Detection kit and detection method for rapidly detecting pear colletotrichum gloeosporioides

Abstract

The invention provides a detection kit and a detection method for rapidly detecting pear colletotrichum gloeosporioides, and belongs to the technical field of pear colletotrichum gloeosporioides detection. According to the scheme, the five kinds of pear anthracnose germs can be specifically detected, pear tissue DNA roughly extracted through alkali liquor can be directly used as a template, visual detection is achieved through colloidal gold immunochromatography test strip color development after palm center temperature reaction, and the whole operation process can be completed within 25 min. The scheme of the invention has the advantages of strong specificity, high sensitivity, simplicity in operation, no dependence on instruments and equipment, convenience in transportation and carrying, easiness in storage, multiple detection scenes and the like, can detect low-content pear anthracnose bacteria, and provides reliable technical support for field early recognition and diagnosis and precise prevention and control of pear anthracnose.

Description

Technical Field

[0001] The present invention relates to the technical field of detection of Colletotrichum gloeosporioides Penz. f. sp. piricola, and specifically relates to a detection kit and a detection method for rapid detection of Colletotrichum gloeosporioides Penz. f. sp. piricola. Background Art

[0002] Pears are perennial deciduous fruit trees of the Rosaceae family and the genus Pyrus Pyrus ). Their fruits have a sweet taste, rich nutritional value, and have the effects of relieving cough and reducing phlegm, clearing heat and reducing fire, etc., and occupy an important position in the world fruit industry. The cultivation area and output of pears in China have always been at the leading level in the world. However, the yield per unit area is quite different from that of advanced countries. The serious occurrence of pests and diseases and the lack of effective prevention and control technologies are important factors affecting the development of the pear industry in China.

[0003] Pear anthracnose is caused by fungi of the genus Colletotrichum Colletotrichum spp.), which occurs during the growth period of pear trees, from near the maturity of fruits to the storage period, causing great economic losses. It causes necrotic lesions and non-expanding black dot lesions on pear leaves, often causing early defoliation, secondary flowering, etc., resulting in the decline of the tree vigor of pear trees and affecting the yield of pear trees in the following year. It causes fruit rot during the near-maturity and storage periods of fruits, losing their economic value. In addition, pear anthracnose has the characteristic of latent infection, with a long latent period. It does not show symptoms or the symptoms are not obvious under unfavorable environmental conditions, and it is greatly affected by climate factors. There is an outbreak epidemic phenomenon during high-temperature and rainy seasons. Research shows that there are 12 species of pathogenic bacteria causing pear anthracnose diseases in cultivated pears in China, specifically Colletotrichum aenigma , C. fioriniae , C. fructicola , C. gloeosporioides , C. citricola , C. conoides , C. karstii , C. plurivorum , C. siamense , C. wuxiense , C. jinshuiense and C. pyrifoliae , and the pathogenicity between species is significantly different, and the dominant species on different pear varieties are also significantly different.

[0004] At present, the diagnostic methods for Colletotrichum gloeosporioides of pears include traditional field symptom diagnosis and indoor morphological observation, as well as molecular detection techniques such as specific PCR and Nest-PCR based on polymerase chain reaction. For example, Zhang Lei et al. (2012) established a specific duplex PCR detection method for Physalospora piricola and Colletotrichum gloeosporioides. However, the existing detection methods have disadvantages such as complex operation, long time consumption, requiring experienced researchers, and being difficult to perform outside laboratory conditions. In addition, the Colletotrichum population system is large and the interspecies relationship is complex. Most of the existing detection methods target single or a few species of Colletotrichum gloeosporioides, with a small detection range and unable to be efficiently applied, seriously hindering the early monitoring, early warning and prevention and control of pear anthracnose. Therefore, in order to maintain the healthy and sustainable development of the pear industry, the early accurate diagnosis, prevention and control of pear anthracnose should be strengthened, and a convenient, rapid and efficient on-site visual detection method for Colletotrichum gloeosporioides in the field of pears should be established. Summary of the Invention

[0005] In view of the technical problems existing in the background art, the present invention provides a detection kit and a detection method for rapidly detecting Colletotrichum gloeosporioides of pears, aiming to solve the technical problems such as limited detection range of pear anthracnose, complex operation, and difficulty in getting away from laboratory conditions.

[0006] In the first aspect, the present invention provides a detection kit for rapidly detecting Colletotrichum gloeosporioides of pears, which at least includes a colloidal gold immunochromatographic test strip, detection primers and probes, and the sequences of the primers and probes are as follows: Forward primer: TCACGCTGACTGGATAGAGATCGAAGACA; Reverse primer: CTCTTGATGATGTATCCCGACTACCGTTAC, and the 5' end is modified with a Biotin label; Probe: FAM-TGGGCGCGCTGATGGTTTTGTCGCTCTCGGG(THF)AGGAGGCGGCCTCTAC-C3-spacer.

[0007] The colloidal gold immunochromatographic test strip in the present invention contains a test line and a quality control line, wherein the test line contains a biotin ligand and the quality control line contains an anti-FAM antibody.

[0008] Preferably, in the above detection kit, the pre-reaction system prepared by formulating the detection primers and probes with other reaction reagents (such as A Buffer, B Buffer, etc.) is prepared in the form of a lyophilized agent. Compared with the liquid preparation, the lyophilized preparation is more convenient for transportation and operation. Moreover, experimental data show that after the primers and probes provided by the present invention are prepared into lyophilized microspheres and stored for a long time, the reconstituted detection still has very good results.

[0009] Preferably, in the above detection kit, it includes a 0.5M NaOH solution as an extraction reagent. Test data shows that the reaction system containing the above primers and probes provided by the present invention can directly use the dilution of the crude extract supernatant of the pear tissue sample with a 0.5M NaOH solution as a template, thereby effectively reducing the time cost and cost of DNA extraction, and being conducive to large-scale and high-efficiency detection.

[0010] In a second aspect, the present invention provides a detection method for rapidly detecting Colletotrichum gloeosporioides of pears, which includes the following steps: Treat the sample to be tested to obtain a detection template; Prepare a reaction system containing the template, primers, and probes for MIRA reaction, and detect the obtained product; wherein, the sequences of the primers and probes are as follows: Forward primer: TCACGCTGACTGGATAGAGATCGAAGACA; Reverse primer: CTCTTGATGATGTATCCCGACTACCGTTAC; Probe: FAM-TGGGCGCGCTGATGGTTTTGTCGCTCTCGGG(THF)AGGAGGCGGCCTCTAC-C3-spacer.

[0011] It can be understood that when the MIRA reaction system contains primer pairs but does not contain probes, the obtained product can be detected by gel electrophoresis, and it can be judged whether the sample to be tested contains Colletotrichum gloeosporioides of pears according to the target band (about 350 bp); when the MIRA reaction system contains probes and the 5' end of the used reverse primer is modified with a Biotin label, the obtained product can be detected by a colloidal gold immunochromatographic test strip, thereby realizing visual detection. Specifically: Drop the obtained product onto the colloidal gold immunochromatographic test strip for a color reaction. Only showing one quality control line indicates that the sample to be tested is negative, showing one quality control line and one detection line indicates that the sample to be tested is positive, and the depth of the detection line is positively correlated with the amount of bacteria in the template.

[0012] Preferably, in the above detection method, a 0.5M NaOH solution is used to extract the sample of the pear tissue to be tested, and the obtained supernatant is the detection template after simple dilution. Compared with the DNA extraction reagents sold on the market, although the extraction with NaOH solution is simple in operation, it will result in a low DNA concentration and poor quality in the obtained product. However, the primer and probe combination provided by the present invention can still use the diluted alkaline extraction supernatant for the reaction, and even when the content of Colletotrichum gloeosporioides of pears is low and the symptoms are not obvious, the results are still accurate and reliable.

[0013] More preferably, the dilution factor of the supernatant is 15 - 30 times.

[0014] Preferably, in the above detection method, the MIRA reaction is carried out on the palm or at a constant temperature of 37 °C, the reaction time is 6 - 15 min, and 15 min is the best.

[0015] The detection method provided by the present invention can at least detect C. aenigma , C. fructicola , C. gloeosporioides , C. wuxiense , C. siamense the Colletotrichum gloeosporioides of these 5 species of pears.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: The primer and probe combination provided by the present invention can specifically detect 5 species of Colletotrichum gloeosporioides of pears, and it can be prepared into a freeze-dried microsphere product, and then assembled into a simple MIRA-LFD rapid detection product for Colletotrichum gloeosporioides of pears. The DNA of the diseased tissues of pear leaves and fruits can be rapidly and roughly extracted in the field as a reaction template. After the reaction at the palm temperature, the detection result can be visualized through the color development of a colloidal gold immunochromatographic test strip. The entire operation process can be completed within 25 min.

[0017] Due to the high detection sensitivity of MIRA, false positive results are likely to occur during the experiment due to improper operations such as cross-contamination between positive and negative samples, and aerosol contamination caused by repeated opening and pipetting of the amplification centrifuge tubes, which affects the objective accuracy of sample detection. However, the MIRA reaction reagent containing primers and probes provided by the present invention can be prepared into freeze-dried microspheres, which greatly reduces the reagent addition process, can effectively avoid the phenomenon of false positive contamination, ensures the accuracy of the results, simplifies the field application process, and also has the advantage of being easy to store. In addition, the freeze-dried microspheres prepared by the present invention still have very good effects after reconstitution and detection after long-term storage.

[0018] Compared with the existing detection methods for Colletotrichum gloeosporioides of pears, the solution of the present invention has the advantages of strong specificity, high sensitivity, simple operation, independence from instrument equipment, convenient transportation and carrying, easy storage, and multiple detection scenarios, providing reliable technical support for the early identification and diagnosis and precise prevention and control of pear anthracnose. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the present invention, the drawings used in the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0020] Figure 1It is the operation flowchart for rapid detection of Colletotrichum gloeosporioides in pears based on MIRA-LFD in the embodiments of the present invention; Figure 2 It is the result diagram of the specificity determination of the primers used in Example 3 of the present invention; Figure 3 It is the result diagram of the specificity determination of the primer and probe combination used in Example 3 of the present invention; Figure 4 It is the result diagram of the detection of Colletotrichum gloeosporioides in pears based on MIRA-LFD at different reaction times in Example 3 of the present invention; Figure 5 It is the result diagram of the sensitivity determination of Colletotrichum gloeosporioides in pears based on MIRA-LFD in Example 3 of the present invention; Figure 6 It is the result diagram of the disease symptoms of pear leaves and fruits inoculated with Colletotrichum gloeosporioides and the PCR and MIRA-LFD detection results in Example 4 of the present invention; Figure 7 It is the result diagram of the symptoms of pear samples with Colletotrichum gloeosporioides in the field and the MIRA-LFD detection results in Example 4 of the present invention; Figure 8 It is the result diagram of the PCR and MIRA-LFD detection results of suspected pear samples with Colletotrichum gloeosporioides in the field in Example 4 of the present invention; Figure 9 It is the schematic diagram of the MIRA-LFD rapid test kit for Colletotrichum gloeosporioides in pears in Example 5 of the present invention; Figure 10 It is the result diagram of the specificity determination of the primers used in Comparative Example 1 of the present invention; Figure 11 It is the result diagram of the specificity determination of the primers used in Comparative Example 2 of the present invention; Figure 12 It is the result diagram of the specificity determination of the primer-probe combination used in Comparative Example 2 of the present invention. Detailed implementation manners

[0021] The embodiments of the technical solution of the present invention will be described in detail below with reference to the accompanying drawings. The following embodiments are only used to illustrate the technical solution of the present invention more clearly, so they are only examples and cannot be used to limit the protection scope of the present invention.

[0022] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which this application belongs; the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit this application; the terms "including" and "having" and any variations thereof herein are intended to cover non-exclusive inclusion.

[0023] In view of the technical problems existing in the existing detection methods for Colletotrichum gloeosporioides of pears, such as small detection range, complex operation, long time consumption, and dependence on personnel and laboratory conditions, the present invention provides a detection kit and a detection method for rapidly detecting Colletotrichum gloeosporioides of pears based on MIRA-LFD. By designing and screening specific primers and probes that can perform isothermal amplification at low temperature using alkali crude extracts, the technical effect of rapidly detecting Colletotrichum gloeosporioides of pears in the field can be achieved.

[0024] In a first aspect, an embodiment of the present application provides a detection kit for rapidly detecting Colletotrichum gloeosporioides of pears, which at least includes the following: Forward primer: TCACGCTGACTGGATAGAGATCGAAGACA (SEQ ID NO.1); Reverse primer: CTCTTGATGATGTATCCCGACTACCGTTAC (SEQ ID NO.2), and its 5' end is modified with a Biotin label; Probe, its 5' end is modified with a FAM antigen label, a dSpacer (tetrahydrofuran, THF) is labeled at the middle positions of the 5' end and the 3' end as the recognition site of nfo, and a C3-Spacer modification group is labeled at the 3' end, and its sequence is specifically as follows: FAM-TGGGCGCGCTGATGGTTTTGTCGCTCTCGGG(THF)AGGAGGCGGCCTCTAC-C3-spacer (SEQ ID NO.3).

[0025] In view of C. aenigma , C. fructicola , C. gloeosporioides , C. wuxiense , C. siamense These 5 species of Colletotrichum gloeosporioides of pears are the dominant species in major pear production areas in China and have relatively strong pathogenicity. The inventors performed sequence alignment and analysis on these 5 different species of Colletotrichum gloeosporioides of pears, and then designed and verified and screened MIRA detection primers and probes in regions with relatively high homology. The primer pair provided by the embodiment of the present invention targets the ApMat gene sequence of Colletotrichum gloeosporioides of pears, and the amplification product is about 365 bp; compared with the MIRA primer pairs designed targeting other conserved sequences of Colletotrichum gloeosporioides of pears, it has excellent detection effects on Colletotrichum gloeosporioides of pears.

[0026] In a second aspect, as Figure 1 shown, an embodiment of the present invention provides a method for rapidly detecting Colletotrichum gloeosporioides of pears based on MIRA-LFD, which specifically includes the following steps: (1) Collect pear tissue samples in the field; (2) Add the sample to 0.5 M NaOH solution, grind thoroughly, and take the supernatant after dilution as the template. (3) Mix the template, primers shown in SEQ ID NO.1 - 2, probe shown in SEQ ID NO.3, enzyme and other reagents in a reaction tube. Hold the reaction tube in the palm of the hand for 15 min. Drop the reaction product onto the test strip and let it stand to make the test strip develop color.

[0027] In the method of the present invention, since the crude extract is strongly alkaline and will destroy the activity of the enzyme, directly using it for the amplification reaction will lead to amplification failure or extremely poor results. Therefore, it needs to be diluted by a certain multiple before being used as the amplification template. The experimental data of the present invention show that the amplification effect is better when the crude extract is diluted 15 - 30 times. At the same time, in order to ensure a relatively high concentration of nucleic acid, the best effect is obtained when the crude extract is diluted about 20 times. In addition, after the sample is thoroughly ground and crushed, it needs to be centrifuged or left standing for 1 - 2 min to make the tissue fragments sink to the bottom of the tube before sucking the supernatant, otherwise it will also affect the detection result and is likely to cause false negatives.

[0028] In some embodiments of the present invention, the primers shown in SEQ ID NO.1 - 2, the probe shown in SEQ ID NO.3, enzyme and other reagents are stored in the reaction tube in the form of freeze - dried microspheres. Mix water and the template with the pre - freeze - dried microspheres and then re - dissolve them to obtain the reaction system.

[0029] Different from the existing detection methods for Colletotrichum gloeosporioides of pears, the detection method developed in the present invention can use the DNA of pear tissue rapidly and crudely extracted for the MIRA - LFD reaction. Moreover, the prepared MIRA - LFD reaction system can react using the temperature of the palm. Even samples with a low pathogen load can be efficiently and visually detected, providing reliable technical support for the early - stage field visual diagnosis of pear anthracnose.

[0030] The following lists some specific embodiments. It should be noted that the embodiments described below are exemplary and are only used to explain the present invention and should not be construed as a limitation of the present invention. For those without specific technical or conditions noted in the embodiments, they shall be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0031] The test strains used in the following embodiments include Colletotrichum gloeosporioides strains PAFQ1 ( C. aenigma ), PAFQ30 ( C. fructicola ), PAFQ80 ( C. gloeosporioides ), PAFQ53 ( C. wuxiense ), PAFQ68 ( C. siamense), and three other common pathogens on leaves and fruits, namely the strain HB104 of Alternaria kikuchiana Tanaka ( Alternaria. arborescens ), the strain F-XJ-28 of Valsa mali Miyabe et Yamada ( Valsa pyri ), and the strain LW-P of Physalospora piricola Nose ( Botryosphaeria dothidea ).

[0032] The reagents used in the following examples mainly include a high-efficiency plant genomic DNA extraction kit (Tsingke Biological, Beijing), and a DNA constant-temperature rapid amplification kit (basic type), a DNA constant-temperature rapid amplification kit (colloidal gold test strip type), and HybriDetect colloidal gold test strips from Amp Future Biotechnology Co., Ltd. (Changzhou).

[0033] The method for extracting genomic DNA in the following examples is as follows: After culturing the strain for 7 d, scrape and collect the mycelia, grind them into powder in liquid nitrogen, and then perform the remaining steps according to the instructions of the high-efficiency plant genomic DNA extraction kit (Tsingke Biological, Beijing). The obtained DNA template is stored at -20 °C for later use. The method for crude extraction of pear sample DNA is as follows: Take 1-2 tissue pieces of about 0.5 cm × 0.5 cm in size from pear tissue (such as the lesion of the affected leaf or fruit) and place them in a 1.5 mL Ep tube. Add 100 μL of NaOH solution (0.5 M), mash them thoroughly with a blue pipette tip, and let it stand for 2 min. Take 5 μL of the supernatant and dilute it 20 times with 95 μL of H 2 2O as the template for the amplification reaction.

[0034] Example 1 This example provides a detection kit for rapidly detecting Colletotrichum gloeosporioides Penz. f. sp. piricola (Nose) Yamamoto & K. Hara, which at least includes the following primers and probes: Forward primer: TCACGCTGACTGGATAGAGATCGAAGACA (SEQ ID NO.1); Reverse primer: CTCTTGATGATGTATCCCGACTACCGTTAC (SEQ ID NO.2); Probe, with a FAM antigen label modified at its 5' end, a dSpacer (tetrahydrofuran, THF) marked at the middle positions of both the 5' end and the 3' end as the recognition site of nfo, a C3-Spacer modification group marked at the 3' end, and its sequence is specifically as follows: FAM-TGGGCGCGCTGATGGTTTTGTCGCTCTCGGG(THF)AGGAGGCGGCCTCTAC-C3-spacer (SEQ ID NO.3).

[0035] Based on the above primers and probes, this example provides two MIRA reaction systems as shown in Table 1 and Table 2. The 5' end of the downstream primer in Table 1 is not modified with a Biotin label, while the 5' end of the downstream primer in Table 2 is modified with a Biotin label.

[0036] Table 1 Reaction system for isothermal rapid DNA amplification (basic type)

[0037] Table 2 Reaction system for isothermal rapid DNA amplification (colloidal gold type)

[0038] Example 2 Based on the primers, probes, and reaction system in Example 1, this example provides a method for rapid detection of Colletotrichum gloeosporioides in pears, including the following steps: (1) Obtaining the template.

[0039] Use a DNA extraction kit to extract the DNA of the test bacterial solution or plant tissue, and refer to the instruction manual for the extraction process; Alternatively, use the NaOH alkaline lysis method to rapidly extract the DNA of pear tissue samples. Specifically: Take 1 - 2 pieces of diseased tissue of 0.5×0.5 cm 2 , add 100 μL of 0.5 M NaOH solution, grind and crush it thoroughly, then take 5 μL of the supernatant and dilute it 20 times with sterile water to obtain the test template.

[0040] (2) Prepare the reaction system and detect.

[0041] basicMIRA detection: Prepare the reaction system for isothermal rapid DNA amplification (basic type) according to Table 1, mix well and centrifuge briefly. Place the reaction tube in a PCR instrument and react at 37°C for 20 min. Dilute the reaction product 1-fold with 10 μL of ddH 2 O, mix well by pipetting, add 20 μL of extraction solution (chloroform:isopropanol = 1:1) in a fume hood for extraction, and centrifuge for about 5 min until layered. Take 3 μL of the supernatant, mix it with 10xLoading buffer and load the sample. Electrophorese at a voltage of 120 V.

[0042] Or, MIRA-LFD detection: Prepare the reaction system for isothermal rapid DNA amplification (colloidal gold type) according to Table 2, mix well and centrifuge briefly. React at a constant temperature of 37°C for 15 min, then place the reaction tube on ice and let it stand for 2 min to terminate the reaction. Pipette 5 μL of the MIRA reaction product and use 95 μL of ddH 2Dilute it 20 times, take 50 µL of the diluted product and spot it into the sample application hole of the test strip, and let it stand for 2 min to allow the test strip to fully develop color. The result shows that if both the quality control line and the test line appear, it is a positive result; if only the quality control line appears, it is a negative result. Additionally, during field detection or under conditions without constant temperature equipment, you can choose to wear latex gloves, hold the reaction tube in the palm of your hand for 15 min, and then perform the test strip detection.

[0043] Example 3 Based on the detection method in Example 2, the following tests were conducted on the method of the present invention in this example: (1) Specificity test.

[0044] Take the gDNA of 5 test strains of pear anthracnose, the gDNA of 3 other pathogen strains HB104, F-XJ-28, and LW-P, and the gDNA of a positive fruit sample of pear scab. Using the primer combinations shown in SEQ ID NO.1~2, perform ordinary PCR reactions and basicMIRA reactions respectively. The results are as Figure 2 shown. This primer combination can specifically detect 5 kinds of pear anthracnose bacteria simultaneously, showing specificity.

[0045] Then, use the DNA of the above 9 kinds of bacteria as templates for MIRA-LFD reactions. The results are as Figure 3 shown: The test strips for the detection of 5 kinds of pear anthracnose bacteria are all positive, while the DNA of pear black spot bacteria HB104, the positive sample DNA of pear scab, the DNA of pear ring rot bacteria LW-P, the DNA of pear canker bacteria F-XJ-28, and the water control are negative, which is consistent with the results of PCR and basicMIRA reactions, proving that this primer-probe combination and the prepared detection system have good specificity.

[0046] (2) Influence of reaction time on the detection effect.

[0047] Taking strain PAFQ30 as an example, the influence of reaction time on the detection results in the MIRA-LFD reaction was detected. The specific operation was as follows: Use the primer combination shown in SEQ ID NO.1-2 to amplify the target fragment of strain PAFQ30 to construct a recombinant plasmid; at a reaction temperature of 37 °C, dilute the concentration of the recombinant plasmid of PAFQ30 to 10 ng / μL and use it as the reaction template for MIRA-LFD. Set 5 reaction time gradients of 3 min, 6 min, 9 min, 12 min, and 15 min, and set a negative control NTC (the template is ddH 2 O).

[0048] The MIRA-LFD results are as Figure 4As shown, the detection band of the test strip becomes brighter as the reaction time increases. No detection band was shown on the test strip after 3 min of reaction. A detection band had already appeared after 6 min of reaction, and the band brightness at 15 min of reaction was significantly stronger than that at 9 min and 12 min. The above results indicate that the brightness of the detection band is proportional to the reaction time. Detection can be carried out within 6 - 15 min, and 15 min is the optimal reaction time.

[0049] (3)Sensitivity test.

[0050] After diluting the recombinant plasmid or mycelial DNA concentration of PAFQ30 to 100 ng / µL, gradient dilution was carried out in 10 - fold multiples, and ordinary PCR amplification and MIRA - LFD reactions were carried out respectively to compare the reaction sensitivities of ordinary PCR and MIRA - LFD.

[0051] The results are as Figure 5 shown, where A and C are the PCR sensitivity detection results of PAFQ30 recombinant plasmid and mycelial DNA respectively, and B and D are the MIRA - LFD sensitivity detection results of PAFQ30 recombinant plasmid and mycelial DNA respectively. The results show that the minimum concentration of the recombinant plasmid that ordinary PCR can detect is 1×10 -4 ng / μL. Under the condition of MIRA - LFD reacting at 37℃ for 15 min, the minimum concentration limit of the recombinant plasmid corresponding to the band that can be effectively detected and clearly observed by photographing is 1×10 -6 ng / μL, that is, its detection sensitivity is significantly higher than that of ordinary PCR.

[0052] Example 4 Based on the NaOH alkaline lysis method and the MIRA - LFD detection conditions in Example 2, this example diagnosed different types of pear tissue samples, specifically including the following experiments: (1)Monitoring the content of pathogenic bacteria during the disease - development process of in vitro pear leaves and fruits artificially inoculated with Colletotrichum gloeosporioides.

[0053] The 4 - day - old Colletotrichum acutatum PAFQ30 was used for stab inoculation of in vitro Pyrus betulifolia leaves and Huangguan pear fruits. After 1 d or 3 d of disease development, diseased tissues were taken to roughly extract DNA with NaOH, and ordinary PCR amplification and MIRA - LFD reactions were carried out respectively.

[0054] The results are as Figure 6As shown in the figure, A is the disease symptom of the fruit, B is the PCR detection result of the crude extract of the diseased fruit tissue, C is the MIRA-LFD detection result of the crude extract of the diseased fruit tissue, D is the disease symptom of the leaf, E is the PCR detection result of the crude extract of the diseased leaf tissue, and F is the MIRA-LFD detection result of the crude extract of the diseased leaf tissue. The PCR results showed that when the pathogen invaded for 3 days, the detection band of the diseased sample was significantly brighter than that of the sample with a low pathogen concentration invaded for 1 day. The MIRA-LFD results showed that the brightness of the detection bands at 1 day and 3 days of pathogen invasion was comparable, and low-content pathogens could be efficiently detected. The above results indicate that the crude extraction of pear sample DNA can be used as a template for MIRA-LFD, and the detection results are stable.

[0055] (2)Detection of field pear anthracnose samples.

[0056] Thirty-two pear anthracnose samples were detected by MIRA-LFD, and the disease symptoms are shown in Figure 7 A. Among them, there were 25 leaf samples and 7 fruit samples.

[0057] The results are shown in Figure 7 B. The MIRA-LFD detection of 32 samples showed positive, and the detection bands were visibly bright to the naked eye. The colors of the red detection lines of the 32 test strips were different, which was directly related to the pathogen content in the samples and the amount of crude nucleic acid obtained. This result indicates that the MIRA-LFD detection method of the present invention is applicable to the visual detection of field samples of pear anthracnose, and the pathogen can be stably and accurately detected in different tissue parts, and the operation has strong repeatability.

[0058] (3)Detection of field samples suspected of pear anthracnose.

[0059] Fifteen field samples with different symptoms suspected of pear anthracnose in Table 3 were respectively subjected to PCR detection and MIRA-LFD detection, and the template was genomic DNA.

[0060] The results are shown in Figure 8 As shown. The PCR detection and MIRA-LFD of samples 1-5 showed positive, and the bands were bright; the PCR detection bands of samples 6-10 were weak, and the MIRA-LFD detection bands were bright; there were no bands in the PCR detection of samples 11-15, but there were light-colored detection bands at the position of the MIRA-LFD detection line, which were still visible to the naked eye and were detected as positive. At the same time, samples 11-15 were subjected to tissue isolation and culture, and the pathogen of pear anthracnose could be isolated from all samples. This result indicates that the MIRA-LFD detection method of the present invention has the advantages of accurate, stable and sensitive detection results, is conducive to detection when the content of pear anthracnose pathogen is low and the symptoms are not obvious, and can be applied to the early field visual diagnosis of pear anthracnose.

[0061] Table 3 Information of field samples suspected of pear anthracnose

[0062] Example 5 Based on the primers, probes and reaction system in Example 1, this example provides a rapid test kit for MIRA-LFD of Colletotrichum gloeosporioides f. sp. piricola, as Figure 9 shown, which includes the following reagents and consumables: Colloidal gold test strip, blue pipette tip, pipette, reaction tube containing NaOH solution, reaction tube containing freeze-dried enzyme powder microspheres (which contained the components shown in Table 2 before freeze-drying), etc.

[0063] Using the above kit, it is possible to successfully achieve on-site visual detection in the field where all three steps of nucleic acid extraction, MIRA reaction, and detection result interpretation can be completely completed without laboratory equipment. Moreover, the entire operation process can be completed within 25 minutes, with the advantages of simple operation, short time consumption, no need for heating instruments, convenient transportation, high sensitivity, and strong specificity.

[0064] Comparative Example 1 Different from Example 1, this example also targets the ApMat gene sequence of Colletotrichum gloeosporioides f. sp. piricola, and designs and provides other MIRA primers, as specifically shown below: Primer pair 1, whose amplified product size is about 247 bp, and its upstream and downstream primer sequences are as follows: Upstream primer: CGATATCTATTCCGTTCCATGACTGATACTAC (SEQ ID NO.4), Downstream primer: CTCTTGATGATGTATCCCGACTACCGTTAC (SEQ ID NO.2); Primer pair 2, whose amplified product size is about 209 bp, and its upstream and downstream primer sequences are as follows: Upstream primer: CTTGTCGCAGTCGGTAGGTATAACTCATA (SEQ ID NO.5), Downstream primer: CTCTTGATGATGTATCCCGACTACCGTTAC (SEQ ID NO.2).

[0065] Referring to Example 3, the detection effects of each primer pair were detected, and the results are as Figure 10 shown. The results show that the detection ranges of the above two primer pairs are limited, and only some species of Colletotrichum gloeosporioides f. sp. piricola can be detected.

[0066] Comparative Example 2 Different from Example 1, in this example, MIRA primers were designed targeting other conserved sequences of *Colletotrichum gloeosporioides* infecting pears, as follows: And the detection effect of the primers was verified.

[0067] Primer pair 3, which targets the internal transcribed spacer (ITS), has the following specific sequences: TJ1-F: GAAACCAAACTCTATTTACACGACGTCTCTTC (SEQ ID NO.6), TJ1-R: CAATGTGCGTTCAAAGATTCGATGATTCAC (SEQ ID NO.7); Primer pair 4, which targets GAPDH the gene, has the following sequences: TJ2-F: TTCATTGAGACCAAGTACGCTGTGAGTATC (SEQ ID NO.8), TJ2-R: AATTCATGATGGCCTTCTTGTGTACTAACC (SEQ ID NO.9); Primer pair 5, which targets GAPDH the gene, has the following sequences: TJ3-F: CTTCATTGAGACCAAGTACGCTGTGAGTAT (SEQ ID NO.10), TJ3-R: TAAATGTGACAGATGGGGCTGATATGAGTG (SEQ ID NO.11); Specificity verification of primer pairs 3, 4, and 5 was performed using conventional PCR, and the results are as Figure 11 shown. Lanes 1-9 are isolates of *Colletotrichum gloeosporioides* from Fujian, Guizhou, Zhijiang, and Yunnan, and lanes 10 and 11 are strains HB1 and LW-P, respectively. From the detection results, it can be seen that primer pair 3 is specific for fungi of the genus *Colletotrichum* ( Figure 11 A), primer pair 4 is specific for the detection of 9 isolates of *Colletotrichum gloeosporioides* but has a small detection range ( Figure 11 B), and primer pair 5 cannot effectively detect 9 isolates of *Colletotrichum gloeosporioides* ( Figure 11 C).

[0068] Furthermore, a Biotin tag was added to the 5' end of TJ1-R, and a probe TJ1-P was designed based on the TJ1-F / TJ1-R targeting fragment, specifically: FAM-TTTTAACAACGGATCTCTTGGTTCTGGCATC(THF)ATGAAGAACGCAGCGA-C3-spacer (SEQ ID NO.12). Based on this primer-probe combination, the MIRA-LFD detection specificity test of pear anthracnose was performed with reference to Example 3. The results are shown in Figure 12 As shown, Pyrus pyrifolia A. alternata Pear ring spot B. dothidea The positive result indicated that the primer-probe combination had no detection specificity for pear anthracnose pathogen.

[0069] In summary, the detection reagent and detection method provided by the present invention can simply and quickly realize the visual detection of pear anthracnose pathogens, and have the characteristics of strong specificity, high sensitivity, accuracy and reliability, which is conducive to detection when the content of pear anthracnose pathogens is low and the symptoms are not obvious, and is of great significance for the early identification diagnosis and precise prevention and control of pear anthracnose in the field.

[0070] It should be noted that the present invention is not limited to the above-mentioned embodiments. The above-mentioned embodiments are only examples, and the embodiments having the same structure as the technical idea and exerting the same effect within the scope of the technical solution of the present invention are all included in the technical scope of the present invention. In addition, without departing from the scope of the main purpose of the present invention, various modifications that can be thought of by those skilled in the art to the embodiments and other methods of combining some of the constituent elements in the embodiments are also included in the scope of the present invention.

Claims

1. A rapid detection kit for pear anthracnose pathogen, characterized in that: At least includes colloidal gold immunochromatographic test strips, detection primers and probes, and the sequences of the primers and probes are as follows: Upstream primer: TCACGCTGACTGGATAGAGATCGAAGACA; Downstream primer: Biotin-CTCTTGATGATGTATCCCGACTACCGTTAC; Probe: FAM-TGGGCGCGCTGATGGTTTTGTCGCTTCGGG(THF)AGGAGGCGGCCTCTAC-C3-spacer.

2. The detection kit according to claim 1, characterized in that The detection primers and probes are stored in a freeze-dried form.

3. The detection kit according to claim 1, characterized in that A 0.5 M NaOH solution was also included.

4. A method for rapid detection of pear anthracnose pathogens, characterized in that: The following steps are involved: Processing the sample to be tested to obtain a test template; A reaction system containing a template, primers and probes is prepared to carry out a MIRA reaction, and the resulting product is detected; wherein the sequences of the primers and probes are as shown in claim 1.

5. The detection method according to claim 4, characterized in that: The product is added to a colloidal gold immunochromatographic test strip for color development, and judgment is made based on the color development result.

6. The detection method according to claim 4, characterized in that: The pear tissue sample to be tested was extracted with 0.5M NaOH solution, and the obtained supernatant was diluted to serve as the detection template.

7. The detection method according to claim 6, characterized in that: The dilution multiple is 15-30 times.

8. The detection method according to claim 4, characterized in that: The MIRA reaction was performed on the palm of the hand or at a constant temperature of 37°C.

9. The detection method according to claim 8, characterized in that: The MIRA reaction time is 6-15 minutes.

10. The detection method according to claim 4, characterized in that: The pear anthracnose pathogen includes C. aenigma , C. fructicola , C. gloeosporioides , C. wuxiense , C. siamense .

Images