction of phylogenetic tree

[0046] First, use the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) for BLAST search and download the amino acid sequence of the NtPDS gene. Then, perform a BLAST search in the Erigeron breviscapus plant database (http: / / cucurbitgenomics.org / ), download the Erigeron breviscapus PDS-related gene sequences, and import them into the MEGA7 software to construct a phylogenetic tree using the neighbor-joining method (N-J).

[0047] (2) Selection and design of EbPDS gene target sites

[0048] Based on the homology analysis, select the Erigeron breviscapus EbPDS gene with high homology to tobacco NtPDS. According to the EbPDS gene sequence information and sequence alignment results, combine the target site design website http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR to design 2 target sites T1 and T2 of the EbPDS gene (Table 1). Design PCR amplification primers according to the target sites (Table 2).

[0049] Table 1 EbPDS target site sequence

[0050] Target site name Sequence (5’—3’) EbPDS-T1 ACGCCCACCTAAGCCATTGA EbPDS-T2 GCAAAGTACTTGGCTGATGC

[0051] Table 2 EbPDS target site PCR amplification primers

[0052] Primer Sequence (5’—3’) EbPDS-T1-F TTCCCGGCTGGTGCAACGCCCACCTAAGCCATTGAGTTTTAGAGCTAGAAATAGCAAGT EbPDS-T2-R TTCTAGCTCTAAAACGCATCAGCCAAGTACTTTGCTGCACCAGCCGGGAAT EbPDS-U26-F TGTCCCAGGATTAGAATGATTAGGC EbPDS-inf-T2as-R TTCTAGCTCTAAAACGCATCAGCCAAGTACTTTGC

[0053] (3) Gene amplification and recovery

[0054] After the synthesis of the target site PCR amplification primers, using the PGTR plasmid as a template, gene amplification was carried out using DNA polymerase (phanta enzyme). The amplification system was as follows: Novi 2×Rapid Taq Master Mix 15 μl, Primer F (10 μM) 0.3 μl, Primer R (10 μM) 0.3 μl, PGTR template 1.5 μl, supplemented with water to 30 μl. The reaction program was 95°C for 3 min; 95°C for 20 s, 55°C for 20 s, 72°C for 10 s, for 35 cycles; 72°C for 3 min; 25°C for 1 s. After the PCR amplification program was completed, 1.2% agarose gel electrophoresis was used to detect whether the length of the amplified gene band was consistent with that of the target gene band. After the PCR product was detected by agarose gel electrophoresis, the obtained band was similar in length to the target gene band, indicating good amplification effect. The target gene was recovered and purified using the gel recovery kit of GenStar Company. The recovery concentration was measured using the instrument NanoDrop2000 and stored in a -20°C refrigerator.

[0055] (4) Construction and identification of gene recombinant vectors

[0056] Linearization of vector A: The PV58-Cas9 vector plasmid was double-digested with the restriction endonuclease Kpnl to obtain the linearized vector PV58-Cas9 ( Figure 2 ). It was purified and recovered using the E.Z.N.A.® CyclePure Kit of omega company. After measuring its concentration, it was stored in a -20°C refrigerator for later use.

[0057] Recombination of gene B: The target gene amplified using the ready-to-use seamless cloning enzyme kit of Sangon Biotech (Shanghai) Co., Ltd. was ligated and recombined with the linearized vector PV58-Cas9. The ligation method and transformation method used recombinant ligation and heat shock transformation, and the transformed strain was E. coli (DH5α) competent cells.

[0058] PCR detection of bacterial water: Randomly select 8 single colonies from the transformation medium in a laminar flow hood and place them in 20 μl ddH 2In O, 3 μl was taken as the template for PCR amplification. The PCR reaction system used was the 2x Taq Master Mix enzyme reaction system of Nanjing Novoprotein Scientific Co., Ltd. The PCR program was 95°C for 3 min, 95°C for 30 s, 55°C for 15 s, 72°C for 30 s / kb for 35 cycles; after the reaction program of 72°C for 5 min ended, 1% agarose was used to detect the length of the PCR product. After agarose gel electrophoresis detection, obvious bands were observed in the PCR product between 750 bp and 500 bp, which was close to the target fragment (506 bp) and consistent with the expected result. Then the bacterial suspension was sent to Tsingke for sequencing. The results showed that the gene was successfully ligated without mutation. Single colonies were selected as positive bacteria, indicating successful assembly. The bacteria were preserved by mixing 50% glycerol and the bacterial solution at a volume ratio of 1:1.

[0059] The reference sequence of the amplification product is as follows (the primer sequences are underlined, the target site sequences are boxed, and the PAM site sequences are double-underlined):

[0060] GTGTCGACTATCCAAGACCAGACCTTGATAACACCTCTAATTTCTTGGAAGCTGCTTA TTTGTCTTCTA CCTTCCGAGCT TCTCCACGCCCACCTAAGCCATTGA AGG TTGTAATTGCTGGTGCAGGTAAAACCTTCATACTTATACTGCTCATTATATTGTCTTTTAAGTCGCTTTTGTTTGAGAATTTGATACTGCCACATCTGATAGATAACCAAATGATACTTCAAGTGTTCAAGTGTATCCCCAATGATGCTTTTTATGCCACATACTAACATCTGCTCTATTTTGCTATCCCGCTTACTTTTGCAAACTTCGCATATGCAGGTCTCGCTGGTTTATCAACTGCAAAGTACTTGGCTGATGC CGG TCACAAGCCAATTCTGCTAGAA GCAAGGGATGTTCTTGGTGG AAAGGTAGCCGATTTTTAAGAAATTACCATAGGATTAGAAGTCCT

[0061] (5)Plasmid vector extraction and transformation of Agrobacterium tumefaciens EHA105

[0062] Vector plasmid extraction: The vector plasmid carrying the recombinant plasmid PV58-Cas9-EbPDS was extracted using the ready-to-use Steadure plasmid extraction kit of Wuhan Aike Biotechnology Co., Ltd. (Figure 3 ). Extract the plasmids from the correctly aligned positive clones in Escherichia coli.

[0063] Transformation of Agrobacterium tumefaciens EHA105: Take 50 μL of Agrobacterium tumefaciens EHA105 competent cells in a 1.5 mL centrifuge tube, add 5 μL of the correctly aligned plasmid, and gently mix with a pipette. Then, let it stand on ice for 5 min, quickly freeze in liquid nitrogen for 5 min, heat shock at 37 °C for 5 min, and incubate on ice for 5 min. Add 700 μL of LB liquid medium without antibiotics, and resuscitate at 28 °C and 200 rpm on a shaker for 3 h. Pipette 70 μL of the bacterial solution and spread it on an LB plate containing Kan (50 mg / L) and Rif (25 mg / L). Incubate the plate upside down in a 30 °C incubator for 2 - 3 d, pick single colonies, and perform PCR to detect whether the target gene is present.

[0064] (6) Preparation of the infection solution

[0065] Add a single colony of positive Agrobacterium containing the recombinant plasmid PV58-Cas9-EbPDS to 5 mL of LB liquid medium containing Kan (50 mg / ml) and Rif (50 mg / ml), and culture overnight at 28 °C and 200 rpm on a shaker. Pipette 500 μL of the bacterial solution into 50 mL of LB liquid medium containing Kan (50 mg / ml) and Rif (50 mg / ml), and culture at 28 °C and 200 rpm on a shaker until the OD value of the bacterial solution reaches 1. Centrifuge at 5000 rpm at room temperature for 8 min to collect the bacteria, discard the supernatant, and add the resuspension solution in a laminar flow hood to prepare the infection solution with an OD value of 0.2.

[0066] (7) Agrobacterium-mediated genetic transformation of Erigeron breviscapus

[0067] Place the Erigeron breviscapus leaf explants into the prepared infection solution containing Agrobacterium with PV58-Cas9-EbPDS, and perform vacuum transformation treatment in sequence. The infection time is 30 min. First, apply a vacuum pressure of 0.7 kPa for 15 min, then take it out and shake it, and then apply pressure for another 15 min. After the infection, pour out the infection solution, place the leaf explants on sterile filter paper to absorb the moisture, and then transfer the leaf explants to the Erigeron breviscapus co-culture medium MS + 0.004 mg / mL 6-BA + 0.0005 mg / mL TDZ + 0.002 mg / mL NAA + 3% sucrose + 0.8% agar + 100 μmol / L AS. The co-culture is in the dark, the culture temperature is 22 - 25 °C, and the culture time is 2 days.

[0068] After the leaf explants were co-cultured for two days, they were inoculated onto a delayed selection medium of MS + 0.004 mg / mL 6-BA + 0.0005 mg / mL TDZ + 0.002 mg / mL NAA + 3% sucrose + 0.8% agar + 0.27 mg / mL Tmt, and placed in a light incubator at 25 °C for light culture for 14 days. The non-browning callus materials after delayed selection were transferred to a selection medium of MS + 0.002 mg / mL 6-BA + 0.005 mg / mL TDZ + 0.001 mg / mL NAA + 3% sucrose + 0.8% agar + 0.27 mg / mL Tmt + 10 mg / L Hyg and continued for light culture. Newly generated successfully transgenic callus could be seen after about 3 weeks. First, the selected callus was inoculated onto a bud initiation medium of SH + 0.001 mg / mL 6-BA + 0.001 mg / mL NAA + 0.08 g / L AD + 0.05 g / L Glu + 2 g / L CH + 3% sucrose + 0.8% agar + 0.27 mg / mL Tmt + 5 mg / L Hyg, and placed in a light incubator at 25 °C for light culture. Small buds could be seen growing on the surface of the callus after about 3 weeks ( Figure 5 ). The whole callus with growing young buds was inoculated onto a bud differentiation medium of MS + 0.0005 mg / mL KT + 0.0003 mg / mL NAA + 3% sucrose + 0.8% agar + 0.27 mg / mL Tmt + 5 mg / L Hyg until the young buds developed into seedlings. The seedlings were transferred to a rooting medium of MS, 0.1 mg / L NAA, 1% sucrose, 0.8% agar, 0.27 mg / mL Tmt to obtain transgenic Erigeron breviscapus plants.

[0069] (8) PCR Detection of PV58-Cas9-EbPDS Agrobacterium Transgenic Plants

[0070] After the Erigeron breviscapus leaf explants were infected with PV58-Cas9-EbPDS Agrobacterium, they were screened and grown in a selection medium containing Hyg. After the screening-differentiation process, they grew into young buds. Young buds obtained by screening and differentiation with Hyg were taken, DNA was extracted for PCR detection, and specific primers were designed before and after the target sequence of gene editing

[0071] EbPDS-F: ggagtgagtacggtgtgcTTTGTCTTCTACCTTCCGAGCT;

[0072] EbPDS-R: gagttggatgctggatggCCACCAAGAACATCCCTTGCPCR;

[0073] PCR amplification was carried out with a reaction system of 20 μL. After mixing various components, PCR reaction was carried out. The PCR reaction procedure was as follows: after pre-denaturation at 98°C for 5 minutes, 30 cycles were performed, each cycle was denaturation at 98°C for 5 seconds, annealing at 62°C for 5 seconds, extension at 72°C for 20 seconds, and finally, extension at 72°C for 1 minute. The PCR product was detected by 1.0% agarose gel electrophoresis, and the target band of 390 bp was obtained, confirming the presence of transgenes in hygromycin-resistant plants.

[0074] (9) Analysis of gene editing sites in PV58-Cas9-EbPDS Agrobacterium transgenic plants

[0075] The PDS gene is a key gene in the process of plant chlorophyll synthesis. If the PDS gene function is lost, the green tissue of the plant will become albinic. The regenerated albino sprouts formed by the PV58-Cas9-EbPDS Agrobacterium gene expression function cannot photosynthesize. Therefore, the regenerated albino sprouts formed by the PV58-Cas9-EbPDS Agrobacterium gene expression function show a high degree of dwarfing, reduced leaf area, and growth less than 0.5 cm. A total of 30 plants were regenerated from PV58-Cas9-EbPDS Agrobacterium-mediated transformation of Erigeron breviscapus leaf explants, and 10 regenerated plants showed an albino sprout phenotype. PCR was used to detect 4 complete albino sprouts, and the 4 albino plants (PDS-1, PDS-2, PDS-3, and PDS-4) were subjected to second-generation sequencing and mutation analysis ( Figure 6 ), and found that the T1 and T2 target sites of the albino sprouts and their vicinity had a variety of editing types, including single-base and multi-base deletions, single-base substitutions, etc. The T1 target site was mainly single-base deletions, and the T2 target site was mainly multi-base deletions (Table 3). These results show that PV58-Cas9-EbPDS Agrobacterium destroys the function of the PDS gene through base deletion ( Figure 4 ). In this study, the PV58-Cas9-EbPDS Agrobacterium gene mutation efficiency (number of edited plants / number of transformed plants) was 33.3%. Therefore, an efficient and feasible Cas9-mediated genome editing scheme was established in Erigeron breviscapus.

[0076] Table 3 Analysis of Cas9-EbPDS gene editing sites

[0077] Edited plant type T1 target T2 target T1 editing type T2 editing type Editing efficiency WT ACGCCCACCTAAGCCATTGA CTGGTTTATCAACTGCAAAGTACTTGGCTGATGCCGGT -- -- -- Plant 1 (1) ACGCCCACCTAAGCCAT-GA CTGGTTTATCAACTGCAAAGTACTTGGC---TGCCGGT 1D 3D 48.0% Plant 1 (2) ACGCCCACCTAAGCCAT-GA --------------------------------------- 1D 38D 26.0% Plant 1 (3) ACGCCCACCTAAGCC-TTGA CTGGTTTATCAACTGCAAAGTACTTGGC---TGCCGGT 1D 3D 11.8% Plant 1 (4) ACGCCCACCTAAGCCAT-GA CTGGTTTATCAACTGCAAAGTACTTGGCTGATGCCGGT 1D WT 7.67% Plant 1 (5) ACGCCCACCTAAGCC-TTGA --------------------------------------- 1D 38D 6.47%

[0078] Edited plant type T1 target T2 target T1 editing type T2 editing type Editing efficiency WT ACGCCCACCTAAGCCATTGA CTGCAAAGTACTTGGCTGATGCCGGTCAC -- -- -- Plant 2 (1) ACGCCCACCTAAGCCAT-GA CTG--------------------------------- CAC 1D 23D 20.26% Plant 2 (2) ACGCCCACCTAAGCCAT-GA CTGCAAAGTACTTGGC-TGCCGGTCAC 1D 3D 14.21% Plant 2 (3) ACGCCCACCTAAGC-TTGA CTGCAAAGTACTTGGC-TGCCGGTCAC 2D 3D 9.70% Plant 2 (4) ACGCCCACCTAA-TTGA CTGCAAAGTACTTGGC-TGCCGGTCAC 4D 3D 9.15% Plant 2 (5) ACGCCCACCTAA-TTGA CTG--------------------------------- CAC 4D 23D 8.01% Plant 2 (6) ACGCCCACCTAAGC-TTGA CTG--------------------------------- CAC 2D 23D 6.33% Plant 2 (7) ACGCCCACCTAAGCCA-TGA CTGCAAAGTACTTG-GCCGGTCAC 1D 6D 5.83%

[0079] Edited plant type T1 target T2 target T1 editing type T2 editing type Editing efficiency WT ACGCCCACCTAAGCCATTGA CTGCAAAGTACTTGGCTGATGCCGGTCAC -- -- -- Plant 3 (1) ACGCCCACCTAAGCCAT-GA CTGCAAAGTACTTGGC-TGCCGGTCAC 1D 3D 24.60% Plant 3 (2) ACGCCCACCTAAGCCAT-GA -------------------------------CGGTCAC 1D 22D 13.25% Plant 3 (3) ACGCCCACCTAAGCCAT-GA CTGCAAAGTACTTGGCTGATGCCGGTCAC 1D WT 12.43% Plant 3 (4) ACGCCCACCTAAGCCAT-GA --------------------------------- 1D 31D 11.09% Plant 3 (5) ACGCCCACCTAAGCCAT-GA CTGCAAAG------------TGCCGGTCAC 1D 11D 7.88% Plant 3 (6) ACGCCCACCTAAGCC-TTGA CTGCAAAGTACTTGGC-TGCCGGTCAC 1D 3D 7.23% Plant 3 (7) ACGCCCACCTAAGCC-TTGA -------------------------------CGGTCAC 1D 22D 5.93%

[0080] Edited plant type T1 target T2 target T1 editing type T2 editing type Editing efficiency WT ACGCCCACCTAAGCCATTGA CTGCAAAGTACTTGGCTGATGCCGGTCAC -- -- -- Plant 4 (1) ACGCCCACCTAAGCC-TGA CTG------------------------------C 2D 25D 18.02% Plant 4 (2) ACGCCCACCTAAGCCATTGA CTG------------------------------C WT 25D 13.57% Plant 4 (3) ACGCCCACCTAAGCCATTGA CTG------------------------------C SNP 25D 13.26% Plant 4 (4) ACGCCCACCTAAGCC-TGA CTG------------------------------C 2D 25D 7.60% Plant 4 (5) ACGCCCACCTAAGC-TGA CTG------------------------------C 3D 25D 6.07% Plant 4 (6) ACGCCCACCTAAGCCATTGA CTGCAAAGTACTTGGCTGATGCCGGTCAC WT WT 5.26% Plant 4 (7) ACGCCCACCTAAGCCATTGA CTGCAAAGTACTTGGC-TGCCGGTCAC SNP 3D 5.03%

[0081] Example 2

[0082] A method for constructing an Erigeron breviscapus Cas9 gene editing system, comprising the following steps:

[0083] (1) Constructing a phylogenetic tree

[0084] First, perform a BLAST search using the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) to download the amino acid sequence of the NtPDS gene. Then, perform a BLAST search in the Erigeron breviscapus plant database (http: / / cucurbitgenomics.org / ), download the Erigeron breviscapus PDS-related gene sequence, and import it into the MEGA7 software to construct a phylogenetic tree using the neighbor-joining method (N-J).

[0085] (2) Selection and design of the target site of the EbPDS gene

[0086] Based on homology analysis, select the Erigeron breviscapus EbPDS gene with high homology to the tobacco NtPDS. According to the EbPDS gene sequence information and sequence alignment results, combined with the target site design website http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR, design 2 target sites of the EbPDS gene, and design PCR amplification primers according to the target sites.

[0087] (3) Gene amplification and recovery

[0088] After the synthesis of the target site PCR amplification primers, using the PGTR plasmid as a template, perform gene amplification using DNA polymerase (phanta enzyme). The amplification system is as follows: Novazyme 2×Rapid Taq Master Mix 15 μl, Primer F (10 μM) 0.3 μl, Primer R (10 μM) 0.3 μl, PGTR template 1.5 μl, make up the volume to 30 μl with water. The reaction program is 95°C for 3 min; 95°C for 20 s, 55°C for 20 s, 72°C for 10 s, 35 cycles; 72°C for 3 min; 25°C for 1 s. After the PCR amplification program is completed, use 1.2% agarose gel electrophoresis to detect whether the length of the amplified gene band is consistent with the target gene band. After the PCR product is detected by agarose gel electrophoresis and the obtained band is similar in length to the target gene band, it indicates good amplification effect. Use the gel recovery kit of GenStar Company to recover and purify the target gene. Use the instrument NanoDrop2000 to measure the recovery concentration and store it in a -20°C refrigerator.

[0089] (4) Construction and identification of the gene recombinant vector

[0090] A Vector Linearization: The PV58-Cas9 vector plasmid was double digested with the endonuclease Kpnl to obtain the linearized vector PV58-Cas9. It was purified and recovered using the E.Z.N.A.® Cycle Pure Kit from Omega Company. After measuring its concentration, it was stored in a -20°C refrigerator for later use.

[0091] B Gene Recombination: The target gene amplified using the ready-to-use seamless cloning enzyme kit from Sangon Biotech (Shanghai) Co., Ltd. was ligated and recombined with the linearized vector PV58-Cas9. The ligation method and transformation method used recombinant ligation and heat shock transformation, and the transformation strain was E.coli (DH5α) competent cells.

[0092] C Bacterial Water PCR Detection: Randomly select 8 single colonies from the transformation medium in a laminar flow hood and place them in 20 μl of ddH 2 O. Take 3 μl as a template for PCR amplification. The PCR reaction system used is the 2x Taq Master Mix enzyme reaction system from Nanjing Novoprotein Scientific Co., Ltd. The PCR program is 95°C for 3 min, 95°C for 30 s, 55°C for 15 s, 72°C for 30 / kb for 35 cycles; after the reaction program of 72°C for 5 min ends, the length of the PCR product is detected using 1% agarose. After agarose gel electrophoresis detection, the PCR product has obvious bands between 750 bp and 500 bp, which is close to the target fragment (506 bp) and consistent with the expected result. Then the bacterial water was sent to Tsingke Company for sequencing. The result showed that the gene ligation was successful without mutation. The selected single colonies were positive bacteria, indicating successful assembly. The bacteria were preserved by mixing 50% glycerol and the bacterial liquid at a volume ratio of 1:1.

[0093] (5) Plasmid Vector Extraction and Agrobacterium tumefaciens EHA105 Transformation

[0094] Vector Plasmid Extraction: The vector plasmid carrying the recombinant plasmid PV58-Cas9-EbPDS was extracted using the ready-to-use Steadure plasmid extraction kit from Wuhan Aike Biotechnology Co., Ltd. The plasmid of the correct positive clone in Escherichia coli was extracted.

[0095] Agrobacterium tumefaciens EHA105 transformation: Take 50 μL of Agrobacterium tumefaciens EHA105 competent cells in a 1.5 mL centrifuge tube, add 5 μL of the correctly verified plasmid, mix well by pipetting, then incubate on ice for 5 min, freeze in liquid nitrogen for 5 min, heat shock at 37 °C for 5 min, and incubate on ice for 5 min. Add 700 μL of LB liquid medium without antibiotics, and resuscitate at 28 °C and 200 rpm on a shaker for 3 h. Pipette 70 μL of the bacterial solution and spread it on an LB plate containing Kan (45 mg / L) and Rif (20 mg / L), and incubate it upside down in an incubator at 30 °C for 2 - 3 d. Pick single colonies and perform PCR to detect whether the target gene is present.

[0096] (6) Preparation of the infection solution

[0097] Add a single colony of positive Agrobacterium containing the recombinant plasmid PV58 - Cas9 - EbPDS to 5 mL of LB liquid medium containing Kan (40 mg / ml) and Rif (40 mg / ml), and culture it overnight at 28 °C and 200 rpm on a shaker. Pipette 500 μL of the bacterial solution into 50 mL of LB liquid medium containing Kan (40 mg / ml) and Rif (40 mg / ml), and culture it at 28 °C and 200 rpm on a shaker until the OD value of the bacterial solution reaches 1.5. Centrifuge at 5000 rpm at room temperature for 8 min to collect the bacterial cells, discard the supernatant, and add the resuspension solution in a laminar flow hood to prepare the infection solution to make the OD value 0.25.

[0098] (7) Agrobacterium - mediated genetic transformation of Erigeron breviscapus

[0099] Put the Erigeron breviscapus leaf explants into the prepared infection solution containing the recombinant plasmid PV58 - Cas9 - EbPDS and perform vacuum transformation treatment in sequence. The infection time is 30 min. First, apply a vacuum pressure of 0.7 kPa for 15 min, then take it out and shake it, and then apply pressure for another 15 min. After the infection, pour out the infection solution, place the leaf explants on sterile filter paper to absorb the moisture, and then transfer the leaf explants to the Erigeron breviscapus co - culture medium MS + 0.004 mg / mL 6 - BA + 0.0005 mg / mL TDZ + 0.002 mg / mL NAA + 3% sucrose + 0.8% agar + 100 μmol / L AS. The co - culture is in the dark, the culture temperature is 22 - 25 °C, and the culture time is 2 days.

[0100] After the leaf explants were co-cultured for two days, they were inoculated onto the delayed selection medium MS + 0.004 mg / mL 6-BA + 0.0005 mg / mL TDZ + 0.002 mg / mL NAA + 3% sucrose + 0.8% agar + 0.27 mg / mL Tmt, and placed in a light incubator at 25 °C for light culture for 14 days. The non-browning callus materials after delayed selection were transferred to the selection medium MS + 0.002 mg / mL 6-BA + 0.005 mg / mL TDZ + 0.001 mg / mL NAA + 3% sucrose + 0.8% agar + 0.27 mg / mL Tmt + 10 mg / L Hyg for continuous light culture. After about 3 weeks, newly generated successfully transgenic callus could be seen. First, the selected callus was inoculated onto the shoot initiation medium SH + 0.001 mg / mL 6-BA + 0.001 mg / mL NAA + 0.08 g / L AD + 0.05 g / L Glu + 2 g / L CH + 3% sucrose + 0.8% agar + 0.27 mg / ml Tmt + 5 mg / L Hyg, and placed in a light incubator at 25 °C for light culture. After about 3 weeks, small shoots could be seen growing on the surface of the callus. The whole callus with young shoots was transferred to the shoot differentiation medium MS + 0.0005 mg / mL KT + 0.0003 mg / mL NAA + 3% sucrose + 0.8% agar + 0.27 mg / mL Tmt + 5 mg / L Hyg until the young shoots developed into seedlings. The seedlings were transferred to the rooting medium MS, 0.1 mg / L NAA, 1% sucrose, 0.8% agar, 0.27 mg / ml Tmt to obtain transgenic Erigeron breviscapus plants.

[0101] Example 3

[0102] A method for constructing an Erigeron breviscapus Cas9 gene editing system, comprising the following steps:

[0103] (1) Constructing a phylogenetic tree

[0104] First, use the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) for BLAST search and download the amino acid sequence of the NtPDS gene. Then, conduct a BLAST search in the Erigeron breviscapus plant database (http: / / cucurbitgenomics.org / ), download the Erigeron breviscapus PDS-related gene sequences, and import them into the MEGA7 software to construct a phylogenetic tree using the neighbor-joining method (N-J).

[0105] (2) Selection and design of the target site of the EbPDS gene

[0106] Based on homology analysis, the Erigeron breviscapus EbPDS gene with high homology to tobacco NtPDS was selected. According to the EbPDS gene sequence information and sequence alignment results, combined with the target site design website http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR, 2 target sites of the EbPDS gene were designed, and PCR amplification primers were designed according to the target sites.

[0107] (3)Gene amplification and recovery

[0108] After the synthesis of the target site PCR amplification primers, using the PGTR plasmid as a template, DNA polymerase (phanta enzyme) was used for gene amplification. The amplification system was as follows: Novazyme 2×Rapid Taq Master Mix 15 μl, Primer F (10 μM) 0.3 μl, Primer R (10 μM) 0.3 μl, PGTR template 1.5 μl, supplemented with water to 30 μl. The reaction program was 95°C for 3 min; 95°C for 20 s, 55°C for 20 s, 72°C for 10 s, 35 cycles; 72°C for 3 min; 25°C for 1 s. After the PCR amplification program ended, 1.2% agarose gel electrophoresis was used to detect whether the length of the amplified gene band was consistent with that of the target gene band. After the PCR product was detected by agarose gel electrophoresis and the obtained band was similar in length to the target gene band, it indicated good amplification effect. The target gene was recovered and purified using the Gel Extraction Kit of GenStar Company. The recovery concentration was measured using the NanoDrop2000 instrument and stored in a -20°C refrigerator.

[0109] (4)Construction and identification of gene recombinant vectors

[0110] Linearization of vector A: The PV58-Cas9 vector plasmid was double digested with the endonuclease Kpnl to obtain the linearized vector PV58-Cas9. The omega company's E.Z.N.A.® CyclePure Kit was used for purification and recovery. After measuring its concentration, it was stored in a -20°C refrigerator for later use.

[0111] Recombination of gene B: The target gene amplified using the ready-to-use seamless cloning enzyme kit of Sangon Biotech (Shanghai) Co., Ltd. was ligated and recombined with the linearized vector PV58-Cas9. The ligation method and transformation method used recombinant ligation and heat shock transformation, and the transformation strain was E. coli (DH5α) competent cells.

[0112] Detection of bacterial water PCR: Randomly select 8 single colonies from the transformation medium in the ultra-clean workbench into 20 μl ddH 2In the O, 3 μl was taken as the template for PCR amplification. The PCR reaction system used the 2x Taq Master Mix enzyme reaction system of Nanjing Novoprotein Biological Technology Co., Ltd. The PCR program was 95°C for 3 min, 95°C for 30 s, 55°C for 15 s, 72°C for 30 s / kb, for 35 cycles; after the reaction program of 72°C for 5 min ended, 1% agarose was used to detect the length of the PCR product. After detection by agarose electrophoresis, there were obvious bands in the PCR product between 750 bp and 500 bp, which was close to the target fragment (506 bp) and consistent with the expected result. Then the bacterial suspension was sent to Tsingke for sequencing. The result showed that the gene ligation was successful and there was no mutation. Single colonies were selected as positive bacteria, indicating successful assembly. The bacteria were preserved by the method of mixing 50% glycerol and the bacterial solution at a volume ratio of 1:1.

[0113] (5) Plasmid vector extraction and transformation of Agrobacterium tumefaciens EHA105

[0114] Vector plasmid extraction: The vector plasmid carrying the recombinant plasmid PV58-Cas9-EbPDS was extracted using the ready-to-use Steadure plasmid extraction kit of Wuhan Aike Biological Technology Co., Ltd. The plasmid of the positive clone with correct alignment in Escherichia coli was extracted.

[0115] Transformation of Agrobacterium tumefaciens EHA105: Take 50 μL of Agrobacterium tumefaciens EHA105 competent cells in a 1.5 mL centrifuge tube, add 5 μL of the correctly aligned plasmid, mix well with a pipette gun, then stand on ice for 5 min, quick-freeze in liquid nitrogen for 5 min, heat shock at 37°C for 5 min, and ice bath for 5 min. Add 700 μL of LB liquid medium without antibiotics, and resuscitate at 28°C and 200 rpm on a shaker for 3 h. Pipette 70 μL of the bacterial solution and spread it on an LB plate containing Kan (47 mg / L) and Rif (30 mg / L), and incubate it upside down in a 30°C incubator for 2 - 3 d. Pick single colonies and detect by PCR whether they contain the target gene.

[0116] (6) Preparation of the infection solution

[0117] Add the positive Agrobacterium tumefaciens single colony containing the recombinant plasmid PV58-Cas9-EbPDS to 5 mL of LB liquid medium containing Kan (65 mg / ml) and Rif (70 mg / ml), culture overnight at 28°C and 200 rpm on a shaker. Pipette 500 μL of the bacterial solution into 50 mL of LB liquid medium containing Kan (65 mg / ml) and Rif (70 mg / ml), culture at 28°C and 200 rpm on a shaker until the OD value of the bacterial solution reaches 2, centrifuge at 5000 rpm at room temperature for 8 min to collect the bacteria, discard the supernatant, and add the resuspension solution in a laminar flow hood to prepare the infection solution to make the OD value 0.3.

[0118] (7) Agrobacterium-mediated genetic transformation of Erigeron breviscapus

[0119] The Erigeron breviscapus leaf explants are placed into the prepared infection solution containing the recombinant plasmid PV58-Cas9-EbPDS and subjected to vacuum transformation treatment in sequence. The infection time is 30 min. First, vacuum pressurize at 0.7 kPa for 15 min, then take it out and shake it, and then pressurize for another 15 min. After the infection is completed, pour out the infection solution, place the leaf explants on sterile filter paper to absorb the moisture, and then transfer the leaf explants to the Erigeron breviscapus co-culture medium MS + 0.004 mg / mL 6-BA + 0.0005 mg / mL TDZ + 0.002 mg / mL NAA + 3% sucrose + 0.8% agar + 100 μmol / L AS. The co-culture is carried out in the dark at a culture temperature of 22-25 °C for 2 days.

[0120] When the leaf explants have been co-cultured for two days, they are inoculated into the delayed selection medium MS + 0.004 mg / mL 6-BA + 0.0005 mg / mL TDZ + 0.002 mg / mL NAA + 3% sucrose + 0.8% agar + 0.27 mg / mL Tmt and placed in a light culture room for light culture at 25 °C for 14 days. The non-browning callus materials after delayed selection are transferred to the selection medium MS + 0.002 mg / mL 6-BA + 0.005 mg / mL TDZ + 0.001 mg / mL NAA + 3% sucrose + 0.8% agar + 0.27 mg / mL Tmt + 10 mg / L Hyg and continue light culture. Newly generated transgenic callus can be seen in about 3 weeks. First, the selected callus is inoculated onto the bud initiation medium SH + 0.001 mg / mL 6-BA + 0.001 mg / mL NAA + 0.08 g / L AD + 0.05 g / L Glu + 2 g / L CH + 3% sucrose + 0.8% agar + 0.27 mg / ml Tmt + 5 mg / L Hyg and placed in a light culture room for light culture at 25 °C. Small buds can be seen growing on the surface of the callus after about 3 weeks. The whole callus with young buds is inoculated onto the bud differentiation medium MS + 0.0005 mg / mL KT + 0.0003 mg / mL NAA + 3% sucrose + 0.8% agar + 0.27 mg / mL Tmt + 5 mg / L Hyg until the young buds develop into seedlings. The seedlings are transferred into the rooting medium MS, 0.1 mg / L NAA, 1% sucrose, 0.8% agar, 0.27 mg / ml Tmt to obtain transgenic Erigeron breviscapus plants.

[0121] In summary, through the research of each embodiment, it is found that the present invention successfully applies the Erigeron breviscapus EbPDS gene to CRISPR / cas9-mediated genome editing, effectively knocking out the phytoene desaturase (PDS) gene, and the gene editing system constructed by Agrobacterium tumefaciens PV58-Cas9-EbPDS is highly efficient and feasible ( Figure 1 ). In the breeding and variety improvement of Erigeron breviscapus plants, the albino trait can be used as an obvious marker. By observing whether the albino phenotype appears in the offspring plants of Erigeron breviscapus, individuals with specific genotypes can be quickly screened out, accelerating the breeding process.

[0122] The above has described the embodiments of the present invention in detail, but the present invention is not limited to the described embodiments. For those skilled in the art, without departing from the principle and spirit of the present invention, various changes, modifications, substitutions, and variations of these embodiments still fall within the protection scope of the present invention.

Claims

1. A method for constructing a Cas9 gene editing system of Erigeron breviscapus, characterized in that: The following steps are involved: S1. Select the EbPDS gene from Erigeron breviscapus, design the EbPDS gene target site according to the gene sequence, and design PCR amplification primers according to the target site; S2, using the PGTR plasmid as a template to amplify the EbPDS gene, and connecting the EbPDS amplified fragment to the vector PV58-Cas9 by homologous recombination to obtain the recombinant plasmid PV58-Cas9-EbPDS; S3. The constructed recombinant plasmid PV58-Cas9-EbPDS was transferred into Escherichia coli DH5α by electroporation, and then the recombinant plasmid PV58-Cas9-EbPDS was transformed into Agrobacterium EHA105 and cultured. Positive clones were screened by colony PCR to obtain PV58-Cas9-EbPDS Agrobacterium, and the leaf explants of Erigeron breviscapus were placed in the infection solution containing PV58-Cas9-EbPDS Agrobacterium for infection.

2. The method for constructing the Cas9 gene editing system of Breviscapus breviscapus according to claim 1, characterized in that: The nucleotide sequence of the EbPDS gene is shown in SEQ ID NO: 1; the amino acid sequence of the protein encoded by the EbPDS gene is shown in SEQ ID NO:

2.

3. The method for constructing the Breviscapus Cas9 gene editing system according to claim 1, characterized in that: Two target sites T1 and T2 were designed according to the EbPDS gene sequence, and the PCR amplification primers for the target sites were EbPDS-T1-F and EbPDS-T2-R.

4. The construction method according to claim 1, characterized in that: Before extracting the recombinant plasmid PV58-Cas9-EbPDS, colony PCR verification was performed using primers EbPDS-U26-F and EbPDS-inf-T2as-R.

5. The method for constructing the Cas9 gene editing system of Breviscapus breviscapus according to claim 1, characterized in that: The system for amplifying the EbPDS gene is: 15 μl of Novai 2×Rapid Taq Master Mix, 0.3 μl of Primer F (10 μM), 0.3 μl of Primer R (10 μM), 1.5 μl of PGTR template, and water is added to 30 μl; the reaction program for the amplification is: 95°C for 3 min; 95°C for 20 s, 55°C for 20 s, 72°C for 10 s, 35 cycles; 72°C for 3 min; 25°C for 1 s.

6. The method for constructing the Cas9 gene editing system of Breviscapus breviscapus according to claim 1, characterized in that: The vector PV58-Cas9 is a linearized vector PV58-Cas9 obtained by double digesting the PV58-Cas9 vector plasmid with the nuclease Kpn1.

7. The method for constructing the Cas9 gene editing system of Breviscapus breviscapus according to claim 1, characterized in that: The steps of transforming Agrobacterium are as follows: taking 50 μL of Agrobacterium EHA105 competent cells into a 1.5 mL centrifuge tube, adding 5 μL of correctly aligned plasmid, blowing and mixing with a pipette, and then standing on ice for 5 minutes, quick freezing with liquid nitrogen for 5 minutes, heat shocking at 37° C. for 5 minutes, and ice bathing for 5 minutes; adding 700 μL of antibiotic-free liquid culture medium, and reviving at 28° C. and 200 rpm on a shaking table for 3 hours; absorbing 70 μL of bacterial solution and coating it on an LB plate containing 45-50 mg / L kanamycin and 20-30 mg / L rifampicin, and inverting and culturing in a 30° C. incubator for 2-3 days.

8. The method for constructing the Cas9 gene editing system of Breviscapus breviscapus according to claim 1, characterized in that: The preparation method of the infection solution comprises the following steps: adding PV58-Cas9-EbPDS Agrobacterium to LB culture medium simultaneously added with 40-65 mg / ml kanamycin and 40-70 mg / ml rifampicin, shaking at 28°C overnight, and diluting the bacterial solution by centrifugation until the OD value of the turbid OD value reaches 1-2 with a scutellaria suspension to an OD value of 0.2-0.3, and adding AS to obtain the infection solution of PV58-Cas9-EbPDS Agrobacterium; the scutellaria suspension comprises MS basal culture medium, 30 g / L sucrose, and 10-40 g / L glucose.

9. An application of the PV58-Cas9-EbPDS Agrobacterium according to claim 1 in breeding Erigeron breviscapus, characterized in that: The following steps are involved: The leaf explants of Erigeron breviscapus are placed in an infection solution containing PV58-Cas9-EbPDS Agrobacterium for infection, and then cultured in Erigeron breviscapus co-culture medium, delayed screening medium and screening medium respectively to obtain new callus tissue with successful genetic modification; the new callus tissue is cultured in a bud initiation medium, a bud differentiation medium and a rooting medium respectively to obtain transgenic plants.

10. The use according to claim 9, characterized in that: The co-culture medium of Erigeron breviscapus is: MS, 0.004 mg / mL 6-BA, 0.0005 mg / mL TDZ, 0.002 mg / mL NAA, 3% sucrose, 0.8% agar, 100 μmol / L AS, the co-culture is dark culture, the culture temperature is 22-25° C., and the culture time is 2 days; The delayed screening medium is: MS, 0.004 mg / mL 6-BA, 0.0005 mg / mL TDZ, 0.002 mg / mL NAA, 3% sucrose, 0.8% agar, 0.27 mg / mL Tmt, and the culture conditions are 25°C light culture for 14 days; The screening medium is: MS, 0.002 mg / mL 6-BA, 0.005 mg / mL TDZ, 0.001 mg / mL NAA, 3% sucrose, 0.8% agar, 0.27 mg / mL Tmt, 10 mg / L Hyg, and the culture conditions are 25°C light culture for 2-4 weeks; The bud initiation medium is: SH, 0.001 mg / mL 6-BA, 0.001 mg / mL NAA, 0.08 g / L AD, 0.05 g / LGIu, 2 g / L CH, 3% sucrose, 0.8% agar, 0.27 mg / ml Tmt, 5 mg / L Hyg; cultured at 25°C under light; The bud differentiation medium is: MS, 0.0005 mg / mL KT, 0.0003 mg / mL NAA, 3% sucrose, 0.8% agar, 0.27 mg / mL Tmt, 5 mg / L Hyg; cultured at 25°C under light; The rooting medium is: MS, 0.1 mg / L NAA, 1% sucrose, 0.8% agar, and 0.27 mg / ml Tmt.

Images