Primer group for detecting nucleic acid integrity of HPV (human papillomavirus), detection method and application of primer group

Abstract

The invention relates to a primer group for detecting the integrity of HPV (human papillomavirus) nucleic acid, a detection method and application of the primer group, the primer group comprises a first primer and a second primer, and the length of an amplification product obtained by amplifying an HPV genome by the first primer and the second primer is 1000-5000bp. According to the present invention, the completeness of the HPV virus in the body of the HPV infected patient is determined through the long fragment PCR, the amplification of the DNA extracted from the cervical exfoliated cell sample, such that the HPV infection process is revealed, the clinical prediction of the risk probability of the patient developing into the precancerous lesion or the cervical cancer is assisted, the disease prognosis diagnosis is performed, and the advantages of low detection price and convenient clinical use are provided.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a primer set for detecting the nucleic acid integrity of HPV virus, a detection method and its application. Background Art

[0002] Cervical cancer is the most common malignant tumor seriously threatening women's health and has become a major global public health problem. According to the data in the World Cancer Report 2020 released by the World Health Organization (WHO) in February 2020, the number of new cases and deaths of cervical cancer in women worldwide were 604,100 cases and 341,800 cases respectively, and it is the fourth largest malignant tumor threatening the health and life safety of women all over the world. Cervical cancer has a hidden onset and no obvious characteristics in the early stage. Most cases are diagnosed in the advanced stage, and its five-year survival rate is only 20% - 33%, seriously threatening the life safety of patients. Therefore, early diagnosis and treatment are very important. The purpose of cervical cancer screening is to detect, diagnose and treat cervical cancer lesions and early cervical cancer early.

[0003] The whole world has been making unremitting efforts to prevent and control the occurrence of cervical cancer. In November 2020, the WHO released the Global Strategy for the Acceleration of the Elimination of Cervical Cancer, proposing that the world should achieve the "90-70-90" stage goal by 2030, that is, 90% of women complete the vaccination of human papillomavirus (HPV) vaccine before the age of 15, 70% of women receive at least 1 standardized screening at the ages of 35 and 45 respectively, and 90% of patients diagnosed with cervical diseases are treated.

[0004] In the 1970s, German pathologist Harald zur Hausen found through years of observation and research that HPV infection is closely related to the incidence of cervical cancer. Since then, a large number of studies have confirmed that persistent infection with high-risk HPV is the main pathogenic factor of cervical cancer.

[0005] The methods for primary screening of clinical cervical cancer include (1) cervical cytology examination (TCT) and (2) high-risk HPV (HrHPV, high risk HPV) detection. TCT is that doctors observe the morphology of stained cervical exfoliated cells under a microscope to determine whether the patient has lesions. High-risk HPV detection is to detect whether the test sample contains the HPV DNA of 14 high-risk types through nucleic acid hybridization or nucleic acid amplification technology. Those with abnormal or suspicious results in the TCT primary screening, those with positive results of 16 / 18 types in the high-risk HPV genotyping detection, those with positive results of other high-risk types and abnormal or suspicious TCT results, and those with abnormal macroscopic examination need to undergo further colposcopy.

[0006] Both methods have limitations: (1) Since the TCT test relies on the subjective judgment of cytomorphology by the reading physician, and due to sampling errors, as well as a large amount of blood and mucus in the specimens, the false negative rate of using TCT to screen for cervical cancer is relatively high. With the increasing vaccination rate of the HPV vaccine, foreign clinical studies have found that it is becoming increasingly difficult to detect early-stage cervical cancer using the TCT method. (2) Among the test results of using the HPV detection method as a primary screening means for cervical cancer in clinical practice, about 80% of those with positive high-risk HPV DNA tests are transient infections or short-term infections, and only 15% - 20% of patients with persistent high-risk HPV infections may develop into cervical intraepithelial neoplasia or cervical cancer in the future. Due to the high infection rate of HPV, when using HPV detection for cervical cancer screening, a large number of patients need to undergo colposcopy, resulting in a huge waste of medical resources. Therefore, it is crucial to develop new primary screening technologies for cervical cancer and improve the triage strategy for HPV-positive women.

[0007] CN104017907A discloses a fluorescence PCR detection kit for high-risk HPV, which includes a nucleic acid releasing agent and a PCR reaction solution. The nucleic acid releasing agent contains 0.01 - 0.5 mmol / L of surfactin, 20 - 300 mmol / L of potassium chloride, 0.01 - 2% of sodium dodecyl sulfate, and 0.05 - 1% of ethanol; the PCR reaction solution contains primer-probe sequences for high-risk HPV types 16 and 18 and primer-probe sequences for internal standards. It provides a fluorescence quantitative PCR detection kit for high-risk human papillomavirus with rapid operation, simple method, high detection sensitivity, and wide detection range.

[0008] CN105247077A discloses a method for differentiating transient high-risk HPV infection and persistent high-risk HPV infection by in situ hybridization, which relates to a method for classifying cervical tissue or cytological samples. By performing in situ hybridization assays on cervical tissue samples using an antisense E6 or E7 probe, the antisense E6 or E7 probe can detect both HPV DNA and HPV RNA, detect the presence of HPV nucleic acid, and classify cervical tissue samples based on HPV nucleic acid expression.

[0009] In summary, how to detect high-risk HPV and determine whether it has a risk of persistent infection has become one of the urgent problems to be solved in this field. Summary of the Invention

[0010] To solve the above technical problems, the present invention provides a primer set, a detection method, and its application for detecting the nucleic acid integrity of the HPV virus. By long-fragment PCR, the present invention determines the integrity of HPV fragments in patients infected with HPV, thereby revealing the HPV infection process, helping to clinically predict the risk probability of patients developing into precancerous lesions or cervical cancer, and diagnosing the prognosis of the disease.

[0011] To achieve this object, the present invention adopts the following technical solutions:

[0012] In the first aspect, the present invention provides a primer set for detecting the integrity of HPV virus nucleic acid, the primer set comprising a first primer and a second primer, the length of the amplification product of the HPV virus genome amplified by the first primer and the second primer is 1000 to 5000 bp (for example, 1000bp, 1500bp, 2000bp, 2200bp, 2400bp, 2500bp, 2600bp, 2800bp, 3000bp, 3500bp, 4000bp, 4500bp or 5000bp, etc.).

[0013] A good cervical cancer screening triage technology should have the following characteristics: (1) high specificity and sensitivity; (2) no need for professional doctors to resample; (3) low price; (4) simple and easy to use, with less clinical workload. However, existing triage technologies often have high sample requirements and cannot use self-sampled specimens. They are also complicated to operate and expensive. This is because the scientific core of these triage markers is based on the exfoliated cells of the lesions. This results in: (1) The markers detected are usually the biological characteristics of the lesion cells, which requires that the exfoliated cells of the lesion site must be collected for these tests to be closed in scientific logic, and it is inevitable that professional doctors need to collect specimens. (2) The detection markers used in clinical practice are often HPV-related biological specific markers, so they have high sensitivity but poor specificity. Research often uses tumor-related protein or nucleic acid markers, so it is impossible to prevent cervical cancer at the high-grade epithelial tumor stage before the tumor occurs. Therefore, if the starting point of the scientific core of the methodology is changed (persistent HrHPV infection), there is hope to solve the above bottleneck problems.

[0014] According to the "first principles", from the fact that persistent high-risk HPV infection is the main cause of cervical cancer, the present invention makes the following deductions: persistent high-risk HPV infection → complete HPV virus particles → complete HPV genome → long HPV fragments can be amplified by PCR. Conversely, if long HPV fragments can be amplified by PCR → the HPV genome is more complete → there is a greater possibility of complete HPV virus particles → it is more likely that HPV persistent infection will occur, leading to cervical cancer.

[0015] The existing HPV detection methods have amplicons with a length of only about 500 bp. The amplicons are relatively short and cannot truly reflect the presence state of HPV in the body. Therefore, the present invention proposes that patients who can use PCR to amplify longer HPV fragments are more likely to develop cervical cancer. Thus, the present invention designs multiple sets of primers that can amplify the HPV virus genome to produce amplicons of different lengths. Using these primers to perform PCR amplification on the DNA extracted from cervical exfoliated cell specimens, if long fragment amplicons can be produced, it indicates that the patient's body may still contain intact virus particles, and the condition may continue to develop, requiring further examination or continued follow-up. If the long fragment product does not exist, it indicates that the intact HPV in the patient is already incomplete, the ability of persistent infection has decreased, and the patient is in the process of recovery. This method can use the same self-sampling specimens as HPV detection, without requiring the patient to resample. At the same time, it has the advantages of low detection cost and convenient clinical use, and is expected to provide a reference basis for improving the triage strategy for HPV-positive women.

[0016] Preferably, the HPV virus includes HPV 16 and / or HPV 18.

[0017] Preferably, the nucleic acid sequence of the first primer includes the sequence shown in SEQ ID NO.1, and the nucleic acid sequence of the second primer includes the sequence shown in SEQ ID NO.2.

[0018] SEQ ID NO.1: GCGCAGGGCCACAATAATGG.

[0019] SEQ ID NO.2: GAACAGATGGGGCACACAAT.

[0020] Preferably, the primer set further includes a third primer and a fourth primer.

[0021] Preferably, the length of the amplification product of the first primer and the third primer amplifying the HPV virus genome is 700 - 1000 bp (such as 700 bp, 750 bp, 800 bp, 850 bp, 900 bp, 930 bp, 950 bp, 980 bp or 1000 bp, etc.).

[0022] Preferably, the length of the amplification product of the first primer and the fourth primer amplifying the HPV virus genome is 200 - 600 bp (such as 200 bp, 250 bp, 300 bp, 350 bp, 400 bp, 450 bp, 500 bp, 550 bp or 600 bp, etc.).

[0023] Preferably, the nucleic acid sequence of the third primer includes the sequence shown in SEQ ID NO.3.

[0024] SEQ ID NO.3: AAAACAGGGATTTGGCACGC。

[0025] Preferably, the nucleic acid sequence of the fourth primer includes the sequence shown in SEQ ID NO.4.

[0026] SEQ ID NO.4: CGTCCTAAAGGAAACTGATC。

[0027] In the present invention, the first primer provided is an upstream primer, and the second, third, and fourth primers are all downstream primers. The positional distribution of the four primers on the HPV16 genome is as Figure 1 shown, having a common upstream primer.

[0028] Preferably, the nucleic acid sequence of the first primer includes the sequence shown in SEQ ID NO.5, and the nucleic acid sequence of the second primer includes the sequence shown in SEQ ID NO.6.

[0029] SEQ ID NO.5: AGTGCTCCAATCCTCACTGC。

[0030] SEQ ID NO.6: TGCCCCAGTGTTCCCCTATA。

[0031] Preferably, the nucleic acid sequence of the first primer includes the sequence shown in SEQ ID NO.7, and the nucleic acid sequence of the second primer includes the sequence shown in SEQ ID NO.8.

[0032] SEQ ID NO.7: TGCATCGGCTACCCAACTTT。

[0033] SEQ ID NO.8: GATGAGGTGGTGGGTGTAGC。

[0034] Preferably, the nucleic acid sequence of the first primer includes the sequence shown in SEQ ID NO.9, and the nucleic acid sequence of the second primer includes the sequence shown in SEQ ID NO.10.

[0035] SEQ ID NO.9: TGCAGAAACTGGAGGGCATT。

[0036] SEQ ID NO.10: AAAACAGGGATTTGGCACGC。

[0037] Preferably, the nucleic acid sequence of the first primer includes the sequence shown in SEQ ID NO.11, and the nucleic acid sequence of the second primer includes the sequence shown in SEQ ID NO.12.

[0038] SEQ ID NO.11: GCACCGAAGAAACACAGACG.

[0039] SEQ ID NO.12: TGGCAAGCAGGAAACGTACA.

[0040] The present invention also provides other nucleic acid sequences that can serve as the first primer and the second primer. For example, the combinations of SEQ ID NO.5 and SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 can all amplify the HPV16 genome, and other primer sets that can obtain amplification products of 1000 - 5000

[0041] bp can all be applicable to the present invention.

[0042] Preferably, the nucleic acid sequence of the first primer includes the sequence shown in SEQ ID NO.13, and the nucleic acid sequence of the second primer includes the sequence shown in SEQ ID NO.14.

[0043] SEQ ID NO.13: CCTGATCTGTGCACGGAACT.

[0044] SEQ ID NO.14: TCGTTTTTGGGCTCGCCTAT.

[0045] The present invention provides other nucleic acid sequences that can serve as the first primer and the second primer, such as the combination of SEQ ID NO.11 and SEQ ID NO.12, for amplifying the HPV18 genome.

[0046] In the second aspect, the present invention provides a method for detecting the nucleic acid integrity of HPV virus. The method for detecting the nucleic acid integrity of HPV virus includes: using the primer set described in the first aspect to perform PCR amplification on the HPV virus genome and detecting whether the amplification is successful.

[0047] Preferably, the method for detecting the nucleic acid integrity of HPV virus specifically includes:

[0048] Using the first primer and the second primer to perform PCR amplification on the HPV virus genome, detecting whether the amplification is successful. If the amplification is successful, the nucleic acid integrity of the HPV virus is good.

[0049] Preferably, the method for detecting the nucleic acid integrity of HPV virus specifically includes:

[0050] (1) Amplify the HPV virus genome by PCR using the first primer and the second primer, and detect whether the amplification is successful. If the amplification is successful, the integrity of the HPV virus nucleic acid is good;

[0051] (2) If the amplification in step (1) is not successful, amplify the HPV virus genome by PCR using the first primer and the third primer, and detect whether the amplification is successful. If the amplification is successful, the integrity of the HPV virus nucleic acid is medium;

[0052] (3) If the amplification in step (2) is not successful, amplify the HPV virus genome by PCR using the first primer and the fourth primer, and detect whether the amplification is successful. If the amplification is successful, the integrity of the HPV virus nucleic acid is poor.

[0053] Specifically, the present invention can detect the integrity of the HPV virus nucleic acid using the following method:

[0054] (1) Amplify the HPV virus genome by PCR using SEQ ID NO.1 and SEQ ID NO.2, and detect whether the amplification is successful. If the amplification is successful, the integrity of the HPV virus nucleic acid is good;

[0055] (2) If the amplification in step (1) is not successful, amplify the HPV virus genome by PCR using SEQ ID NO.1 and SEQ ID NO.3, and detect whether the amplification is successful. If the amplification is successful, the integrity of the HPV virus nucleic acid is medium;

[0056] (3) If the amplification in step (2) is not successful, amplify the HPV virus genome by PCR using SEQ ID NO.1 and SEQ ID NO.4, and detect whether the amplification is successful. If the amplification is successful, the integrity of the HPV virus nucleic acid is poor.

[0057] Preferably, the method for detecting the integrity of the HPV virus nucleic acid further includes the step of extracting the sample nucleic acid.

[0058] Preferably, the method for detecting whether the amplification is successful includes: performing agarose gel electrophoresis on the amplification product.

[0059] Preferably, the HPV virus includes HPV 16 and / or HPV 18.

[0060] In a third aspect, the present invention provides an application of the primer set as described in the first aspect in the preparation of a cervical cancer diagnostic reagent.

[0061] Viral infection of the human body is inseparable from the process of viral replication and proliferation. By infecting human cells, abnormal proliferation and replication of the cells will produce a large amount of HPV virus DNA. With the massive replication and proliferation of the viral DNA, the once highly ordered and structured epithelial tissue will become chaotic. The extent of the extension of this disordered tissue in the upper layer and on the surface of the epithelium is used to classify the degree of the lesion.

[0062] Clinically, liquid-based thin-layer cytology test (TCT) is commonly used to detect cervical cells and perform cytological classification diagnosis. The common classifications are no intraepithelial lesion or malignancy (NILM), atypical squamous cells of undetermined significance (ASC-US), low-grade squamous intraepithelial lesion (LSIL), and high-grade squamous intraepithelial lesion (HSIL). NILM indicates possible cervical erosion or no cervical disease. ASC-US indicates that some cell abnormalities are found during the examination, and HPV testing or clinical symptoms and medical history need to be combined for diagnosis. LSIL indicates low-grade cervical precancerous lesions, and HSIL indicates high-grade cervical precancerous lesions, and a colposcopy is required for further diagnosis.

[0063] Since persistent infection with high-risk HPV leads to cervical cancer, the virus particles are complete, which can ensure its normal proliferation and expansion of the infection area. The integrity of the virus particles indicates the integrity of the HPV genes. When using PCR for long-fragment amplification, the expected product fragments can be obtained.

[0064] Fourthly, the present invention provides a kit for cervical cancer diagnosis, and the kit includes the primer set described in the first aspect.

[0065] Preferably, the cervical cancer diagnosis includes: predicting the risk probability of developing precancerous lesions or cervical cancer after being infected with high-risk HPV.

[0066] Fifthly, the present invention provides the application of the primer set described in the first aspect, the method for detecting the integrity of HPV virus nucleic acid described in the second aspect, or the kit described in the fourth aspect in constructing a cervical cancer risk prediction model.

[0067] In the prevention and treatment of cervical cancer, predicting the risk of an individual developing cervical cancer in advance is crucial for early intervention of the disease. The primer set involved in the present invention can accurately identify and amplify specific fragments of HPV virus DNA that are closely related to the risk of cervical cancer.

[0068] By collecting a large number of population samples of different ages, different living habits and with clear cervical cancer diagnosis results (including patients from a healthy state to different grades of precancerous lesions and those with confirmed cervical cancer), after amplifying the HPV virus DNA in the samples using this primer set, corresponding gene data information is obtained (such as the amplification of each long fragment, the quantification of the HPV virus, etc.). These gene data are integrated with other clinical information of the sample providers (such as whether there is immune deficiency, whether taking specific drugs for a long time, family cancer history, etc.). Subsequently, advanced machine learning algorithms, such as random forest, XGBoost, etc., are used to construct a cervical cancer risk prediction model. During the model training process, through the learning and analysis of the data, the model can uncover the complex association patterns between the gene characteristics of the HPV virus and other clinical factors. After repeated model training and optimization, as well as strict internal cross-validation and external independent dataset validation. By screening with the scores of F1 score and AUC-PR, a suitable model is selected, and then the basic parameters are improved through the generated confusion matrix (where 0 represents positive sample HSIL and 1 represents negative sample non-HSIL), improving a series of parameter indicators such as the sensitivity, specificity, positive predictive value, negative predictive value, etc. of the model. So that it can accurately evaluate the risk degree of an individual suffering from cervical cancer. For individuals at high risk, more intensive monitoring measures and personalized preventive intervention programs can be taken in advance, such as increasing the screening frequency, providing lifestyle guidance or early preventive treatment, etc., thereby effectively reducing the incidence and mortality of cervical cancer and providing strong support for the precise prevention and treatment of cervical cancer.

[0069] Other specific point values within the above numerical ranges can all be selected and will not be elaborated one by one here.

[0070] Compared with the prior art, the present invention has the following beneficial effects:

[0071] The present invention provides a primer set for detecting the nucleic acid integrity of the HPV virus and its detection method. By long fragment PCR, the integrity of the viral nucleic acid is judged. Based on this, the present invention also provides a kit for cervical cancer diagnosis. By long fragment PCR, the integrity of the HPV fragments in the body of HPV-infected patients is obtained, to judge whether they have the risk of persistent infection, reveal the HPV infection process, help clinically predict the risk probability of patients developing into precancerous lesions or cervical cancer, and conduct the diagnosis of disease prognosis. Brief Description of the Drawings

[0072] Figure 1 Schematic diagram of the position distribution of each primer in Example 1.

[0073] Figure 2 Graph of the primer sensitivity test results in Example 3.

[0074] Figure 3Electrophoresis result diagram of the amplified product with a length of 2 kb to 3 kb in Example 4.

[0075] Figure 4 Electrophoresis result diagram of the amplified product with a length of 3 kb to 4 kb in Example 4.

[0076] Figure 5 Electrophoresis result diagram of the amplified product with a length of 4 kb to 5 kb in Example 4.

[0077] Figure 6 Electrophoresis result diagram of the amplified product with a length of 5 kb to 6 kb in Example 4.

[0078] Figure 7 Electrophoresis band statistical chart of Example 5.

[0079] Figure 8 Schematic diagram of the position distribution of each primer in Example 6.

[0080] Figure 9 Result diagram of the primer sensitivity test in Example 6.

[0081] Figure 10 Electrophoresis result diagram of the PCR amplified product of HSIL samples in Example 6.

[0082] Figure 11 Electrophoresis band statistical chart of the PCR amplified products of primers FP2 and RP4 in Example 6.

[0083] Figure 12 Electrophoresis band statistical chart of the PCR amplified products of primers FP4 and RP6 in Example 6.

[0084] Figure 13 Statistical comparison chart of different length primer groups in Example 7.

[0085] Figure 14 Electrophoresis result diagram of the PCR amplified product in Example 8.

[0086] Figure 15 Electrophoresis band statistical chart of Example 8.

[0087] Figure 16 Confusion matrix and numerical results of each index generated by the random forest model in Example 9.

[0088] Figure 17 Confusion matrix and numerical results of each index generated by the XGBoost model in Example 9. Detailed implementation manners

[0089] To further elaborate on the technical means and effects adopted by the present invention, the present invention will be further described below in conjunction with embodiments and the accompanying drawings. It can be understood that the specific implementation manners described herein are only used to explain the present invention, rather than limiting the present invention.

[0090] For those not specifying specific techniques or conditions in the embodiments, they shall be in accordance with the techniques or conditions described in the literature in this field or in accordance with the product specifications. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through regular channels.

[0091] The reagents used in the following embodiments are as follows:

[0092] PCR reagent: 2×PlatinumTMII Hot-Start Green PCR Master Mix, purchased from ThermoFisher Scientific.

[0093] Example 1

[0094] This example provides a primer set for detecting the nucleic acid integrity of HPV 16 virus, and the nucleic acid sequences are shown in Table 1.

[0095] Table 1

[0096] SEQ ID NO. Primer Name Sequence (5’-3’) 1 HPV16-FP1 GCGCAGGGCCACAATAATGG 2 HPV16-RP1 GAACAGATGGGGCACACAAT 3 HPV16-RP2 AAAACAGGGATTTGGCACGC 4 HPV16-RP3 CGTCCTAAAGGAAACTGATC

[0097] Among them, HPV16-FP1 is the common left primer. After PCR amplification with three right primers RP1, RP2, and RP3 respectively, the lengths of the amplification products are 2168bp, 988bp, and 452bp. Figure 1 It is the position diagram of the primers.

[0098] Example 2

[0099] This example provides a method for detecting the nucleic acid integrity of HPV virus, and the method includes the following steps:

[0100] 1. Sample collection: Collect cervical exfoliated cell samples and extract the nucleic acids of the samples.

[0101] 2. Nucleic acid amplification and sample analysis: Prepare the PCR reaction system according to Table 2. The PCR amplification program is shown in Table 3. After the amplification is completed, perform agarose gel electrophoresis on the PCR products to obtain the amplification situation. Use the first primer and the second primer to perform PCR amplification on the HPV virus genome to detect whether the amplification is successful. If the amplification is successful, the integrity of the HPV virus nucleic acid is good; if the amplification is not successful, use the first primer and the third primer to perform PCR amplification on the HPV virus genome to detect whether the amplification is successful. If the amplification is successful, the integrity of the HPV virus nucleic acid is medium; if the amplification is still not successful, use the first primer and the fourth primer to perform PCR amplification on the HPV virus genome to detect whether the amplification is successful. If the amplification is successful, the integrity of the HPV virus nucleic acid is poor.

[0102] Table 2

[0103]

[0104] Table 3

[0105]

[0106] Example 3

[0107] In this example, the sensitivity of the primers FP1 and RP1 in Example 1 was verified. Sensitivity refers to the minimum value of the target gene that can be detected by the PCR amplification reaction. A plasmid was used as the target for the sensitivity experiment. The high-concentration plasmid was serially diluted to different multiples, and then the PCR amplification reaction was carried out with reference to Example 2. The electrophoresis results of the PCR products are as Figure 2 shown, and the sensitivity of the primers FP1 and RP1 was obtained as 19.7 cp / μL.

[0108] Example 4

[0109] In this example, multiple sets of primers were designed on the L1 gene of HPV16 to amplify fragments with lengths exceeding 2 kb, 3 kb, 4 kb, and 5 kb, respectively, to deeply explore the influence of primers with different lengths on the amplification effect of long fragments. The PCR amplification method was carried out with reference to Example 2. After the amplification reaction was completed, the amplification products were analyzed by gel electrophoresis to visually observe the amplification situation of different length fragments. The electrophoresis results of 2 kb to 3 kb (2399 bp, 2510 bp, 2098 bp, 2811 bp, 2605 bp, 2400 bp, 2845 bp, 2814 bp, 2034 bp, and 2831 bp) are as Figure 3 shown, and the electrophoresis results of 3 kb to 4 kb (3637 bp, 3288 bp, 3329 bp, 3052 bp, and 3217 bp) are as Figure 4 shown, and the electrophoresis results of 4 kb to 5 kb (4107 bp, 4304 bp, 4079 bp, 4770 bp, and 4114 bp) are as Figure 5As shown, the electrophoresis results of 5 kb to 6 kb (5190 bp, 5737 bp, 5682 bp, 5535 bp, and 5986 bp) are as Figure 6 shown.

[0110] It can be seen from Figures 3 to 6 that the effect is best when using primer sets designed to amplify fragments not exceeding 3 kb. Compared with primer sets for other longer fragments, the primer set with an amplification product length below 3 kb can not only more stably achieve the amplification of long fragments, but also has better quality of the amplification product, showing clear bands and higher specificity. In contrast, when using primer sets for longer fragments (such as exceeding 3 kb, 4 kb, or 5 kb), it is difficult to amplify the target fragment, the amount of the amplification product decreases, the bands are relatively fuzzy, and there are non-specific amplified bands, indicating that the stability and efficiency of the amplification are inferior to those of the 2 kb to 3 kb primer set. Therefore, this experiment verifies the superiority of the primer set with an amplification length of 2 kb to 3 kb in long fragment amplification, which not only improves the success rate of the experiment, but also provides higher-quality data support for gene analysis of complex samples.

[0111] Although long fragment PCR for lengths exceeding 3 kb, 4 kb, or 5 kb can still be achieved (such as Figure 5 the first group), its effect is often inferior to that of 2 kb to 3 kb PCR efficiency. Even by optimizing the reaction conditions and using high-performance reagents, it is possible to successfully amplify the target fragment exceeding 3 kb, but the efficiency, specificity, and yield of the reaction are usually not as high as those of 2 kb to 3 kb PCR. At the same time, long fragment amplification of more than 3 kb, 4 kb, or 5 kb requires higher requirements for reagents, has a lower error tolerance for operation, and the process of repeated optimization is more time-consuming and resource-consuming.

[0112] It can be seen from the results that when the distance between the upstream and downstream primers is too long, that is, the amplification product is too long, the long fragment amplification efficiency decreases, which will cause some viruses with a complete structure to be misjudged as viruses without a complete structure due to the failure of long fragment amplification. Moreover, the longer the amplification fragment, the longer the reaction time required. Therefore, the primer set and its detection method provided by the present invention can be applicable to determine whether HPV has a risk of persistent infection.

[0113] Example 5

[0114] In this example, a kit for cervical cancer diagnosis was prepared using the primers provided in Example 1. The integrity of HPV16 virus nucleic acid was detected using the method for detecting the integrity of HPV virus nucleic acid provided in Example 2. Cervical exfoliated cell samples from 274 HPV16-infected patients with complete medical records (TCT, HPV, and tissue biopsy) were collected for research. Using the patient's cervical exfoliated cell DNA as the amplification target, long-fragment PCR amplification was performed, and the target bands were statistically analyzed after agarose gel electrophoresis. The results are as Figure 7 shown.

[0115] As can be seen Figure 7 from Figure 7 , in the three classification groups of NILM (negative for intraepithelial lesion or malignancy), LSIL (low-grade squamous intraepithelial lesion), and HSIL (high-grade squamous intraepithelial lesion), the statistical results showed an obvious trend in the proportion of the presence or absence of the 2168bp fragment product band in different groups. When the patient had symptoms of higher-risk cervical cancer precancerous lesions, the possibility of the appearance of the 2168bp amplification band in the exfoliated cell DNA amplification result was greater.

[0116] Example 6

[0117] In this example, primers capable of amplifying long fragments were designed for different positions of the HPV16 whole genome. These three primer sets did not have a common left primer, and the amplicons were distributed in different intervals of the HPV16 genome. The primer sequences are shown in Table 4, Figure 8 and Figure 8 is the position map of the primers, FR1, and RP1 in the HPV16 virus genome in Table 4.

[0118] Table 4

[0119] SEQ ID NO. Primer Name Sequence (5’-3’) 5 HPV16-FP2 AGTGCTCCAATCCTCACTGC 6 HPV16-RP4 TGCCCCAGTGTTCCCCTATA 7 HPV16-FP3 TGCATCGGCTACCCAACTTT 8 HPV16-RP5 GATGAGGTGGTGGGTGTAGC 9 HPV16-FP4 TGCAGAAACTGGAGGGCATT 10 HPV16-RP6 AAAACAGGGATTTGGCACGC

[0120] Referring to Example 3, the sensitivity test of the primers in Table 4 was performed. The results are as Figure 9 shown. From left to right, they are the electrophoresis results of the amplification products of primers FP2 and RP4, the electrophoresis results of the amplification products of primers FP3 and RP5, and the electrophoresis results of the amplification products of primers FP4 and RP6. The length of the amplification product of primers FP2 and RP4 is 2605bp, and the sensitivity is 84cp / μL; the length of the amplification product of primers FP3 and RP5 is 2845bp, and the sensitivity is 32.5cp / μL; the length of the amplification product of primers FP4 and RP6 is 2814bp, and the sensitivity is 34.5cp / μL.

[0121] Using the primers in Table 4, PCR amplification was performed on 4 HSIL samples. The PCR amplification method was referred to Example 2, and the electrophoresis results of the amplification products are as Figure 10As shown. All three primer sets could amplify long fragment bands from HSIL samples, further proving that the amplifiable long fragment HPV DNA could be used as a marker for detecting persistent high-risk HPV infection, and the amplification range of the above primers covered the vast majority of HPV 16 genomic fragments.

[0122] Primers FP2 and RP4, and primers FP4 and RP6 were selected for verification with real samples. 176 samples were amplified for long fragments, and the results were statistically analyzed. The amplification results of primers FP2 and RP4 are as Figure 11 shown, and the amplification results of primers FP4 and RP6 are as Figure 12 shown. Combining Figure 7 , Figure 11 and Figure 12 It can be seen that the amplification results of the three primer sets have high consistency, and there is an obvious trend in the proportion of the presence of long fragment product bands in different groups. Therefore, the present invention can predict the patient's disease course without using multiple primer sets, which not only greatly simplifies the detection process, but also reduces the experimental cost and operation difficulty. The simplified primer design can reduce the complexity of the reaction, lower the risk of non-specific amplification, thereby improving the accuracy and repeatability of the results. In addition, reducing the number of primer sets can also speed up the detection, making it more suitable for high-throughput detection and clinical real-time monitoring, and making the dynamic tracking of the disease course more convenient and efficient.

[0123] Example 7

[0124] In this example, to clarify the technical advantages of long fragment PCR primers in the grading diagnosis of HPV16-related cervical lesions, four groups of gradient amplification length primer combinations were systematically designed for the entire HPV 16 genome, and their amplification products covered the intervals of 0 - 500bp, 500 - 1000bp, 1000 - 3000bp, and 3000 - 5000bp respectively. By detecting the DNA samples of cervical exfoliated cells from 100 HPV 16-positive patients with different clinical courses (from NILM to HSIL), combined with bioinformatics prediction and PCR amplification experiment verification, it was found that there was a certain correlation between the length of the amplicon and the disease process, as Figure 13 shown.

[0125] When using the HPV16-FP1 / HPV16-RP3 primer set (product length: 452bp, 0 - 500bp) for detection, more than 92% of the samples showed target product bands. Although its detection sensitivity was comparable to that of commercially available conventional kits (PCR product < 500bp), its disease grading diagnosis efficiency was significantly insufficient, confirming that short fragment amplification technology could not effectively distinguish the virus integrity characteristics. While the long fragment primer set showed specific biological correlation in disease grading.

[0126] The long - fragment primer sets, namely HPV16 - FP1 / RP2 primer set (988bp), HPV16 - FP1 / RP1 primer set (2168bp), and HPV16 - FP5 / RP7 (4107bp), showed a certain degree of consistency compared with the gold standard in the detection of different disease courses of HPV 16. The amplification success rate showed a certain increasing trend with the degree of lesion. Among them, the HPV16 - FP1 / RP3 primer set (product length: 2168bp, 1000 - 3000bp) had the best effect.

[0127] SEQ ID NO.11 (HPV16 - FP5): GCACCGAAGAAACACAGACG.

[0128] SEQ ID NO.12 (HPV16 - RP7): TGGCAAGCAGGAAACGTACA.

[0129] This may be because when the amplicon length exceeds 3000bp, limited by the clinical sample DNA and the continuous synthesis ability of the polymerase, its amplification efficiency decays exponentially, resulting in a significant decrease in the detection rate of high - integrity target sequences. On the contrary, short - fragment amplification (<500bp) has the advantage of high amplification kinetics, but it will amplify fragmented viral DNA, leading to an increase in the detection rate of different disease courses. The above results indicate that 1000 - 3000bp amplicons can effectively detect intact virus particles by balancing genome coverage and detection stability, providing key technical parameters for constructing an HPV lesion grading system based on virus integrity.

[0130] Example 8

[0131] In this example, a set of primers was designed for the whole - genome sequence of HPV 18, named HPV18 - FP and HPV18 - RP. As Figure 14 shown, this primer set can amplify a 2042bp product fragment.

[0132] SEQ ID NO.13 (HPV18 - FP): CCTGATCTGTGCACGGAACT.

[0133] SEQ ID NO.14 (HPV18 - RP): TCGTTTTTGGGCTCGCCTAT.

[0134] In this invention, 261 cervical exfoliated cell samples of HPV18 - infected patients with complete medical records (TCT, HPV, tissue biopsy) were collected for research. Using the cervical exfoliated cell DNA of patients as the amplification target, long - fragment PCR amplification, electrophoresis, and statistical analysis of the target bands were carried out. The results are as Figure 15As shown, it is proved that there is a correlation between the long fragment products and the infection course. By using PCR amplification to detect whether the long fragment DNA of HPV is contained in the patient's body, the HPV infection process can be revealed, so as to help the clinic predict whether the patient will develop the risk of precancerous lesions or cervical cancer, and this biomarker can also help clinicians diagnose the prognosis of the disease.

[0135] Example 9

[0136] This example provides the application of the present invention in constructing a cervical cancer risk prediction model. By collecting a large number of population samples of different ages, different living habits and with clear cervical cancer diagnosis results (including patients diagnosed with cervical cancer from the healthy state to different grades of precancerous lesions), after amplifying the HPV virus DNA in the samples using this primer set, the corresponding gene data information (such as the amplification of each long fragment, the quantification of the HPV virus, etc.) is obtained. These gene data are integrated with other clinical information of the sample providers (such as whether there is immune deficiency, whether taking specific drugs for a long time, family cancer history, etc.). Subsequently, advanced machine learning algorithms, such as random forest ( Figure 16 ), XGBoost ( Figure 17 ), etc., are used to construct a cervical cancer risk prediction model. For individuals at high risk, more intensive monitoring measures and personalized preventive intervention programs can be taken in advance, such as increasing the screening frequency, providing lifestyle guidance or early preventive treatment, etc., so as to effectively reduce the incidence and mortality of cervical cancer and provide strong support for the precise prevention and treatment of cervical cancer.

[0137] To sum up, the present invention provides a primer set for detecting the nucleic acid integrity of the HPV virus and its detection method, and judges the integrity of the viral nucleic acid by long fragment PCR. Based on this, the present invention also provides a kit for cervical cancer diagnosis, which obtains the integrity of the HPV fragments in the body of HPV-infected patients by long fragment PCR, judges whether they have the risk of persistent infection, reveals the HPV infection process, helps the clinic predict the risk probability of patients developing precancerous lesions or cervical cancer, and diagnoses the prognosis of the disease.

[0138] The applicant declares that the above description is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

Claims

1. A primer set for detecting the integrity of HPV virus nucleic acid, characterized in that: The primer set includes a first primer and a second primer. The length of the amplified product of the HPV viral genome amplified by the first primer and the second primer is 1000 to 5000 bp.

2. The primer set according to claim 1, characterized in that The HPV virus includes HPV 16 and / or HPV 18; Preferably, the nucleic acid sequence of the first primer includes the sequence shown in SEQ ID NO.1, and the nucleic acid sequence of the second primer includes the sequence shown in SEQ ID NO.

2.

3. The primer set according to claim 1 or 2, characterized in that: The primer set also includes a third primer and a fourth primer; Preferably, the length of the amplified product of the HPV viral genome amplified by the first primer and the third primer is 700 to 1000 bp; Preferably, the length of the amplified product of the HPV viral genome amplified by the first primer and the fourth primer is 200 to 600 bp; Preferably, the nucleic acid sequence of the third primer includes the sequence shown in SEQ ID NO.3; Preferably, the nucleic acid sequence of the fourth primer includes the sequence shown in SEQ ID NO.

4.

4. The primer set according to any one of claims 1 to 3, characterized in that: The nucleic acid sequence of the first primer includes the sequence shown in SEQ ID NO.5, and the nucleic acid sequence of the second primer includes the sequence shown in SEQ ID NO.6; Preferably, the nucleic acid sequence of the first primer includes the sequence shown in SEQ ID NO.7, and the nucleic acid sequence of the second primer includes the sequence shown in SEQ ID NO.8; Preferably, the nucleic acid sequence of the first primer includes the sequence shown in SEQ ID NO.9, and the nucleic acid sequence of the second primer includes the sequence shown in SEQ ID NO.10; Preferably, the nucleic acid sequence of the first primer includes the sequence shown in SEQ ID NO.11, and the nucleic acid sequence of the second primer includes the sequence shown in SEQ ID NO.12; Preferably, the nucleic acid sequence of the first primer includes the sequence shown in SEQ ID NO.13, and the nucleic acid sequence of the second primer includes the sequence shown in SEQ ID NO.

14.

5. A method for detecting the integrity of HPV virus nucleic acid, characterized in that: The method for detecting the integrity of HPV virus nucleic acid comprises: using the primer set described in any one of claims 1 to 4 to PCR amplify the HPV virus genome, and detecting whether the amplification is successful.

6. The method for detecting the integrity of HPV virus nucleic acid according to claim 5, characterized in that: The method for detecting the integrity of HPV virus nucleic acid specifically comprises: Using the first primer and the second primer to PCR amplify the HPV virus genome, and detecting whether the amplification is successful. If the amplification is successful, the HPV virus nucleic acid has good integrity; Preferably, the method for detecting the integrity of HPV viral nucleic acid specifically comprises: (1) using the first primer and the second primer to PCR amplify the HPV viral genome and detect whether the amplification is successful. If the amplification is successful, the HPV viral nucleic acid has good integrity; (2) If step (1) fails to amplify successfully, use the first primer and the third primer to PCR amplify the HPV viral genome to detect whether amplification is successful. If amplification is successful, the HPV viral nucleic acid integrity is medium; (3) If step (2) fails to amplify successfully, use the first primer and the fourth primer to PCR amplify the HPV viral genome to detect whether the amplification is successful. If the amplification is successful, the HPV viral nucleic acid integrity is poor.

7. The method for detecting the integrity of HPV virus nucleic acid according to claim 5 or 6, characterized in that: The method for detecting the integrity of HPV virus nucleic acid also includes the step of extracting sample nucleic acid; Preferably, the method for detecting whether the amplification is successful comprises: subjecting the amplification product to agarose gel electrophoresis; Preferably, the HPV virus includes HPV 16 and / or HPV 18.

8. Use of the primer set according to any one of claims 1 to 4 in preparing a diagnostic reagent for cervical cancer.

9. A kit for diagnosing cervical cancer, characterized in that: The kit comprises the primer set according to any one of claims 1 to 4; Preferably, the cervical cancer diagnosis includes: predicting the risk probability of developing precancerous lesions or cervical cancer after infection with high-risk HPV.

10. Use of the primer set according to any one of claims 1 to 4, the method for detecting the integrity of HPV virus nucleic acid according to any one of claims 5 to 7, or the kit according to claim 9 in constructing a cervical cancer risk prediction model.

Images