Molecular markers related to the thorny trait of eggplant calyx and their applications
By developing molecular markers and KASP technology related to the thorny trait of eggplant calyx, and using eggplant leaf genomic DNA to detect specific SNP sites, the problems of environmental and human factors affecting the field screening of thornless eggplant materials have been solved, achieving efficient and accurate breeding screening and reducing costs and time consumption.
Patent Information
- Application Number
- CN202510306074.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-14
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2045-03-14
AI Technical Summary
In existing technologies, field screening of thornless eggplant materials requires judgment after the eggplant has budded, which is easily affected by environmental and human factors, resulting in large selection errors and wasting time.
Molecular markers associated with the thorny trait of eggplant calyx were developed. Competitive allele-specific PCR (KASP) technology was used to design primers for PCR amplification by detecting specific SNP sites in the genomic DNA of eggplant leaves. The genotype was determined using fluorescent probes. Kits and primers were provided for rapid screening of thornless eggplant materials.
By using molecular markers to assist in the screening of thornless eggplant materials, environmental and human errors can be eliminated, enabling batch processing, saving land and labor costs, and improving breeding efficiency.
Smart Images

Figure CN120138201B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomolecular detection and breeding technology, specifically involving molecular markers and their applications related to the thorny trait of eggplant calyx. Background Technology
[0002] Competitive allele-specific PCR (KASP) technology uses primers designed for allele SNP sites to amplify the substrate using real-time fluorescence PCR technology. The corresponding fluorescent probes can bind to the corresponding primer binding sites, and the genotype of the amplified product can be determined based on the detected fluorescence color. It is a novel, rapid, and simple method that does not require electrophoresis.
[0003] Thorns, as appendages of plants, especially as the fruit matures, most thorns gradually harden and become dangerous, causing inconvenience to field operations, storage, transportation, and consumers, and are generally considered undesirable agronomic traits.
[0004] In related breeding techniques, field screening of thornless eggplant materials needs to be done during the period when the eggplant has large buds, which is easily affected by environmental temperature and other factors, resulting in a large selection error. Summary of the Invention
[0005] In view of this, the present invention provides a molecular marker and its application related to the thorny trait of eggplant calyx, in order to solve the problem that the field screening of thornless eggplant materials requires judgment after the eggplant has budded, which is easily affected by environmental and human factors, resulting in large selection errors and wasting time.
[0006] In a first aspect, the present invention provides a molecular marker related to the thorny trait of eggplant calyx, the sequence of the molecular marker being SEQ ID NO:1, wherein a T→C mutation occurs at the 100bp position of SEQ ID NO:1, and when the base at the 100bp position is T, the eggplant calyx is thorny.
[0007] In one alternative embodiment, the eggplant calyx of SEQ ID NO:1 with a base C at 100bp is thornless.
[0008] Secondly, the present invention also provides a primer suitable for specifically amplifying the molecular markers associated with the shape of the calyx spines of eggplant.
[0009] Thirdly, the present invention also provides a KASP primer for amplifying molecular markers related to the thorny trait of eggplant calyx, the KASP primer comprising a first upstream primer, a second upstream primer and a downstream primer, wherein the sequence of the first upstream primer is SEQ ID NO:2, the sequence of the second upstream primer is SEQ ID NO:3, and the sequence of the downstream primer is SEQ ID NO:4.
[0010] Fourthly, the present invention also provides a kit suitable for detecting the molecular markers associated with the spur-covered trait of eggplant calyx; and / or detecting the primers; and / or detecting the KASP primers.
[0011] Fifthly, the present invention also provides a method for identifying the thorny trait of eggplant calyx, comprising: extracting genomic DNA from eggplant leaves; using the genomic DNA as a template, designing primers; and performing PCR amplification to obtain the product shown in SEQ ID NO:1; analyzing or sequencing the product; and determining that the eggplant is thorny when the base at the 100bp position of SEQ ID NO:1 is T, and the eggplant is thornless when the base at the 100bp position of SEQ ID NO:1 is C.
[0012] Sixthly, the present invention also provides a method for predicting the thorn appearance of eggplant, comprising: extracting genomic DNA from eggplant leaves, designing primers using the genomic DNA as a template, and performing PCR amplification to obtain the product shown in SEQ ID NO:1; analyzing or sequencing the product; and determining that the eggplant has thorns when the base at the 100bp position of SEQ ID NO:1 is T, and the eggplant does not have thorns when the base at the 100bp position of SEQ ID NO:1 is C.
[0013] In a seventh aspect, the present invention also provides an application comprising: the molecular marker; and / or the primer; and / or the KASP primer; and / or the kit described herein, in the identification of eggplant calyx thorns and / or in eggplant breeding.
[0014] The beneficial effects of this invention are as follows:
[0015] This invention utilizes molecular markers to assist in screening thornless eggplant materials, which can eliminate environmental and human operational errors, facilitates batch operation, and saves land and labor costs by selecting seedlings, thereby improving breeding efficiency. Attached Figure Description
[0016] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without any creative effort.
[0017] Figure 1 This is a schematic diagram of the separation of eggplant spurs by molecular markers related to the spur characteristics of eggplant calyx in an embodiment of the present invention;
[0018] Figure 2 This is a diagram showing the separation of eggplant spurs by molecular markers related to the spur characteristics of eggplant calyx in an embodiment of the present invention;
[0019] Figure 3 This is an F2 spur separation diagram of molecular markers related to the spur characteristics of eggplant calyx in an embodiment of the present invention;
[0020] Figure 4 This is a distribution map of the SNPDelta-index of the eggplant genome, which shows the molecular markers related to the calyx-covered spine trait of eggplant according to an embodiment of the present invention.
[0021] Figure 5a This is one of the primer information diagrams in an embodiment of the present invention;
[0022] Figure 5b This is the second primer information diagram according to an embodiment of the present invention;
[0023] Figure 6 This is a genotyping diagram of the test population in an embodiment of the present invention, wherein the blue dots represent the thorny genotype of eggplant.
[0024] Figure 7 This is a genotyping diagram of the test population in an embodiment of the present invention, where red dots represent the thornless genotype and green dots in the middle represent the heterozygous genotype. Detailed Implementation
[0025] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0026] Furthermore, the technical features involved in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.
[0027] Relevant data indicates that most eggplant calyxes are covered with thorns, which become increasingly dangerous as the fruit matures and hardens, causing inconvenience to field operations, storage, transportation, and consumers. This is considered a poor agronomic trait. There is an urgent need for thornless eggplant breeding technology and new varieties in production. Thornless eggplant breeding in my country is still in its initial stage, with limited research on genes and breeding techniques related to the thorn-covering trait. This patent uses genome resequencing combined with BSA methods, comprehensively applying bioinformatics to predict candidate genes, and developing KASP markers using their SNP sites. These markers are then validated in populations with known genotypes, aiming to develop KASP marker-assisted breeding for the thorn-covering trait.
[0028] The following is combined Figures 1 to 7 The following describes embodiments of the present invention.
[0029] like Figure 1 and Figure 2 As shown, according to an embodiment of the invention, a molecular marker related to the thorny trait of eggplant calyx is provided. The sequence of the molecular marker is SEQ ID NO:1, wherein a T→C mutation occurs at the 100bp position of SEQ ID NO:1. When the base at the 100bp position is T, the eggplant calyx is thorny.
[0030] In an embodiment of the invention, the specific sequence of the molecular marker is designated as SEQ ID NO:1. At the 100th base pair position of this sequence, there is an important mutation. Specifically, when the base at this position changes from T (thymine) to C (cytosine), it indicates a change in the serrations of the eggplant calyx. In other words, if a T is detected at the 100th base pair position of the sequence, it can be inferred that the eggplant calyx is serrated.
[0031] Using molecular markers to assist in screening thornless eggplant materials can eliminate environmental and human error, facilitate batch processing, and save land and labor costs by selecting seedlings, thereby improving breeding efficiency.
[0032] Furthermore, the eggplant calyx of SEQ ID NO:1 with a base C at 100bp is thornless.
[0033] According to the sequence identifier SEQ ID NO:1, if the base at the position with a length of 100 base pairs (bp) is cytosine (C), then in terms of botanical characteristics, the sepals of the corresponding eggplant variety will exhibit a spineless morphology.
[0034] According to embodiments of the invention, a primer is also provided that is suitable for specifically amplifying molecular markers associated with the thorny trait of eggplant calyx.
[0035] In embodiments of the present invention, these primers are particularly suitable for the specific amplification of molecular markers associated with the serrated edge trait of eggplant sepals. The design and use of these primers enable researchers to more accurately identify and analyze the genetic factors influencing the shape of the sepals, thus providing an effective tool for eggplant variety improvement and genetic research.
[0036] According to embodiments of the invention, a KASP primer for amplifying molecular markers associated with the spiky trait of eggplant calyx is also provided. The KASP primer includes a first upstream primer, a second upstream primer, and a downstream primer, wherein the sequence of the first upstream primer is SEQ ID NO:2, the sequence of the second upstream primer is SEQ ID NO:3, and the sequence of the downstream primer is SEQ ID NO:4. By using primers with these specific sequences, researchers can effectively amplify specific DNA fragments associated with the spiky trait of eggplant calyx, thereby facilitating the study and improvement of this trait at the molecular level.
[0037] According to embodiments of the invention, a kit is also provided, suitable for detecting molecular markers associated with eggplant calyx spine traits; and / or detection primers; and / or detection KASP primers. In embodiments of the invention, the kit is particularly suitable for detecting molecular markers associated with eggplant calyx spine traits; furthermore, the kit can also be used to detect specific detection primers associated with them; and specific primers for detecting KASP (Kompetitive Allele Specific PCR) technology.
[0038] According to an embodiment of the invention, a method for identifying the thorny characteristics of eggplant calyxes is also provided, comprising the following steps:
[0039] Step S101: Extract genomic DNA from eggplant leaves, design primers using the genomic DNA as a template, and amplify by PCR to obtain the product shown in SEQ ID NO:1.
[0040] Step S103: Analyze or sequence the product.
[0041] Step S105: When the base at the 100th bp of SEQ ID NO:1 is T, the eggplant is thorny; when the base at the 100th bp of SEQ ID NO:1 is C, the eggplant is thornless.
[0042] According to an embodiment of the invention, a method for predicting the prickly appearance of eggplant is also provided, comprising the following steps:
[0043] Step S201: Extract genomic DNA from eggplant leaves, design primers using the genomic DNA as a template, and amplify by PCR to obtain the product shown in SEQ ID NO:1.
[0044] Step S203: Analyze or sequence the product.
[0045] Step S205: When the base at the 100th bp of SEQ ID NO:1 is T, the eggplant has thorns; when the base at the 100th bp of SEQ ID NO:1 is C, the eggplant has no thorns.
[0046] According to an embodiment of the invention, firstly, genomic DNA needs to be extracted from eggplant leaves. Next, using the extracted genomic DNA as a template, specific primer sequences are designed. These primers are amplified using PCR (polymerase chain reaction) technology to obtain a specific DNA sequence product whose sequence matches the sequence shown in SEQ ID NO:1. The obtained PCR product needs further analysis or sequencing. This step is to ensure the correctness and purity of the product and to provide accurate DNA sequence information for subsequent analysis. After analysis and sequencing, a specific base check can be performed on the SEQ ID NO:1 sequence. Specifically, if a T (thymine) base is detected at the 100th base position of the sequence, it indicates that the eggplant variety has thorns; conversely, if a C (cytosine) base is detected at the same position, it indicates that the eggplant variety is thornless. This method can effectively predict the thorn appearance of eggplants, thus providing convenience for agricultural production.
[0047] According to embodiments of the invention, an application is also provided, including: molecular markers; and / or primers; and / or KASP primers; and / or kits for the identification of eggplant calyx thorns and / or for eggplant breeding.
[0048] In embodiments of the present invention, the application involves multiple aspects, including but not limited to the use of molecular markers; and / or the use of specific primers; and / or the use of KASP (Kompetitive Allele Specific PCR) primers; and / or the use of reagent kits. These elements play an important role in identifying the calyx spine characteristics of eggplant and in the eggplant breeding process. Through these technical means, researchers and breeders can more accurately identify and select eggplant varieties with specific traits, thereby improving breeding efficiency.
[0049] This invention utilizes a specific KASP marker to assist in the screening of eggplant thorn-covering traits. A specific KASP marker is located at a SNP locus on chromosome 6 at position 86557859, which is either T or C. This invention provides an SNP locus closely linked to the eggplant thorn-covering trait and develops a KASP marker that can perform high-throughput detection of the genotype at position 86557859, which is associated with the thorn-covering trait. Field screening of thornless eggplant materials requires judgment during the eggplant flowering period, which is easily affected by environmental and human factors, resulting in significant selection errors. Using KASP molecular markers to assist in the screening of thornless eggplant materials can eliminate environmental and human operational errors, facilitate batch processing, and save land and labor costs by selecting at the seedling stage, thereby improving breeding efficiency.
[0050] This invention primarily solves the problem of investigating thorn characteristics by utilizing a rapid screening technology based on specific KASP molecular markers, significantly reducing field labor and saving manpower, material resources, and time costs. Its positive effects compared to existing technologies are as follows:
[0051] (1) Overcoming environmental impact: Screening thornless eggplant varieties and inbred lines by linkage markers can help quickly identify thorny traits and overcome environmental impact.
[0052] (2) High screening efficiency and reliable results: Experiments have shown that the screening of thornless eggplant materials using this method is more efficient and reliable than artificial climate chambers and traditional field trials.
[0053] (3) Low cost: Compared with artificial climate chambers and traditional field surveys, the costs of manpower, material resources and time are greatly reduced.
[0054] Example 1: Determination of Molecular Markers
[0055] 1.1 Experimental Materials
[0056] The experiment was conducted in the spring of 2023, using experimental seed 24TH4 from the germplasm resource bank of the Vegetable Research Institute of Tianjin Academy of Agricultural Sciences as the female parent and L154 as the male parent to create a hybrid and harvest the F1 generation. In the autumn, the F1 generation was planted and self-pollinated to obtain F2 generation seeds. In the spring of 2024, the parental 24TH4, L154, and F2 generation seeds were simultaneously planted. Sowing and seedling raising were carried out on February 1st, and transplanting was conducted on March 28th in a multi-span greenhouse. 40 plants were planted for each of the female and male parents, and 230 plants were planted for the F2 population, with a plant spacing of 60cm × 70cm. The greenhouse was covered with black plastic mulch and managed using conventional methods. Figure 1 As shown, the sepals of 24TH4 are spiny; as Figure 2 As shown, the sepals of L154 are spine-bearing; the spine characteristics of the F2 population show divergence, with some having many spines, some having few spines, and some being spineless.
[0057] 1.2 Experimental Methods
[0058] 1.2.1 Field trials and trait surveys
[0059] Thorn survey: The agronomical traits of eggplant calyx thorns were mainly tested. Thorns were visible about 2 months after transplanting, and the number of thorns on the calyx was recorded.
[0060] The number and distribution of spines: Based on the segregation of spines in the parental and F2 populations of the tested materials, the number of spines was classified and statistically analyzed.
[0061] 1.2.2 Construction of extreme mixing pools and genotyping
[0062] Forty spiny and forty spinless individual plants were selected from the F2 population, along with two parents, 24TH4 and L154. One g of young plant leaves was taken, and DNA was extracted using the CTAB method with the Shanghai Sangon Biotech Plant DNA Extraction Kit. Equal amounts of DNA from the 40 spiny and 40 spinless F2 plants were mixed to construct spiny and spinless mixed pools, respectively. Libraries were constructed from the DNA from the two mixed pools and the two parents according to the Vagyme standard procedure, and whole-genome resequencing with 30× and 10× coverage was performed on the two mixed pools and the two parents using Illumina HiSeq 4000 (pare-end 150bp). Data quality control was performed using FastQC software (default parameters), removing adapters and low-quality sequences from the raw sequencing data. The sequences were then aligned to the eggplant reference genome using BWA software. Repeats were removed from the alignment results using the SAMTOOLS rmdup command. The GATK3.3 software was used to detect single nucleotide polymorphism (SNP) markers and insertion / deletion (InDels) markers in multiple samples. VariantFiltration was used for filtering, and ANNOVAR software was used to annotate the SNPs and InDels.
[0063] 1.2.3 Development of Spike Gene Localization and Molecular Markers Based on Mixed Pools
[0064] Based on the genotyping results, polymorphic sites showing homozygous differences between parents were screened. Using the parents as references, the SNP frequency (SNP-index) at each polymorphic site in the two progeny pools was calculated according to the method of TAKAGI et al. To reduce the impact of sequencing and alignment errors, the polymorphic sites of the parents after calculating the SNP-index were filtered out according to the following criteria: (1) sites in both progeny with an SNP-index less than 0.3 and an SNP depth less than 5 were filtered out; (2) sites with missing SNP-index in one progeny were filtered out. Subsequently, the difference (ΔSNP-index) between the two progeny SNP-indexes was calculated. The distribution of ΔSNP-index on each chromosome was plotted using a window size of 1Mb and a step size of 10kb. A 95% confidence level was selected as the screening threshold, and windows above the confidence level were selected as candidate intervals.
[0065] 1.3 Experimental Results
[0066] 1.3.1 Preliminary genetic analysis of the prickly trait in eggplant
[0067] A survey of the subcalyx fruit color of 230 F2 generation segregating plants revealed that 40 plants were spiny, 136 were spiny, and 54 were spinless. The overall segregation pattern followed a normal distribution, consistent with quantitative trait inheritance characteristics, and was suitable for BSA extreme pool resequencing. (See attached data.) Figure 3 .
[0068] 1.3.2 Construction of extreme population pools and analysis of sequencing data
[0069] Whole-genome resequencing was performed on a pool of 40 spiny F2 plants and 40 spinless F2 plants, along with both parents, yielding a total of 72.39 G of raw data. After filtering, the effective sequence data from the four samples ranged from 9662.97 to 26582.26 M, with a total data volume of 71.79 G. The sequencing data showed Q20 > 97.92%, Q30 > 93.98%, and GC content between 36.09% and 36.47%. 99.81%–99.87% of the sequences successfully aligned to the reference genome. Therefore, the data from all samples is sufficient, the sequencing quality is acceptable, the GC distribution is normal, and the alignment results with the eggplant reference genome are normal, making the data suitable for subsequent variation detection and trait gene localization.
[0070] Sequencing results from the spiny parent 24TH4 and the spineless parent L154 yielded a total of 1,681,878 SNPs and 312,493 Indels. The number of SNPs detected between the parents was significantly higher than that of Indels. Comparison of the location of mutations revealed that, regardless of whether it was SNP or Indel variations, polymorphic sites located in non-coding regions of genes were significantly more numerous than those in coding regions. These polymorphic sites exhibited a non-uniform distribution among chromosomes, with chromosome 6 having the highest abundance of polymorphic sites.
[0071] 1.3.3 Localization of genes for thorn-like traits
[0072] Two pooled SNP-index analyses were used to map genes involved in the spiny trait of eggplant. The mapping results showed a highly significant peak exceeding the critical value in one region on eggplant chromosome 6, indicating that this region may contain genes regulating spiny trait in eggplant. The significantly associated region on the eggplant genome was distributed as Chr6: 85.22–88.18 Mb. The chromosome length covered by the significantly associated region was 2.96 Mb. The highest peak value at the top of the associated region suggests that this region may contain a major gene causing the spiny-free phenotype in eggplant. (See [link to relevant documentation]). Figure 4 .
[0073] 1.3.4 Development of molecular markers related to spiky traits
[0074] The mapping results revealed a significant associated region located within a 2.96 Mb region on eggplant chromosome 6, exhibiting the highest peak value and representing the major-effect locus controlling the thorn-covering trait. Fine mapping pinpointed the gene controlling the eggplant thorn-covering trait to a physical region of 86444678-86576080. Within this region, a SNP mutation site exists at position 86557859, changing from T to C. A specific KASP marker was developed based on this SNP site.
[0075] Example 2: Determination of specific primers for molecular markers
[0076] 2.1 Base information within 100 bp before and after the variant base
[0077] >SNP1→E06 86557659-86557859
[0078] SEQ ID NO:1
[0079] TTTATCATCGTGCGGAAATTTTTAGCTCATAAGATATATATGCCCACCAATAAGAGTTGT ATTTGATCATGACTCCAACCTTGACCACCCAAACCTCTT[T / C]ATGTGCCTTGACATAGGTAG ATAGCTAGTGTTACTCAACAATCTCCCTCCCAATACGCACTTCATATAGCATGTTGCTCGTTGG AATCTACCCCATGACT
[0080] 2.2 Design of KASP primers based on variant base information
[0081] like Figure 5a and Figure 5b As shown, the KASP primers include a first upstream primer, a second upstream primer, and a downstream primer.
[0082] First upstream primer: SEQ ID NO:2
[0083] GAAGGTGACCAAGTTCATGCTAACCTTGACCACCCAAACCTCTTT
[0084] Second upstream primer: SEQ ID NO:3
[0085] GAAGGTCGGAGTCAACGGATTAACCTTGACCACCCAAACCTCTTC
[0086] Downstream primer: SEQ ID NO:4
[0087] GGTAGATTCCAACGAGCAACATGC
[0088] The sequence of the first upstream primer is shown in SEQ ID NO:2, the sequence of the second upstream primer is shown in SEQ ID NO:3, and the sequence of the downstream primer is shown in SEQ ID NO:4.
[0089] Biological experiments have shown that the above primer combination can perform gradient PCR specific amplification at an annealing temperature close to 61°C.
[0090] Furthermore, the KASP primers were labeled with fluorescein.
[0091] Furthermore, the labeled fluorophores are HEX and FAM.
[0092] Example 3: Validation of Molecular Markers
[0093] 3.1 Test Materials
[0094] The experiment used breeding materials from the fall of 2024, including both thornless and thorny eggplants, totaling 100 experimental materials.
[0095] 3.2 Test Methods
[0096] (1) Sow the eggplant seeds to be tested using a 32-cell seedling tray with one seed per cell and conventional cultivation and management.
[0097] (2) When the seedlings have one new leaf, take one green cotyledon from the seedling to be tested and put it in a 2mL centrifuge tube and transport it back to the laboratory.
[0098] (3) Place two 2mm diameter steel balls in each centrifuge tube and crush them using a high-throughput tissue grinder (Ningbo Scientz-48) with a frequency of 69Hz and a time of 60s.
[0099] (4) During DNA extraction, the sample was placed in a water bath at 65°C for 60 minutes.
[0100] (5) Extract with phenol-chloroform-isoamyl alcohol in a volume ratio of 25:24:1, invert and mix 10 times, centrifuge at 12000 rpm for 4 minutes.
[0101] (6) Take 200uL of the supernatant, add an equal volume of anhydrous ethanol, let stand at 4℃ for 1 hour, centrifuge at 12000rpm for 4 minutes.
[0102] (7) Discard the liquid at the top, add 500ul ddH2O, centrifuge at 3000rpm for 60 seconds, and let stand for 1 hour.
[0103] (8) After the dissolved DNA is tested by a nucleic acid protein analyzer, the concentration is uniformly adjusted to 1-10 ng / uL.
[0104] (9) 2 μL of DNA was collected and the eggplant varieties and inbred lines were screened using the KASP identification system owned by the Eggplant Research Laboratory of Tianjin Kerun Vegetable Research Institute with linkage marker assistance.
[0105] (10)KASP1:
[0106] Forward primer 1: GAAGGTGACCAAGTTCATGCTAACCTTGACCACCCAAACCTCTTT Forward primer 2: GAAGGTCGGAGTCAACGGATTAACCTTGACCACCCAAACCTCTTC Reverse primer: GGTAGATTCCAACGAGCAACATGC Synthesized by Qingke Biotechnology. The labeling development method is described in Examples 1 and 2.
[0107] (11) Drugs and materials: HiGeno 2x Probe Mix, primers, DNA template, ddH2O, fluorescence quantitative PCR plate and sealing film from Beijing Jiacheng Biotechnology Co., Ltd.
[0108] (12) The KASP standard reaction system was used, totaling 10uL, including 5uL Mix (Beijing Jiacheng Biotechnology Co., Ltd. HiGeno 2x Probe Mix), 2.86uL ddH2O, 2uL template DNA (concentration of 1-10ng / uL) and 0.14uL primer premix (adjust the upstream and downstream primer concentrations to 100pmol / uL, and take 12uL Forward primer1, 12uL Forwardprimer2, 30uL Reverse primer and 46uL ddH2O to prepare 100uL primer premix).
[0109] (13) The PCR program is as follows: pre-denaturation at 95℃ for 10 min; 10× cycles (denaturation at 95℃ for 20 s, annealing at 61-55℃ for 40 s, decreasing by 0.6℃ per cycle); 40× cycles (denaturation at 95℃ for 20 s, annealing at 55℃ for 40 s); and finally, storage at 25℃ for later use.
[0110] (14) In order to ensure the accuracy of genotyping data, in addition to the test samples, two control samples with known genotypes are used on the PCR plate. The control samples should cluster in the expected region of their genotypes.
[0111] (15) The samples were detected using a 7500 real-time quantitative PCR instrument, and the genotyping function was selected for analysis. The HEX and FAM fluorescence signal values were plotted on the x-axis and y-axis, respectively. Based on the fluorescence signal values, the samples were clustered, and the genotypes were further determined based on the sample clusters.
[0112] 3.3 Test Results
[0113] Verification results show that the label's compliance rate can reach 95-99%, as shown in Table 1. Figure 6 and Figure 7 This indicates that the molecular markers of the present invention can effectively assist in screening field breeding materials.
[0114] Table 1 Population information for validation of calyx-linked molecular markers
[0115]
[0116]
[0117]
[0118]
[0119]
[0120] Obviously, the above embodiments are merely examples for clear illustration and are not intended to limit the implementation.
[0121] For those skilled in the art, various variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations. However, obvious variations or modifications derived therefrom remain within the scope of this invention.
Claims
1. A molecular marker associated with the thorny trait of eggplant calyx, characterized in that, The sequence of the molecular marker is SEQ ID NO:1, wherein a T→C mutation occurs at the 100bp position of SEQ ID NO:1, and when the base at the 100bp position is T, the eggplant calyx is spiny.
2. The molecular marker related to the thorny trait of eggplant calyx according to claim 1, characterized in that, The eggplant calyx of SEQ ID NO:1 with base C at 100bp is thornless.
3. A KASP primer for amplifying molecular markers associated with the thorny trait of eggplant calyx, characterized in that, The KASP primers include a first upstream primer, a second upstream primer, and a downstream primer, wherein the sequence of the first upstream primer is SEQ ID NO:2, the sequence of the second upstream primer is SEQ ID NO:3, and the sequence of the downstream primer is SEQ ID NO:
4.
4. A reagent kit, characterized in that, The kit includes the KASP primers as described in claim 3.
5. A method for identifying the thorn-like characteristics of eggplant calyxes, characterized in that, include: Genomic DNA was extracted from eggplant leaves. Primers were designed using the genomic DNA as a template, and the product shown in SEQ ID NO:1 was obtained by PCR amplification. The product is then analyzed or sequenced. When the base at the 100th bp of SEQ ID NO:1 is T, the eggplant is thorny; when the base at the 100th bp of SEQ ID NO:1 is C, the eggplant is thornless.
6. A method for predicting the prickly appearance of eggplant, characterized in that, include: Genomic DNA was extracted from eggplant leaves. Primers were designed using the genomic DNA as a template, and PCR amplification was performed to obtain the product shown in SEQ ID NO:
1. The product is then analyzed or sequenced. When the base at the 100th bp of SEQ ID NO:1 is T, the eggplant has thorns; when the base at the 100th bp of SEQ ID NO:1 is C, the eggplant has no thorns.
7. An application characterized in that, include: The use of the molecular markers as described in claim 1 or 2; and / or the KASP primers as described in claim 3; and / or the kits as described in claim 4 in identifying eggplant calyx thorns and / or in eggplant breeding.
Citation Information
Patent Citations
KASP molecular marker related to eggplant fruit color and application of KASP molecular marker
CN116640872A
Group of eggplant whole genome SNP molecular markers and application thereof
CN119040503A