KASP molecular marker related to red strawberry double petal character, primer and application of KASP molecular marker

Abstract

The invention belongs to the technical field of strawberry breeding, and particularly relates to a KASP molecular marker related to red-flower strawberry double petal characters, a primer and application of the KASP molecular marker. The invention provides a KASP marker related to the red strawberry double-petal character, the SNP site of the KASP marker is located at the 34175249 site on the 6-4 chromosome, the KASP marker has the polymorphism of G or A, and the red strawberry with the site of GG type has the double-petal character. The KASP marker disclosed by the invention is closely associated with the characters of the double petals of the red strawberry, and can be used for rapidly identifying and breeding the variety of the double petals of the red strawberry.

Description

Technical Field

[0001] The invention belongs to the technical field of strawberry breeding, and more specifically, relates to a KASP molecular marker related to the double-petal trait of red strawberry, a primer and an application thereof. Background Art

[0002] Red flower strawberry is a new type of ornamental and edible strawberry, which is obtained by intergeneric hybridization of cultivated strawberry with white flowers and Potentilla ovata with red flowers. It has broad application prospects in the fields of landscaping and potted ornamental plants. It has outstanding ornamental value, long flowering period, and edible fruits. It is very popular among domestic and foreign consumers. The double petal nature of flowers is an important ornamental trait of ornamental plants. The double petal nature of red flower strawberry is mainly manifested in the increase of the number of petal whorls and the number of petals. Most double flower traits are quantitative traits, and only a few conform to the genetic laws of quality traits. The double petal characteristics of double flowers are mainly manifested in the increase of the number of petals, the number of petal whorls or the area of ​​petals. Because of its beautiful flower shape and strong sense of layering, it has excellent ornamental value and is deeply favored by people. Therefore, the breeding of double flower varieties has become the key goal of ornamental plant breeding. By breeding red flower strawberry varieties with double petals, we can fill the gap in my country's local double varieties, improve the ornamental value of red flower strawberries, significantly shorten the breeding cycle and increase economic benefits.

[0003] In recent years, molecular biology technology has developed rapidly. DNA molecular marker technology can help researchers quickly select varieties with specific traits and has become an effective means of genetic diversity research. At present, there are very few studies on the formation of double flower traits in red strawberry. Therefore, if molecular assisted breeding based on the formation of double flower traits is to be achieved, it is extremely urgent to explore the genetic loci and key genes that regulate the double flower traits of red strawberry and develop related molecular markers. Summary of the invention

[0004] The purpose of the present invention is to provide a KASP molecular marker, primer and application thereof related to the double petal trait of red flower strawberry, so as to solve the above technical problems.

[0005] The objective of the present invention is achieved through the following technical solutions:

[0006] The invention provides a KASP molecular marker related to the double petal trait of red flower strawberry, whose nucleotide sequence is shown in SEQ ID NO.1, the 150th N of the sequence is a SNP site, the polymorphism is G or A, and the red flower strawberry with the GG genotype at the site has the double petal trait.

[0007] The present invention determines the double - petal trait of red - flowered strawberry by judging the SNP site polymorphism of the gene sequence at the 34175249bp position of chromosome 6 - 4 of red - flowered strawberry. When the SNP site of the gene sequence of red - flowered strawberry is the GG genotype, it is considered that the red - flowered strawberry has the double - petal trait.

[0008] The present invention also provides a pair of specific primers for amplifying the above - mentioned KASP marker, including the upstream primers shown in SEQ ID NO.2 and SEQ ID NO.3, and the downstream primer shown in SEQ ID NO.4.

[0009] The present invention also provides a kit for detecting the double - petal trait of red - flowered strawberry, which is characterized in that the kit includes the above - mentioned specific primers.

[0010] Furthermore, the kit also includes 2×KASP master mix.

[0011] The present invention also provides the application of the above - mentioned KASP marker, the above - mentioned specific primers or the above - mentioned kit in identifying the double - petal trait of red - flowered strawberry.

[0012] The present invention also provides the application of the above - mentioned KASP marker, the above - mentioned specific primers or the above - mentioned kit in breeding double - petal red - flowered strawberry or assisting in breeding double - petal red - flowered strawberry, and the breeding is to cultivate red - flowered strawberry with double - petal trait.

[0013] The present invention also provides a method for detecting the double - petal trait of red - flowered strawberry, including the following steps:

[0014] (1) Extract the genomic DNA of the red - flowered strawberry to be tested;

[0015] (2) Using the genomic DNA of the red - flowered strawberry to be tested as a template, amplify it with the above - mentioned specific primers;

[0016] (3) Identify the genotype at the 150th position of the amplification product. When the SNP site at the 150th position of the amplification product is the GG genotype, the red - flowered strawberry has the double - petal trait.

[0017] The present invention also provides a method for breeding double - petal varieties of red - flowered strawberry, including the following steps:

[0018] (1) Use the above - mentioned detection method to screen red - flowered strawberry plants with the genotype of double - petal trait;

[0019] (2) Use the screened plants as parents for hybridization or self - crossing to obtain offspring of red - flowered strawberry with stable double - petal traits.

[0020] The present invention has the following beneficial effects:

[0021] The present invention provides a KASP marker for identifying the double - petal trait of Potentilla fragarioides, which can be used for the rapid identification and breeding of double - petal varieties of Potentilla fragarioides, laying a foundation for large - scale rapid identification and screening of double - petal Potentilla fragarioides, and contributing to subsequent molecular breeding of Potentilla fragarioides. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is a KASP genotyping map. The abscissa is the FAM fluorescence ratio, the ordinate is the VIC fluorescence ratio, the red dots represent the GG genotype, the blue dots represent the AA genotype, and the green dots represent the AG genotype. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0023] The present invention will be described in detail below with reference to specific embodiments, but it should not be construed as a limitation of the present invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well - known to those skilled in the art. The materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0024] Example 1: Development of KASP molecular markers.

[0025] 1. Development of KASP markers: Using the single - petal Potentilla fragarioides variety 'Scarlet' as the male parent and the double - petal Potentilla fragarioides variety 'Cherry Blossom' as the female parent for hybridization. Select 35 single - petal (petal number 6 - 8) and 35 double - petal (petal number ≥ 15) plants with similar colors from the hybrid offspring to construct two extreme mixed pools. Using the fresh leaves of the Potentilla fragarioides parents and the offspring of the two extreme mixed pools as materials to extract DNA, then conduct whole - genome re - sequencing to screen SNP markers and design KASP molecular markers. The KASP molecular marker sequence is shown in SEQ ID NO.1, the primer sequence group of the KASP marker is shown in Table 1, and the PCR amplification system and reaction program are shown in Tables 2 and 3.

[0026] SEQ ID NO.1: CAAGGTCTATTAGATTAAGCCCCAGTTGTGTGCCTAAC CGGGATCGATCTGATTGAGCCCAGATAGACCTTGCCAGGCGCCTAAAAGGGTTTATTCGAGAAATGGTTCGAGACTGTACAACTAAACTATAAGCCTGACAACGAGCCATGNATGCATTCACAAATTTATATAAGCAACTCTCTTGTCAGTGAAGGGCATGGCTCTTCTGAAAATAGAACCGTAGAAAGTGGAAAACCATATGTTTCATCAAAAGCTCCAACTGTTGATTTTCTGGCTGTTCTTGCATGAAATGTGGGGAAA.

[0027] Table 1: Molecular Markers and Primers Related to the Formation of Double Petal Traits in Red-flowered Strawberries

[0028] Primer 5'-3' SEQ ID NO. F1 GAAGGTGACCAAGTTCATGCTGCCTGACAACGAGCCATGA 2 F2 GAAGGTCGGAGTCAACGGATTGCCTGACAACGAGCCATGG 3 R CTTCACTGACAAGAGAGTTGCTTATATAA 4

[0029] Table 2: PCR Reaction System

[0030] Component Dosage 2×KASP master mix 2.5μL primer mix 1.25μL DNA 1.25μL Total 5μL

[0031] Table 3: PCR Amplification System

[0032]

[0033]

[0034] 2. Fluorescence Detection and Analysis: After the PCR amplification cycle is completed, use a fluorescence quantitative PCR instrument to read the fluorescence value, and use the genotype reading software (Kluster Caller) of LGC_OMEGA to analyze the result data of the fluorescence value reading, and distinguish the allele types. The SNP locus detection uses the fluorophores FAM and VIC to distinguish two isogenic loci. The passive reference dye ROX is used to correct the signal difference caused by the reaction volume error between wells. The relevant excitation and emission wavelengths are shown in Table 4 below.

[0035] Table 4: Wavelengths for Reading Fluorescence Values

[0036] Fluorescent group Excitation light (nm) Emission light (nm) FAM 485 520 VIC 535 556 ROX 575 610

[0037] 3. Explanation of the Results of LGC_OMEGA Gene Analysis: Use the genotype reading software of LGC_OMEGA to analyze the result data of the fluorescence value reading in the above steps. According to the relative fluorescence value, cluster and divide the samples, and further determine the genotype according to the sample clusters and fluorescence types.

[0038] 4. KASP Molecular Marker Genotyping Verification: Use the screened KASP markers to perform genotyping verification on the single and double petal red-flowered strawberry parents and their hybrid offspring. The genotype and phenotype data are shown in Tables 5 and 6, and the genotyping detection results are as Figure 1 shown. This KASP marker is significantly related to the formation of double petal traits in red-flowered strawberries. Among the 66 red-flowered strawberries verified, 44 double petal red-flowered strawberries were successfully detected.

[0039] Table 5: Statistical Results of KASP Marker Genotype Verification in Red-flowered Strawberries

[0040]

[0041]

[0042] Table 6: Genotype and phenotypic verification data of KASP markers for red-flowered strawberry.

[0043]

[0044]

[0045] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0046] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they know the basic creative concept. Therefore, the appended claims are intended to be construed as including the preferred embodiments and all changes and modifications falling within the scope of the present invention.

[0047] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. A KASP molecular marker related to the double petal trait of red strawberry, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

1. The N at position 150 of the sequence is a SNP site, and the polymorphism is G or A. The red strawberry with the GG genotype at this site has a double-petal trait.

2. A specific primer for amplifying the KASP marker according to claim 1, characterized in that: It includes upstream primers as shown in SEQ ID NO.2 and SEQ ID NO.3, and downstream primers as shown in SEQ ID NO.

4.

3. A kit for detecting the petal traits of red strawberry, characterized in that: The kit comprises the specific primer according to claim 2.

4. The kit according to claim 3, characterized in that The kit also includes 2×KASP mastermix.

5. Use of the KASP marker according to claim 1, the specific primer according to claim 2 or the kit according to claim 3 in identifying the double-petal trait of red strawberry.

6. Use of the KASP marker according to claim 1, the specific primer according to claim 2 or the kit according to claim 3 in breeding of double-petaled red flower strawberry or in assisting breeding of double-petaled red flower strawberry, characterized in that: The breeding is to cultivate red-flowered strawberries with double-petal traits.

7. A method for detecting the double petal trait of red strawberry, characterized in that: The following steps are involved: (1) extracting genomic DNA of the tested red strawberry; (2) using the genomic DNA of the strawberry to be tested as a template and amplifying using the specific primers described in claim 2; (3) Identifying the genotype of the 150th position of the amplified product, when the SNP site at the 150th position of the amplified product is a GG genotype, the red strawberry has a double-petal trait.

8. A method for breeding double-petal varieties of red strawberries, characterized in that: The following steps are involved: (1) Screening red strawberry plants having a double-petal genotype using the detection method of claim 7; (2) The selected plants are used as parents for hybridization or self-pollination to obtain red-flowered strawberry offspring with stable double-petal traits.

Images