Use of potato stss5 gene in regulating tuber and starch grain size

Abstract

The application discloses application of a potato StSS5 gene in regulating tuber size and starch granule size, and belongs to the technical field of genetic engineering.The StSS5 gene editing strain is obtained through CRISPR / Cas9 gene editing technology, the tuber size, starch granule size and the number of starch granules in the amyloplast of the StSS5 gene editing strain are analyzed, the functional mechanism of the StSS5 gene in regulating tuber size and starch granule size is revealed, new gene resources are provided for improvement of potato starch characteristics, and a new train of thought is provided for functional research on starch granule initiation related genes.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of potato StSS5 gene in regulating size of tuber and starch granule thereof. BACKGROUND

[0002] Regulation of potato tuber and starch granule size has important scientific significance and application value in agriculture and food industry. Tuber size directly affects potato yield, harvesting efficiency and market adaptability. Larger tubers usually have higher yield per unit, but excessively large tubers may lead to increased mechanical damage, affecting storage, transportation and consumer market. Smaller tubers are more suitable for processing and specific cooking methods, meeting different consumer needs and increasing market competitiveness. Starch granule size is a key factor determining the physicochemical properties of potato starch. Smaller starch granules usually have higher specific surface area and faster gelatinization rate, which are suitable for food processing requiring rapid gelation. Regulating starch granule size can not only improve the processing performance and sensory quality of food, but also expand the application potential of potato starch in non-food fields (such as biomaterials and pharmaceutical carriers). By regulating tuber and starch granule size through breeding technology, an optimal balance between yield and quality can be achieved. Therefore, in-depth study on the regulation mechanism of tuber and starch granule size is of great significance for improving the economic value and functional characteristics of potato.

[0003] Starch synthesis includes two different stages: initiation process and synthesis process itself. The process of synthesizing starch polymers (including amylopectin and amylose) is relatively clear, and the genes involved in different species and organs are conserved in function, mainly involving starch synthase (SS) genes, including granule-bound starch synthase (GBSS) responsible for amylose synthesis and soluble starch synthase (SS1-SS4) responsible for amylopectin synthesis and extension of amylopectin chain length. The understanding of starch granule initiation mainly comes from the genes of model plants Arabidopsis thaliana AtSS4, AtSS5, AtPTST2 and AtMRC, which cooperatively regulate the formation of starch granules in chloroplasts. However, the initiation process of starch granule formation in amyloplasts of sink organs (seeds, tubers, etc.) and the factors regulating the number, size and shape of granules in each amyloplast are species-dependent. For example, the amyloplasts in potato tubers usually contain only one single simple starch granule, while the amyloplasts in plants such as rice and wheat form multiple granules or compound granules, which indicates that the formation mode of starch granules has significant species and organ specificity. In different species, the homologous genes of AtSS4, AtSS5, AtPTST2 and AtMRC of Arabidopsis thaliana that regulate the formation of starch granules in chloroplasts are differentiated in the initiation of starch granules and starch synthesis in their sink organs, especially in potato research, StSS4, StPTST2 and StMRC do not regulate the initiation of starch granules in tubers. StSS5 is dominantly expressed in potato tubers and its expression level increases with the development process of tubers, so it is very important to study the function of StSS5 in the development of potato tubers and the initiation of starch granules. The existing reports disclose that AtSS5 gene can promote the formation of starch granules in chloroplasts of Arabidopsis thaliana leaves, but the formation of starch granules in tubers is differentiated from that in chloroplasts. Therefore, the study on the function of StSS5 gene is of great significance for improving the characteristics of plant starch and increasing the industrial application value. SUMMARY

[0004] The technical problem solved by the present application is to provide the application of potato StSS5 gene in regulating the size of tubers and starch granules, so as to achieve the technical effect of synergistically regulating the size of potato tubers and starch granules.

[0005] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is to provide the application of potato StSS5 gene in regulating the size of tubers and starch granules, and the nucleotide sequence of StSS5 gene is shown in SEQ ID NO: 1.

[0006] On the basis of the above technical scheme, the present application can also be improved as follows:

[0007] Further, by inhibiting or knocking out StSS5 gene, the size of plant tuber and starch granule is regulated, the pasting temperature of tuber starch is reduced.

[0008] Further, by inhibiting or knocking out StSS5 gene, the size of plant tuber and starch granule is regulated, the pasting temperature of tuber starch is reduced.

[0009] Further, the size of tuber includes fresh weight of tuber.

[0010] Further, the size of starch granule includes starch granule size of tuber starch and the number of starch granule in amyloplast.

[0011] Further, the plant is dicotyledon.

[0012] Further, the plant is potato.

[0013] The beneficial effects of the present application are:

[0014] 1. By knocking out StSS5 gene, the present application finds that the tuber of StSS5 gene edited strain is small, which meets the needs of different consumers and increases market competitiveness. The starch granule size of tuber is reduced, and the number of small granular starch is increased. Small granular starch can better combine with water, improve the stability and water retention of food, reduce the phenomenon of water separation, perform better in thickening, gelation and stabilization, and is suitable for the development of various functional foods.

[0015] 2. The starch pasting temperature of StSS5 gene edited strain is reduced, the low-temperature pasting shortens the heating time and accelerates the production speed, which is especially suitable for food that needs to be processed quickly. The above results provide new genetic resources for the improvement of potato starch characteristics and provide a new idea for the functional research of starch synthesis related genes. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 It is a schematic diagram of editing vector PTX041-StSS5;

[0017] Figure 2 It is sgRNA editing site nucleic acid sequence;

[0018] Figure 3 It is the identification result of edited strain allele variation;

[0019] Figure 4 It is the relative expression level of each amylase gene mRNA of edited strain;

[0020] Figure 5 It is the detection result of soluble amylase activity of edited strain;

[0021] Figure 6 To edit the mini-tuber phenotype of the line;

[0022] Figure 7 To edit the average mini-tuber weight of the line;

[0023] Figure 8 To edit the representative picture of the mini-tuber slice staining;

[0024] Figure 9 To edit the starch content of the mini-tuber;

[0025] Figure 10 To edit the representative picture of the mini-tuber starch granule detection;

[0026] Figure 11 To edit the starch granule size distribution of the mini-tuber;

[0027] Figure 12 To edit the average effective starch granule size of the mini-tuber;

[0028] Figure 13 To edit the soil-borne tuber development phenotype of the line;

[0029] Figure 14 To edit the average tuber number of the line;

[0030] Figure 15 To edit the single plant tuber weight of the line;

[0031] Figure 16 To edit the distribution of different weight tubers of the line;

[0032] Figure 17 To edit the dry matter content of the tuber of the line;

[0033] Figure 18 To edit the starch content of the tuber of the line;

[0034] Figure 19 To edit the soluble sugar content of the tuber of the line;

[0035] Figure 20 To edit the representative picture of the soil-borne tuber starch granule size;

[0036] Figure 21 To edit the starch granule size distribution of the soil-borne tuber;

[0037] Figure 22 To edit the average effective starch granule size of the soil-borne tuber;

[0038] Figure 23 To edit the amylopectin chain length determination of the soil-borne tuber;

[0039] Figure 24 To edit the representative picture of the soil-borne tuber amyloplast starch granule number;

[0040] Figure 25 Distribution of starch granule number in powder made from soil-grown tubers

[0041] Figure 26 Representative pictures of starch granule number in chloroplasts of leaves of edited lines

[0042] Figure 27 Distribution of starch granule number in individual chloroplasts of edited lines

[0043] Figure 28 Representative pictures of iodine staining of leaves of edited lines before dark and before light

[0044] Figure 29 Starch content of leaves of edited lines before dark and before light DETAILED DESCRIPTION

[0045] The following describes a specific embodiment of the present application, so that those skilled in the art can understand the present application. If no specific conditions are mentioned in the examples, the conditions are conventional or recommended by the manufacturer. If no manufacturer is mentioned for the reagents or instruments used, they are all conventional products that can be purchased on the market. However, it should be clear that the present application is not limited to the scope of the specific embodiment. For those skilled in the art, it is obvious that various changes are within the spirit and scope of the present application as defined and determined by the appended claims, and all the inventions using the concept of the present application are within the scope of protection.

[0046] The nucleotide sequence of the potato StSS5 gene is as follows:

[0047] ATGGTTCTTACCAGTTTGATTGGCAGCAAGGAGGCATCAGAATTTAGATGGCTGGT

[0048] CATGGATTCAATAGGTAGTATAGCTGATTATTTCTCTGAGAAAATGCATAAACAGGACAC

[0049] TGAGCTTCTGGTAGAGCTGCGCCACTTCCCCCGGAAAAGTAGAAAGTCAGGTTACCACA

[0050] TAATCCACATTTGTACTGAAATGGCACCAGTGGTATCAGTTGGATCTTTGGCACCATATGT

[0051] AACTGGATTATCTCGTGCCTTGCAAAGAAAGGGAAATCTGGTCGAGGTTATCTTACCCA

[0052] AATATGCTAGCCTAAATTTAAATGAAGTTCATGGATTACGAGAAGTTGAGGCAGAGTTCC

[0053] ATTCATACTTTAATGGTCAACTGCATGGAAACAGAATCTGGACTGGGGTTGTCTGTGGCA

[0054] TTGGAGTGACTTTCATAGAACCTCTCTACTATTCAGCATTTTTCGGCTGTGAGAACATATA

[0055] TGGCTACTCAAATGATTTTGAACGATTCACCTACTTCTCTCGTGCTTCATTGGATTATATAA

[0056] TTAAAGCAGGAAAGCACCCGGATGTGCTTCATATACACAACTGGGAAACATCTATTGTTG

[0057] GTCCACTGTTTTGGGATGTTTTTGTAAATCAGGGACTTGGAGGTACCAGGATAATGTTGA

[0058] CATGTCAAAGCTTTGAGTCTCAGTGTGTAGAGCAACCTGAAAAGTTAGCCCTATGTGGG

[0059] CTTGATCCTTATGGACTACATTGTTCTGACCGTCTGCAAGATAACAACAAATCCCATCTTG

[0060] TCAATGTTTTGAAGGCTGGAGTGGTTTACTCCAACAATGTTATCATAATGTCATCCATGCA

[0061] AACAAAAGGGCAGATAATTCATGCTACGAGCCATGGTCTTGAGCCCACCTTAACTATACA

[0062] CAAGGACAAGTTAGTAGTTGCTCCTCCTGGATTCGACAGTTCAGCTTGGGATCCTTCAGT

[0063] AGATATGTTTCTACCACAAAACTATAGTGCAGATTTGAAGGGGAAATCTGTCTGCAAAGT

[0064] TTCGTTGCAGCAGCATCTGGGGTTGCAGGAGAAAGCATCCATTGTTCTTGTAGGTTTTAC

[0065] TCTGGTTGAAGATTTACCTGCAAAAGTTTATAACCAAACACTATTGATGGGGATTTCTCA

[0066] AAGATTATCTCTTCTTTTAGCTTTTTCTTTATGA (SEQ ID NO: 1).

[0067] Example 1 Construction of StSS5 gene editing vector

[0068] Using PTX041 as CRISPR / Cas9 editing vector, double targets were designed for its 5'UTR region and first exon region, and a gene editing vector was constructed, which was driven by StU6 promoter and 2x CaMV35S promoter to express sgRNA and Cas9 protein respectively. Figure 1 After extracting RNA from potato tubers and reversing it into DNA with a kit, the amplified fragment of StSS5 was obtained by amplification, and two sgRNA targeting sites were screened on the CRISPR 2.0 website according to the following principles: the target site starting with G is placed first; GC content is 40%-80%; TSL=3; GSL=0; TBPS<12; CBPS<7; IBPS<6. Two sgRNA (sgRNA1 and sgRNA2) targeting sites, one in the 5'UTR region and the other in the Exon region Figure 2 ), the sequence of sgRNA1 is: TGTTCCGGAGAGTTTGCATG (SEQ ID NO: 2); the sequence of sgRNA2 is: TCTCGTGCCTTGCAAAGAAA (SEQ ID NO: 3).

[0069] Example 2 Obtaining of StSS5 gene editing strain

[0070] The constructed CRISPR / Cas9-StSS5 vector was transformed into potato plants to obtain gene editing lines, and the editing efficiency was identified by sequencing. The PTX041 knockout vector containing sgRNA was immersed into Agrobacterium to transform potato tubers, and resistant sprouts were obtained by kanamycin selection. The primers PTX-F: ATGCTTCCGGCTCGTATGTT (SEQ ID NO: 4) and PTX-R: GACCTGCAGGCATGCAAGCT (SEQ ID NO: 5) were used for PCR amplification with 70 transgenic rooting lines as templates. The rooting lines that could amplify a 750 bp fragment were used as transgenic lines, and ACT-PCR was used to detect that CR8 and CR28 were full-allele gene editing lines. The sequencing sequence is shown in Figure 3 , which confirms that it is a double-allele editing genotype.

[0071] By measuring the mRNA levels of amylase genes and soluble amylase activity of the edited transgenic lines, it was found that the mRNA levels of StSS5 gene editing lines were reduced, the mRNA levels of other enzymes were unchanged Figure 4 , and the total amylase activity of the edited lines did not change significantly Figure 5 .

[0072] Example 3 Analysis of tuber development and starch characteristics

[0073] The obtained StSS5 gene editing lines (CR8 and CR28) were cultured with normal potatoes (wild type WT) at the same time, and were planted in soil. After harvesting, the tuber development and starch characteristics were analyzed.

[0074] 1. The fresh weight of the StSS5 gene editing lines was reduced in vitro induced mini-tubers, the starch content of the tubers was reduced, and the starch granule size of the tubers was reduced.

[0075] (1) The cut single stem segments of tissue culture seedlings were inserted into 8% MS medium, and the tuber induction was performed under the condition of 8h light and 16h darkness. The results are shown in Figure 6 , compared with the wild type (WT), the two StSS5 gene editing lines (CR8 and CR28) produced smaller mini-tubers. By measuring the fresh weight of the mini-tubers, it was found that the fresh weight of the StSS5 gene editing lines was significantly reduced Figure 7 .

[0076] (2) The starch content of the potato samples was detected. 5g of potassium iodide and 2.5g of iodine were dissolved in a small amount of distilled water, stirred thoroughly, and then diluted to 50mL. The prepared solution was titrated into the potato slices, and the mini-tuber slices were stained with starch. The results are shown in Figure 8As shown in the figure, the staining of the two StSS5 gene-edited lines (CR8 and CR28) is significantly lighter than that of the wild type, indicating that the starch content in CR8 and CR28 is significantly lower than that in the wild type. Measurements of the starch content in the micro-tubers also showed consistent results. Figure 9 ).

[0077] (3) The morphology of starch granules extracted from micro-tuber and soil-grown tubers was analyzed by scanning electron microscopy (SEM). The specific steps for observing the starch granule morphology were as follows: A suitable amount of peeled potatoes was weighed, diced, and then crushed with water using a tissue homogenizer or by hand. The mixture was filtered through an 80-mesh sieve, and the filtrate was retained. The filtered liquid was allowed to stand for 2-3 hours, and the supernatant was discarded. This process was repeated 2-3 times. The precipitate was dried in a 40℃ oven, and after drying, it was passed through an 80-mesh sieve to obtain starch granules. The starch granule crystals were analyzed using a scanning electron microscope. The starch granules were fixed on a circular, electrically conductive aluminum sheet, sputtered with gold, and then the experiment was performed using a ZEISS G Em (ZEISS, Germany) electron microscope scanner at 1.00 kV.

[0078] The results show ( Figure 10 The starch granules in each sample of the miniature potato ranged in size, but the typical round or oval shape with smooth edges was maintained. The starch granules in the StSS5 gene-edited lines appeared to be slightly smaller than those in the wild type (WT).

[0079] (4) The particle size distribution and average effective particle size of starch granules were detected using a particle size analyzer. The specific steps were as follows: an appropriate amount of starch granules were placed in water or an organic phase, shaken thoroughly, and allowed to stand for about 24 hours to allow the sample to fully equilibrate and reach system stability, ready for testing. The obtained liquid containing starch granules was placed in a cuvette to measure the starch particle size, repeated 3 times. This experiment was conducted using DLS+PALS particle size measurement (nanoparticle size and Zeta potential analysis).

[0080] The results showed that the starch granule size distribution in the mini-tubers induced by the StSS5 gene-edited lines differed from that of the wild type. The edited lines exhibited a narrower granule size distribution and contained a relatively higher proportion of small starch granules. Figure 11 and a lower average effective particle size ( Figure 12 ).

[0081] 2. The fresh weight of tubers harvested from soil-grown potted plants of the StSS5 gene-edited strain was reduced, the starch content was reduced, the number of starch granules in starch production increased, and the starch granule size was reduced.

[0082] To further analyze the effects of StSS5 gene edited lines on starch accumulation and tuber development characteristics in vivo, wild type (WT) and StSS5 gene edited lines (CR8 and CR28) were planted in soil medium, and the number of tubers per plant, the number of tubers per plant, and the size distribution of tubers were determined after 2 months of planting. The dry matter content, starch content and soluble sugar content of the harvested tubers were determined, and the morphology of the starch granules in the tubers was observed to determine the particle size distribution, effective particle size and starch chain length distribution.

[0083] (1) Dry matter content determination: 50 g of fresh potato was selected and weighed in an oven to dry to constant weight (dry weight). The percentage of dry weight and fresh weight was the dry matter content.

[0084] (2) Starch content determination:

[0085] ①Preparation of standard curve: 0.1 g of soluble starch standard was weighed, 2 mL of double distilled water was added to disperse the starch sample, 3.2 mL of 60% perchloric acid solution was added to the starch dispersion, and the volume was made to 250 mL in a volumetric flask to obtain the starch stock solution. 0.5, 1.0, 1.5, 2.0, 2.5 and 3.0 mL of stock solution were taken into 15 mL graduated test tubes, then double distilled water was added to make the solution volume to 8 mL, finally 2 mL of prepared iodine reagent was added to the test tube, shaken well and placed at room temperature for 5 min to obtain the standard solution. The concentrations of the standard solution were 20, 40, 60, 80, 100 and 120 μg / mL, respectively. The absorbance of double distilled water and standard solution was measured at 660 nm wavelength, with double distilled water as the control, and the standard curve was prepared.

[0086] ②Sample detection: The potato tubers were ground with liquid nitrogen, 0.1 g was weighed into a 2 mL centrifuge tube, and 200 μL of double distilled water was added, and the mixture was shaken well. 320 μL of 60% perchloric acid was added to the uniformly dispersed mixture, and double distilled water was added to make the mixture to 10 mL. After standing or centrifugation, 50 μL of supernatant was taken into a 2 mL centrifuge tube, double distilled water was added to 300 μL, iodine reagent was added to 200 μL, and the mixture was shaken well. After 5 min, the solution was supplemented with double distilled water to 1 mL, and the absorbance was measured at a wavelength of 660 nm with distilled water as the control, and the starch content was calculated according to the standard curve.

[0087] (3) Soluble sugar content determination:

[0088] ①Take the dried potato slices, powder and pass through an 80 mesh sieve. Take 0.1 g and place in a 2 mL centrifuge tube, add 1 mL of 80% ethanol, and make 5 biological replicates for each sample. Centrifuge at 13000 g for 3 min after 1 h in a 80°C water bath. Carefully pipette the supernatant into a new centrifuge tube, add 1 mL of 80% ethanol to the new centrifuge tube, repeat twice, and then dry in an 80°C oven. Add 1 mL of deionized water to dissolve the precipitate, and obtain a soluble sugar solution, which is stored at -20°C for later use.

[0089] ②Take 50 μL of the above obtained soluble sugar solution to a 96-well PCR plate. Add 50 μL of DNS solution (21.0 g / L sodium hydroxide, 6.3 g / L dinitrosalicylic acid, 5.0 g / L phenol, 5.0 g / L sodium sulfite, 185.0 g / L potassium sodium tartrate), and immediately place in an ice bath to cool the liquid after 5 min of reaction at 100°C in a metal bath. Dilute the sample by pipetting 100 μL of double distilled water, take 100 μL to a 96-well enzyme-labeled plate, and use an enzyme-labeled instrument to measure the absorbance of the sample at a wavelength of 540 nm. Calculate the first content of reducing sugar.

[0090] ③Take 50 μL of the above obtained soluble sugar solution, and place in a 96-well PCR plate for 5 biological replicates for each sample. Pipette 5 μL of 5 mol / L hydrochloric acid solution into each sample, and immediately place in an ice bath to cool the liquid after 15 min of reaction at 70°C in a metal bath. Add an equal amount of sodium hydroxide solution to neutralize the hydrochloric acid. Add 60 μL of DNS solution in equal volumes, and repeat the above steps for measuring the content of reducing sugar to obtain the second content of reducing sugar. Finally, calculate the content of sucrose according to the following formula:

[0091] C = (A - B) x 0.95;

[0092] Wherein, C is the content of sucrose, mg / mL; A is the first content of reducing sugar, mg / mL; B is the second content of reducing sugar, mg / mL.

[0093] ④The content of soluble sugar is the total content of the content of reducing sugar and the content of sucrose.

[0094] (4) Starch chain length distribution determination:

[0095] ① Preparation of Standards: Weigh 5 mg each of DP4-DP7 from the oligosaccharide standard kit, resuspend in 5 mL of double-distilled water, and incubate in a boiling water bath for 60 min, vortexing intermittently. Add 50 μL of sodium acetate (0.6 M, pH = 4.4), sodium azide (NaN3, 10 μL, 2% w / v), and 10 μL of isoamylase (1400 U), and incubate at 37 °C for 24 h. Add 0.5% (w / v) sodium borohydride solution, vortex, and let stand for 20 h. Take 600 μL into a centrifuge tube, dry under nitrogen at room temperature, dissolve in 30 μL of 1 M sodium hydroxide solution for 60 min, then dilute with 570 μL of water, centrifuge at 12000 g for 5 min, and load the supernatant of the standard onto the sample.

[0096] ② Sample preparation: Replace the standard with the test sample (approximately 10 mg of purified starch), repeat step ①, and load the supernatant of the test sample.

[0097] ③ Computer-based analysis: using Dionex TM CarboPac TM PA200 (250*4.0mm, 10μm) HPLC column, injection volume 5μL. Mobile phase A: 0.2M sodium hydroxide solution; Phase B: 0.2M sodium hydroxide solution / 0.2M sodium acetate solution. Column temperature: 30℃. Component analysis was performed using an electrochemical detector. Flow rate: 0.4mL / min; Elution gradient: 0 min A / B (90:10V / V), 10 min A / B (90:10V / V), 30 min A / B (40:60V / V), 50 min A / B (40:60V / V); 50.1 min A / B (90:10V / V); 60 min A / B (90:10V / V).

[0098] ④ Starch was analyzed and detected using a Thermo ICS5000 ion chromatography system (ICS500+, Thermo Fisher Scientific, USA).

[0099] (5) Observation of starch granules in powder using transmission microscopy (TEM)

[0100] Cut fresh tuber tissue into 1-3mm pieces 3Small pieces were quickly immersed in physiological solution containing 2.5% glutaraldehyde at pH = 7.6, and fixed at 4°C for 2 h. The samples were rinsed in 0.1 M phosphate buffer (pH = 7.2) for 10 min three times, and then transferred to 1% (w / v) osmium tetroxide (OsO4) solution for secondary fixation at 4°C for 2 h. Subsequently, dehydration was performed using a gradient of ethanol (50%→70%→90%→absolute ethanol, 15 min for each step), and stepwise immersion in a mixture of epoxy resin and absolute ethanol (volume ratio of 1:3, 1:1 and 3:1, respectively, 2 min for each step), and finally transferred to pure resin, and left at room temperature overnight. The samples were placed in a 60°C polymerization mold for 16 h, and the resin-embedded pieces were cut into 70 nm-thick ultrathin sections using a diamond knife, and collected on coated copper grids, and sequentially stained in 3% (w / v) uranyl acetate solution for 8 min, 2.7% (w / v) lead acetate solution for 8 min, and dried after rinsing with distilled water. Finally, the sections were observed and imaged using an HT7800 transmission electron microscope (Hitachi, Japan).

[0101] The results are shown in Figure 13-19 . During the entire growth period, the aboveground parts of the StSS5 gene edited lines did not show significant differences from the wild type plants Figure 13 . However, the tubers produced by the StSS5 gene edited lines were smaller Figure 13 than the wild type, the number of tubers did not show significant differences Figure 14 , and the fresh weight of tubers per plant was significantly reduced Figure 15 and Figure 16 . Compared with the wild type, the dry matter content was reduced Figure 17 , and the starch content of the StSS5 gene edited lines was also significantly reduced Figure 18 . In addition, the soluble sugar content of the edited lines was also reduced Figure 19 compared with the wild type. The above results indicate that the StSS5 gene is essential for the development / swelling of potato tubers and starch accumulation.

[0102] The results of the observation of the morphology of the starch in the tubers were consistent with the results of the observation of the microtubers. The starch granules of each sample covered different sizes, but the typical round or oval shape with smooth edges was maintained Figure 20 , and the starch granules in the StSS5 gene edited lines seemed to be smaller than those in the wild type (WT).

[0103] The particle size distribution and the average effective particle size of the starch granules were detected using a particle size analyzer. The results showed that the size distribution of the starch granules in the StSS5 gene edited lines was different from that of the wild type. The edited lines showed a narrower particle size distribution than the wild type, a relatively larger proportion of small starch granules Figure 21 , and a smaller average effective starch particle size Figure 22). Starch branch chain length distribution assay showed that StSS5 gene edited lines had no change in the relative peak area ratio curve corresponding to different amylopectin degree of polymerization, indicating that editing StSS5 gene did not affect the starch chain length distribution Figure 23

[0104] In addition, by observing the developing tuber sections by TEM, it was found that there was significant heterogeneity in the amyloplasts in StSS5 gene edited lines. The starch granules in both wild type (WT) and edited lines were round or oval, with smooth edges. The amyloplasts in wild type contained only single starch granules, while a few amyloplasts in StSS5 gene edited lines contained compound starch granules Figure 24 ) The number of independent "granules" observed in each section of compound starch granules varied, with a number between 2-6 Figure 25 In summary, these data suggest that StSS5 gene edited lines resulted in the formation of compound starch granules in amyloplasts, indicating that StSS5 gene plays a key role in the initiation of single starch granules in potato tuber amyloplasts.

[0105] 3. The number of starch granules in chloroplasts in StSS5 gene edited lines was reduced, and the rate of starch degradation in leaves at night was reduced.

[0106] The leaves of StSS5 gene edited lines were observed for starch granules in chloroplasts at 1 month of potato growth using TEM. Leaf segments were cut from the middle of fully expanded leaves for fixation and observation, and fully expanded leaves were iodine-stained before the start of light and at the end of darkness, and the starch content of the leaves was measured.

[0107] Leaf iodine staining: Prepare iodine reagent: weigh 5g of potassium iodide and 2.5g of iodine into a small amount of distilled water, mix thoroughly, and dilute to 50mL with distilled water, and store in a 4°C refrigerator. Place the leaves in 95% ethanol in a boiling water bath for 3-5 times to decolorize the chlorophyll. Place the decolorized leaves in 160-fold diluted iodine reagent for iodine staining for 1 min, and observe the staining of the leaves.

[0108] As can be seen from Figure 26 and 27 , the number of starch granules in chloroplasts in StSS5 gene edited lines was reduced compared to wild type.

[0109] In order to further characterize the characteristics of transient starch metabolism in leaves of StSS5 gene edited lines, the diurnal / nitidal changes in starch content in leaves were measured under a photoperiod of 12h light / 12h darkness. Iodine staining of leaves collected at the end of the night showed that StSS5 gene edited lines exhibited a phenotype of excess starch accumulation Figure 28 ​), starch content determination showed that starch content in leaves of edited lines was significantly higher than that of wild type ( Figure 29 ) at the end of night, i.e. before the beginning of light.

[0110] 4. Starch pasting temperature of tubers of StSS5 gene edited lines was reduced.

[0111] After harvesting mature tubers, starch was extracted and purified, and then the heat change of the equilibrated starch sample was scanned using a differential scanning calorimeter (DSC). The specific steps of pasting temperature determination were as follows:

[0112] (1) Fresh potatoes were washed with water to remove surface soil and impurities, and then put into a crusher or grinder, and crushed into slurry with appropriate amount of distilled water. Then, the slurry was filtered through a 100-200 mesh screen to separate the starch milk from the fiber residue, and the filtrate was collected. The starch milk was poured into a beaker and allowed to stand for 2-3 h to allow the starch to settle, and the upper liquid was carefully poured off. Then, distilled water was added to the settled starch, and after stirring, it was allowed to stand again for 1-2 h, and the washing was repeated 2-3 times until the upper liquid was clear. The washed starch slurry was poured into a centrifuge tube and centrifuged at 3000-4000 rpm for 10-15 min to remove excess water and collect the wet starch. The wet starch was evenly spread on a petri dish or aluminum foil and dried to constant weight in a 40-50°C oven. Finally, the dried starch sample was sieved to ensure uniform particles, and stored in a sealed container in a dry place.

[0113] (2) 2.5-3.1 mg of starch sample was taken in a 2 mL centrifuge tube, and appropriate amount of deionized water was added, with a starch to water mass ratio of 1:2. After equilibration at 16°C for 24 h, the sample was analyzed. The temperature was raised from 0°C to 90°C at a rate of 10°C / min, and the heat change was scanned to analyze the enthalpy change of the sample and detect the phase change process of the sample with temperature change.

[0114] The initial pasting temperature (To), peak pasting temperature (Tp), final pasting temperature (Tc) and pasting enthalpy (ΔH) of the starch pasting process were analyzed. The results, as shown in Table 1, showed that the initial pasting temperature and peak pasting temperature of StSS5 gene edited lines CR8 and CR28 starch granules were significantly lower than those of the wild type; the final pasting temperature of CR28 was significantly lower than that of the wild type; and the pasting enthalpy did not change significantly. This indicated that the heat absorption process of starch granule pasting was changed after the loss of normal function of StSS5 gene, and the peak pasting temperature and final pasting temperature were significantly affected.

[0115] Table 1 Results of starch pasting temperature determination

[0116] Strain To (°C) Tp (°C) Tc (°C) ΔH (J / g) WT 65.93±0.06 68.45±0.09 72.42±0.35 2.774±0.34 CR8 64.70±0.27** 67.55±0.19** 72.08±0.36 2.392±0.34 CR28 64.31±0.06** 66.82±0.13** 70.63±0.74* 2.084±0.46

Claims

1. Potatoes StSS5 The application of genes in regulating the fresh weight of potato tubers, the number and size of tuber starch granules, and the gelatinization temperature of tuber starch is characterized by, By inhibiting or knocking out potatoes StSS5 The gene reduces the fresh weight of potato tubers and the average starch granule size, increases the number of starch granules in starch production, reduces the particle size of starch granules, increases the proportion of small starch granules, and lowers the gelatinization temperature of potato tuber starch; StSS5 The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

Images