Application of IMT1 in preparation of anti-aging drugs

By using IMT1 as a POLRMT inhibitor, the expression of aging-related genes and inflammatory response genes was blocked, and the problem of difficulty in delaying aging and inhibiting chronic inflammation in the prior art was solved, and significant aging inhibition and inflammation reduction effects were achieved.

CN120154598APending Publication Date: 2025-06-17武汉安特为生物科技有限公司
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510304552.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-14
Publication Date
2025-06-17

AI Technical Summary

Technical Problem

The prior art is difficult to effectively delay the aging process and inhibit the chronic inflammatory response and tissue degeneration related to aging.

Method used

IMT1 is used as a non-competitive specific human mitochondrial RNA polymerase (POLRMT) inhibitor to alter the metabolic status of cells by blocking substrate binding and transcription, and inhibiting the expression of aging-related genes and inflammatory response genes.

Benefits of technology

It significantly inhibits the expression of aging-related genes and inflammatory response genes in lung and renal tissues induced by DOX, reduces the expression level of inflammatory factors, reduces tissue fibrosis and inflammatory response, and delays the aging process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120154598A_ABST
    Figure CN120154598A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological medicines, and provides application of IMT1 in preparation of anti-aging medicines. The IMT1 effectively targets mtRNA from senescence cells and remarkably inhibits various senescence-related inflammatory reactions and tissue degeneration, and the specific expression is as follows: the IMT1 can remarkably inhibit expression of senescence-related genes P16 and P21, inflammatory reaction genes Il-6 and Il-beta and fibrosis-related genes Acta2, Col1a1 and Tamp1 induced by DOX in lung and kidney tissues, reduce the expression level of inflammatory factors Il-6 and Il-1 beta in alveolar lavage fluid and inhibit the expression of inflammatory reaction genes Il-6 and Il-1 beta in alveolar lavage fluid. Good treatment effect and application potential are shown.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to the application of IMT1 in the preparation of anti-aging drugs. Background Art

[0002] Aging refers to the phenomenon that the body's physiological and psychological adaptability to the environment decreases progressively and gradually tends to death. It is a complex and multi-dimensional natural process. Aging inducing factors include mitotic signal disorders, DNA damage and gene mutations, telomere damage, proteotoxic stress (such as protein aggregation and unfolded proteins), increased metabolites (such as reactive oxygen species, ceramides, fatty acids, high glucose), increased nutrient signals (such as mTOR), etc. Aging is related to several conserved mechanisms, such as nutrient pathways, mitochondrial dysfunction, metabolic pathways, energy homeostasis, DNA repair, and autophagy. Cells can in turn drive the response of aging characteristics to damage: stem cell exhaustion and chronic inflammation. Inflammatory response is also one of the main exogenous influences on aging cells. In particular, chronic low-level inflammation is a serious complex factor in many diseases, and its risk increases with age. The aging process is irreversible, but it can be delayed.

[0003] The chemical name of IMT1 is Propanamide, N,N-dimethyl-2-[[4-(2-methylphenyl)-2-oxo-2H-1-benzopyran-7-yl]oxy], CAS No.: 2304621-31-4. It is a non-competitive specific inhibitor of human mitochondrial RNA polymerase (POLRMT), which can cause conformational changes in POLRMT and block substrate binding and transcription in a dose-dependent manner. It can reduce the levels of deoxynucleoside triphosphates and citric acid cycle intermediates, resulting in a significant depletion of cellular amino acid levels, thereby changing the cell's metabolic state and affecting processes such as cell growth, proliferation, and survival. Multiple studies have found that IMT1 has anti-cancer activity. It can inhibit the growth and proliferation of various cancer cells. For example, in some in vitro cell experiments, IMT1 has an obvious inhibitory effect on the growth of cancer cell lines such as breast cancer, lung cancer, and colorectal cancer, can induce apoptosis of cancer cells, and inhibit the migration and invasion ability of cancer cells, but there is no report on anti-aging. Summary of the Invention

[0004] In view of this, the present invention proposes the application of IMT1 in the preparation of anti-aging drugs.

[0005] The technical solution of the present invention is realized as follows: The present invention provides the application of IMT1 in the preparation of anti-aging drugs, and the structural formula of the IMT1 is:

[0006]

[0007] Based on the above technical solutions, preferably, the aging is organ aging and aging-related inflammation.

[0008] Based on the above technical solutions, preferably, IMT1 can inhibit the expression of aging-related genes P16 and P21, inflammatory response genes il-6 and il-1β, and fibrosis-related genes Acta2, Col1a1, and Timp1.

[0009] The application of IMT1 of the present invention in the preparation of anti-aging drugs has the following beneficial effects compared with the prior art:

[0010] (1) IMT1 in the present invention can significantly inhibit the expression of aging-related genes P16 and P21, inflammatory response genes Il-6 and Il-β, and fibrosis-related genes Acta2, Col1a1, and Timp1 in DOX-induced lung and kidney tissues, and reduce the expression levels of inflammatory factors Il-6 and Il-1β in bronchoalveolar lavage fluid.

[0011] (2) IMT1 treatment can significantly inhibit DOX-induced systemic (liver, lung, and kidney) injury, including reducing the fibrosis level in various tissues and inhibiting the expression level of inflammatory factor Il-1β in these tissues.

[0012] (3) IMT1 effectively targets mtRNA derived from senescent cells and significantly inhibits various aging-related inflammatory responses and tissue degeneration, showing its good therapeutic effect and application potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0014] Figure 1 It is a schematic diagram of mouse modeling for the present invention;

[0015] Figure 2 It is a graph showing the mRNA level expression of fibrosis and inflammation-related genes in mouse lung tissue;

[0016] Figure 3 It is a graph showing the protein level expression of IL-6 and IL-1β in mouse bronchoalveolar lavage fluid;

[0017] Figure 4 It is a graph showing the mRNA level expression of fibrosis-related genes in mouse kidney tissue;

[0018] Figure 5These are the pathological fibrosis and Il-1β staining analysis diagrams of mouse kidney, liver, and lung tissues;

[0019] Figure 6 These are the mtRNA analysis diagrams of mouse liver and kidney tissues;

[0020] Figure 7 These are the mtRNA analysis diagrams of mouse lung tissues. Detailed implementation manners

[0021] Next, in combination with the implementation manners of the present invention, the technical solutions in the implementation manners of the present invention will be clearly and completely described. Obviously, the described implementation manners are only a part of the implementation manners of the present invention, rather than all of the implementation manners. Based on the implementation manners in the present invention, all other implementation manners obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of the present invention.

[0022] The present invention first discovers that the compound IMT1 can delay the aging process, can be used to treat chronic inflammatory responses related to aging, and inhibit tissue degeneration and tissue fibrosis related to aging. Specific experiments and data are shown in the following examples.

[0023] Example 1 Animal model

[0024] 1. Reagents

[0025] IMT1: An mtRNA synthesis inhibitor, administered by gavage (30 mg / kg), purchased from TargetMol, product number T8841, Cas number 2304621-31-4, and the structural formula is:

[0026]

[0027] Doxorubicin (DOX): A DNA-damaging agent that induces cellular senescence (0.5 μM). It induces aging in mice. Administered by intraperitoneal injection (10 mg / kg), purchased from TargetMol, product number T1456, Cas number 23214-92-8.

[0028] ELISA kits (IL-6, IL-1β) were purchased from biolegend and used to detect cytokines inside mouse tissues.

[0029] Antibodies: p16 and IL-1β were provided by immunohistochemistry detection service providers.

[0030] 2. Experimental animals

[0031] Animal model: C57BL / 6 mice (8 weeks old).

[0032] All procedures and experimental protocols involving mice were approved by the Institutional Animal Care and Use Committee (IACUC) of the School of Life Sciences, Wuhan University.

[0033] C57BL / 6 mice received an intraperitoneal injection of DOX (doxorubicin) on day 0, followed by IMT1 treatment on days 1, 3, 5, and 6, and were analyzed on day 7 (see Figure 1 ).

[0034] Example 2 qPCR detection of the mRNA levels of related genes in lung tissue and alveolar macrophages 1. Sample collection and processing

[0035] The mice were sacrificed and the chest cavity was fully exposed. After ligating the trachea, the entire lung lobe was excised. Alveolar cells were collected by bronchoalveolar lavage (BALF), and alveolar macrophages were sorted by flow cytometry (labeled with CD11c+ and F4 / 80+) and purified.

[0036] 2. RNA extraction

[0037] For lung tissue and isolated alveolar macrophages, total RNA was extracted using an RNA extraction kit (such as TRIzol reagent or column-based RNA extraction method).

[0038] The RNA concentration and purity were measured (recommended A260 / A280 between 1.8 - 2.0), and RNA integrity was confirmed by electrophoresis (28S / 18S ≈ 2:1).

[0039] 3. cDNA synthesis

[0040] Using a reverse transcription kit, the extracted RNA was reverse transcribed into cDNA. Specifically:

[0041] Take 1 μg of RNA and reverse transcribe it using PrimeScript RT MasterMix (Takara) under the following conditions:

[0042] 37°C for 15 min → 85°C for 5 sec → store at 4°C.

[0043] 4. Real-time quantitative PCR (qPCR)

[0044] Use primers specific to the target genes (primers designed for genes related to lung tissue senescence, inflammation, and fibrosis, such as P16, P21, Il-6, Il-1β, Acta2, Col1a1, Timp1).

[0045] The sequences are as follows:

[0046]

[0047]

[0048] Reaction system (20 μL): 10 μL of SYBR Premix Ex Taq (Takara), 2 μL of cDNA template, and 0.8 μM each of forward and reverse primers.

[0049] Cycling program: 95°C for 30 s → 40 cycles (95°C for 5 s → 60°C for 30 s → 72°C for 10 s) → melting curve analysis.

[0050] Gene detection list:

[0051] Aging-related genes: p16, p21;

[0052] Inflammation-related genes: IL-6, IL-1β;

[0053] Fibrosis-related genes: Col1a1, Acta2, Timp1.

[0054] The analyzed data was used to compare the relative expression levels of samples in the treatment group and the control group (usually calculated by the ΔΔCq method), and the results are shown in Figure 2 .

[0055] Example 3 ELISA detection of IL-6 and IL-1β protein levels in bronchoalveolar lavage fluid

[0056] 1. Collection of bronchoalveolar lavage fluid (BALF)

[0057] After the mouse experiment (day 7), the mice were anesthetized and tracheally intubated.

[0058] Sterile PBS (500 μL each time, 2 - 3 times in total) was injected into the lungs and the lavage fluid was recovered.

[0059] The collected BALF was slowly centrifuged (such as 300 g, for 10 minutes) to remove cell debris, and the supernatant was stored.

[0060] 2. Protein quantification

[0061] The protein concentration was determined using the BCA or Bradford method to ensure that the total amount of the sample was within the range for ELISA detection.

[0062] Dilute the sample to the appropriate concentration as needed.

[0063] 3. ELISA detection

[0064] Commercially available mouse IL-6 and IL-1β specific ELISA kits were used, and the specific method is as follows:

[0065] Add 100 μL of sample / standard to each well, cover with a sealing plate membrane, and incubate at 37°C for 2 h.

[0066] 3.2 Plate washing (automated plate washer or manually 5 times, washing solution: 0.01M PBS + 0.05% Tween-20).

[0067] 3.3 Add biotin-labeled detection antibody (100 μL per well), incubate at 37 °C for 1 h.

[0068] 3.4 After plate washing, add HRP-streptavidin (100 μL per well), incubate in the dark for 20 min.

[0069] 3.5 Color development: Add TMB substrate (100 μL / well), incubate at room temperature in the dark for 15 min → stop solution (50 μL / well).

[0070] 3.6 Reading: Detect at 450 nm with an ELISA reader (reference wavelength 570 nm), calculate the concentration through the standard curve, and the results are shown in Figure 3 .

[0071] Example 4 Detection of mRNA levels of fibrosis genes (p16, col1a1, timp1) in kidney tissues by qPCR

[0072] 1. Sample collection

[0073] Dissect the kidneys of mice, remove the tissues and quickly rinse them with PBS to remove blood. Cut about 50 - 100 mg of kidney tissue and store it frozen in liquid nitrogen.

[0074] 2. RNA extraction

[0075] Use an RNA extraction kit to extract RNA from kidney tissues (similar to Example 2).

[0076] Homogenize the tissues thoroughly using a homogenizer or mortar, and ensure that the purity of the RNA extraction sample resuspension meets the requirements.

[0077] 3. cDNA synthesis

[0078] Consistent with Example 2, use a reverse transcription kit to reverse transcribe RNA into cDNA.

[0079] 4. Real-time quantitative PCR (qPCR)

[0080] The reaction conditions are the same as in Example 2, and the gene-specific primers for amplification are:

[0081] Gene Forward(5'→3') Reverse(5'→3') M-GAPDH AGGTCGGTGTGAACGGATTTG GGGGTCGTTGATGGCAACA M-P16 CCCAACGCCCCGAACT GCAGAAGAGCTGCTACGTGAA M-Col1a1 GAGCGGAGAGTACTGGATCG GTTCGGGCTGATGTACCAGT M-Timp1 GGTGTGCACAGTGTTTCCCTGTTT TCCGTCCACAAACAGTGAGTGTCA

[0082] Data processing: Calculate the relative gene expression levels by the ΔΔCq method, and use the t-test to compare the differences between the DOX group and the IMT1 treatment group (p < 0.05 is the significance threshold), and the results are shown in Figure 4 .

[0083] Example 5. Staining of kidney / liver / lung tissue fibrosis (Masson) and immunohistochemical analysis of interleukin-1β (IL-1β)

[0084] 1. Tissue fixation and sectioning

[0085] Take mouse kidney, liver, and lung tissues and immediately fix them in 4% paraformaldehyde (PFA) for 24 hours → gradient dehydration (ethanol → xylene) → paraffin embedding. Use a microtome to prepare 4-μm thick continuous sections, attach them to adhesive-free glass slides, and dry them at 60°C for 2 hours.

[0086] 2. Masson trichrome staining (fibrosis assessment)

[0087] Deparaffinization and hydration: Incubate in xylene I / II for 10 minutes each → gradient ethanol (100% → 95% → 80%) for hydration.

[0088] Staining steps: Hematoxylin staining for 5-10 minutes → differentiation with acidic ethanol → rinse with running water → blueing → rinse with running water. Ponceau fuchsin staining for 5-10 minutes → treatment with phosphomolybdic acid for 1-2 minutes → aniline blue staining for 1-2 minutes.

[0089] Dehydration and mounting: Gradient ethanol dehydration → xylene transparency → mounting with neutral gum.

[0090] Result interpretation: Observe and evaluate the degree of pulmonary fibrosis in mice under the microscope. Blue represents collagen fibers, red represents muscle fibers / cytoplasm, and dark blue represents cell nuclei. The results are shown in Figure 5 .

[0091] 3. IL-1β immunohistochemical staining

[0092] Sectioning: The section thickness is 3-5 μm. Spread the sections at a water temperature of 42°C and bake them in an oven at 60°C for 30 minutes.

[0093] Deparaffinization to water: Incubate in xylene I for 5 minutes, xylene II for 5 minutes, xylene III for 5 minutes, absolute ethanol for 1 minute, 95% ethanol for 1 minute, 75% ethanol for 1 minute, and distilled water for 5 minutes.

[0094] Antigen retrieval: EDTA microwave heat retrieval for 5-8 minutes and cool to room temperature.

[0095] Inactivation: Use an immunohistochemical pen to draw a circle to prevent the reagent from flowing out. Drop the endogenous peroxidase blocking solution and incubate at room temperature for 10 minutes. Wash 3 times with PBS buffer, 5 minutes each time.

[0096] Blocking: Drop the blocking serum and incubate at 37°C for 30 minutes. Discard the excess serum without washing.

[0097] Primary antibody incubation: Add primary anti-IL-1β antibody (Abcam ab9722, diluted 1:200), incubate in a humidified chamber at 37°C for 2 h, wash 3 times with PBS buffer for 5 minutes each time.

[0098] Secondary antibody incubation: Add HRP-labeled secondary antibody (GoatAnti-Rabbit IgG), incubate at 37°C for 30 minutes, wash 3 times with PBS buffer for 5 minutes each time.

[0099] Color development: DAB chromogenic solution, prepare DAB by mixing 1 ml of solution B + 1 drop of solution A, add DAB chromogenic solution, observe under the microscope until the positive signal is significantly enhanced and the background is clean to terminate color development; if the color development is faint, repeat the previous step to enhance the color.

[0100] Counterstaining: Add Mayer's hematoxylin for 30 s, wash with distilled water, soak in blueing solution for 1 minute, then wash with water.

[0101] Dehydration, clearing and mounting: Dehydrate in a gradient of 75%-95%-100% alcohol for 1 minute each, clear in three xylene baths for 2 minutes each, and mount with neutral balsam.

[0102] Image analysis: Take pictures with a microscope (×200 / 400), quantify the proportion of the positive area using ImageJ, and the results are shown in Figure 5 。

[0103] Example 6 Extraction and qPCR Analysis of Mitochondrial RNA (mtRNA) from Kidney / Liver / Lung Tissues

[0104] 1. Mitochondrial isolation

[0105] Tissue homogenization: Take 100 mg of tissue in a pre-chilled mitochondrial isolation kit (Beyotime, C3601 / C3606), cut into small pieces on ice → gently grind with a Dounce homogenizer (20 times).

[0106] Differential centrifugation: Centrifuge at 600 g for 10 min at 4°C (to remove cell nuclei and debris) → take the supernatant. Centrifuge the supernatant at 11,000 g for 15 min at 4°C → the precipitate is mitochondria.

[0107] Purity verification: Detect mitochondrial markers (such as COX IV) and nuclear contamination markers (such as Histone H3) by Western Blot.

[0108] 2. mtRNA extraction

[0109] Lyse the mitochondrial precipitate with digitonin (1:500) → separate layers with chloroform → precipitate with isopropanol.

[0110] RNA was dissolved in RNase-free water, and the integrity of mtRNA was detected by Agilent 2100 Bioanalyzer (RIN>7.0).

[0111] 3. Reverse transcription and qPCR of mtRNA

[0112] Reverse transcription: Using M-MLV reverse transcriptase (containing random hexamer primers), 42 °C for 60 min → 70 °C for 15 min.

[0113] qPCR amplification:

[0114] Primer design: Specifically amplify mitochondrial genes (such as mt-COX1, mt-ND1, mt-ATP6) to avoid interference from nuclear genome homologous sequences.

[0115] Reaction conditions: The same as in Experiment 1, and mitochondrial rRNA (such as mt-RNR1) was used as the internal reference.

[0116] Data analysis: The ΔΔCq method was used to calculate the expression difference of mtRNA. The DOX group and the IMT1 treatment group were compared. The results are shown in Figure 6 and 7 .

[0117] Figures 2-4 As shown, IMT1 treatment significantly inhibited the expression of senescence-related genes P16, P21, inflammatory response genes Il-6, Il-1β, and fibrosis-related genes Acta2, Col1a1, Timp1 induced by DOX in lung and kidney tissues, and reduced the expression levels of inflammatory factors Il-6 and Il-1β in bronchoalveolar lavage fluid.

[0118] Figure 5 Histopathological analysis of the tissues showed that IMT1 treatment significantly inhibited DOX-induced systemic damage, including reducing the fibrosis level in various tissues and inhibiting the expression of inflammatory factor Il-1β in these tissues.

[0119] Since IMT1 targets mtRNA synthesis, the present invention further analyzed the synthesis and release of mtRNA in the senescent tissue environment. The results showed that DOX treatment induced the release of mtRNA (COX1 probe was used to detect mtRNA level) into the tissue environment of multiple organs (liver, lung, kidney) ( Figures 6-7 ), while IMT1 treatment significantly inhibited the synthesis and release of mtRNA. These findings indicate that IMT1 treatment can inhibit the synthesis and release of mtRNA, effectively reducing damage-mediated age-related inflammatory responses and tissue degeneration.

[0120] In summary, the research results of the present invention show that IMT1 effectively targets mtRNA derived from senescent cells, significantly inhibits various senescence-related inflammatory responses and tissue degeneration, demonstrating its good therapeutic effect and application potential.

[0121] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. The use of IMT1 in the preparation of anti-aging drugs, characterized in that: The structural formula of the IMT1 is:

2. The use according to claim 1, characterized in that: The aging refers to organ aging and aging-related inflammation.

3. The use according to claim 1, characterized in that: The IMT1 can inhibit the expression of aging-related genes P16 and P21, inflammatory response genes il-6 and il-1β, and fibrosis-related genes Acta2, Col1a1, and Timp1.