Application of engineered exosomes enriched with RHOT1 in the preparation of drugs to improve insulin resistance
By constructing RHOT1-P15 recombinant protein and using CD81 protein to target delivery, RHOT1-Exo was prepared, which solved the problem of difficulty in expression of RHOT1 protein in exosomes, and achieved the effect of improving mitochondrial function and treating insulin resistance.
Patent Information
- Application Number
- CN202510646714.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-20
- Publication Date
- 2025-09-02
- Estimated Expiration
- 2045-05-20
AI Technical Summary
The RHOT1 protein is not efficiently expressed in exosomes, limiting its application in the treatment of insulin resistance caused by mitochondrial dysfunction.
By forming the recombinant protein RHOT1-P15 with amino acid sequences of SEQ ID No. 1 to 4 with RHOT1, a recombinant plasmid expressing the recombinant protein was constructed, transfected with cell culture, and the engineered exosome RHOT1-Exo rich in RHOT1 was extracted, and the targeted delivery of exosomes was achieved using CD81 protein.
Significantly promote mitochondrial oxidative phosphorylation, improve ATP content, enhance antioxidant enzyme expression, improve mitochondrial network structure, improve insulin resistance and treat insulin resistance.
Smart Images

Figure CN120154742B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and more specifically, relates to the use of engineered exosomes enriched in RHOT1 in the preparation of drugs for treating insulin resistance. Background Art
[0002] Mitochondrial dysfunction is closely linked to the development of insulin resistance syndrome (IRS), which includes impaired glucose metabolism, hyperinsulinemia, dyslipidemia, and hypertension. For example, patients with type 2 diabetes and IR experience significant mitochondrial dysfunction. The resulting β-oxidation impairment triggers fatty acid accumulation and increased ROS production, activating corresponding stress proteins and inhibiting insulin signaling. During oxidative metabolism, the ETC in mitochondria is susceptible to massive electron leakage, leading to the reduction of oxygen molecules to form reactive oxygen species (ROS). Excessive ROS can lead to mtDNA mutations, causing mitochondrial dysfunction, impacting mitochondrial homeostasis, and further exacerbating the progression of IR. Therefore, improving mitochondrial dysfunction may be a promising approach to improve insulin resistance.
[0003] RHOT1 is a key regulator of insulin secretion in human pancreatic islets, and its intracellular function is closely linked to mitochondrial morphology and function. Studies have shown that RHOT1 activity is regulated by multiple signaling pathways, including post-transcriptional modifications such as phosphorylation and dephosphorylation, which directly influence RHOT1 function and mitochondrial homeostasis. Silencing RHOT1 in cells leads to increased ROS production, decreased intracellular ATP levels, mitochondrial dysfunction, and decreased insulin secretion. Overexpression of RHOT1, on the other hand, can reduce ROS levels, mitigate cellular oxidative stress damage, improve mitochondrial dysfunction, and alleviate insulin resistance.
[0004] Exosomes are tiny vesicles secreted by cells and containing nucleic acids, proteins, and lipids. Exosomes offer high targeting and barrier penetration, low immunogenicity, high biocompatibility, multifunctional payloads and combination therapy potential, reduced side effects and enhanced stability, and natural origin and scalability. Therefore, they are used as drug delivery vehicles for the treatment of a variety of diseases. However, RHOT1 protein itself cannot be effectively expressed in exosomes, limiting its application in the treatment of insulin resistance via exosomes. Furthermore, RHOT1 protein is not naturally present in exosomes, limiting its application in the treatment of mitochondrial dysfunction. Summary of the Invention
[0005] The purpose of the present invention is to overcome the above-mentioned defects and deficiencies in the prior art and provide the use of engineered exosomes rich in RHOT1 in the preparation of drugs for treating insulin resistance.
[0006] A second object of the present invention is to provide a use of engineered exosomes enriched in RHOT1 in the preparation of a drug for treating insulin resistance caused by mitochondrial dysfunction.
[0007] The above-mentioned object of the present invention is achieved through the following technical solutions:
[0008] The present invention first prepares engineered exosomes rich in RHOT1 (RHOT1-Exo), which are firstly formed by combining a polypeptide P15 having an amino acid sequence as shown in any one of SEQ ID Nos. 1 to 4 with RHOT1 to form a recombinant protein RHOT1-P15, then constructing a recombinant plasmid expressing the recombinant protein, transfecting cells for culture, and extracting exosomes to obtain engineered exosomes RHOT1-Exo rich in RHOT1; that is, the gene encoding the polypeptide P15 having an amino acid sequence as shown in any one of SEQ ID Nos. 1 to 4 is connected to the 3' end or 5' end of the RHOT1 protein encoding gene to obtain a chimeric gene, then constructing a recombinant plasmid expressing the chimeric gene, and then transfecting cells for expression, and extracting exosomes to obtain engineered exosomes RHOT1-Exo rich in RHOT1.
[0009] Molecular glue is a type of artificially synthesized substance. Polypeptides can be enzymes, transcription factors, structural proteins, etc. Polypeptides can promote interactions between proteins, thereby forming stable ternary complexes or enhancing existing protein-protein interactions.
[0010] CD81 is a tetraspanin protein that is widely present on the cell surface and naturally present in exosomes. It is a key marker for exosomes and can be used for their identification and isolation. In exosome-targeted engineering applications, using CD81 for targeted modification can achieve precise delivery of exosomes, thereby improving therapeutic efficacy and reducing side effects, which has important scientific and clinical significance.
[0011] The present invention screens out a peptide P15 that targets and binds to CD81 by incubating a phage library with a recombinant CD81 protein. This peptide is then linked to the end of the RHOT1 protein through genetic recombination technology to form the recombinant protein RHOT1-P15, thereby promoting the binding of RHOT1 to CD81. Since CD81 is a molecular protein already present in exosomes, the peptide P15 can bind to the RHOT1 protein, thereby helping the RHOT1 protein to achieve transcellular transport from the cell to the exosome, enabling its enrichment in the exosomes. Specifically, a recombinant plasmid expressing the recombinant protein RHOT1-P15 is constructed (i.e., the gene encoding the peptide P15 is linked to the 3' or 5' end of the RHOT1 protein encoding gene to obtain a chimeric gene, and then a recombinant plasmid expressing the chimeric gene is constructed), and cells are transfected and cultured; the peptide P15 can link to the CD81 in the RHOT1-targeted exosomes, promoting the binding of RHOT1 to CD81, and obtaining engineered exosomes rich in RHOT1 (RHOT1-Exo). When the amino acid sequences of RHOT1 protein and polypeptide P15 are known, those skilled in the art can obtain the coding gene sequences of RHOT1 protein and polypeptide P15 using conventional techniques and optimize them according to the host codon preference.
[0012] The present invention applied the engineered exosome RHOT1-Exo to a HepG2 cell model of insulin resistance induced by high glucose, and detected the antioxidant activity indicators of cell mitochondria and the expression of insulin signaling pathway proteins. The results showed that the engineered exosome RHOT1-Exo had a therapeutic effect on the insulin resistance model cells, indicating that the RHOT1 protein successfully played a role in the treatment of insulin resistance through exosome expression.
[0013] Specifically, the present invention adds the engineered exosomes RHOT1-Exo to a HepG2 cell model of insulin resistance induced by high glucose, evaluates its effects on ATP content, mitochondrial membrane potential, ROS level and mtDNA content in the model cells, and detects the expression level of insulin signaling pathway proteins. The research results show that the constructed engineered exosomes RHOT1-Exo significantly promotes mitochondrial oxidative phosphorylation, promotes the expression of animal cell antioxidant enzymes and improves the mitochondrial network structure, has the effect of promoting the recovery of mitochondrial function, regulates the biological effects of multiple mitochondrial metabolic enzymes, and enhances its antioxidant capacity, and has application value in insulin resistance caused by mitochondrial dysfunction.
[0014] Therefore, the present invention first provides the use of the above-mentioned engineered exosomes enriched in RHOT1 in the preparation of a drug for improving insulin resistance.
[0015] The present invention also provides use of the engineered exosomes enriched in RHOT1 in the preparation of a drug for treating insulin resistance associated with mitochondrial dysfunction.
[0016] Furthermore, the insulin resistance is caused by mitochondrial dysfunction.
[0017] Furthermore, the drug is used in the treatment of insulin resistance by promoting mitochondrial oxidative phosphorylation in the subject's cells, regulating the activity of mitochondrial metabolic enzymes and antioxidant enzymes, clearing ROS, increasing ATP content and promoting mitochondrial oxidative phosphorylation, enhancing mitochondrial network generation and restoring mitochondrial function.
[0018] Furthermore, the subject is selected from mammals.
[0019] Furthermore, the mammal is selected from mice, cats, dogs, pigs, cows, horses, sheep, monkeys and humans.
[0020] Furthermore, the medicine also includes other pharmaceutically acceptable excipients.
[0021] Furthermore, the gene encoding the polypeptide P15 is connected to the gene encoding the RHOT1 protein via a Flag tag, that is, the polypeptide P15 is connected to the RHOT1 protein via a Flag tag.
[0022] Furthermore, the gene encoding the polypeptide P15 is connected to the 3' end of the gene encoding the RHOT1 protein, that is, the polypeptide P15 is connected to the C-terminus of the RHOT1 protein. The present invention constructs pcDNA3.1-RHOT1-P15-C and pcDNA3.1-RHOT1-P15-N recombinant plasmids, and connects the polypeptide P15 to the C-terminus or N-terminus of the RHOT1 protein through gene recombination technology to form an RHOT1-polypeptide fusion protein expression system. After the plasmid is transfected into cells (engineered gene cells), engineered exosomes rich in RHOT1 are successfully constructed. By + and C + The content of RHOT1 in transfected cells (engineered gene cells), exosomes (engineered exosomes), and target cells (target cells) was analyzed. C + There was more co-localization of RHOT1 with mitochondria in the WT group, indicating that the C-terminal linked peptide P15 can more effectively promote the translocation of RHOT1 to mitochondria in target cells.
[0023] Furthermore, the amino acid sequence of the polypeptide P15 is shown in SEQ ID No. 1: GCSMMKYCATCAGCM. The present invention screened four polypeptide sequences from a 12-peptide phage peptide library, which were able to produce affinity with the CD81 recombinant protein. Phage ELISA testing showed that the polypeptide with the sequence GCSMMKYCATCAGCM had stronger binding ability.
[0024] Furthermore, the template plasmid of the recombinant plasmid is pcDNA3.1, that is, pcDNA3.1-RHOT1-P15 and pcDNA3.1-SDC4 recombinant plasmids are constructed.
[0025] Furthermore, the cells are hepatocytes.
[0026] Preferably, the hepatocytes are human hepatocytes, and the human hepatocytes are HepG2 cells.
[0027] Furthermore, the exosomes are extracted by ultracentrifugation.
[0028] Compared with the prior art, the present invention has the following beneficial effects:
[0029] The present invention provides the use of engineered exosomes enriched in RHOT1 for the preparation of a drug for the treatment of insulin resistance. This method involves incubating a phage library with CD81 recombinant protein to screen for the targeting peptide P15. The peptide P15 is then combined with the RHOT1 protein to form the recombinant protein RHOT1-P15. A recombinant plasmid expressing the recombinant protein RHOT1-P15 is then constructed and transfected into cells for culture. The peptide P15 can bind to CD81 in the RHOT1-targeted exosomes, promoting the binding of RHOT1 to CD81 and aiding in the transorganelle transport and enrichment of RHOT1 from the cell to the exosomes. Finally, the exosomes are extracted to obtain the engineered exosomes enriched in RHOT1, RHOT1-Exo. Research results from the present invention demonstrate that the engineered exosomes RHOT1-Exo can significantly promote mitochondrial oxidative phosphorylation, stimulate the expression of cellular antioxidant enzymes, and improve mitochondrial network structure, promoting mitochondrial function recovery, improving insulin resistance, and treating insulin resistance. Therefore, the present invention provides the use of RHOT1-Exo exosomes enriched in RHOT1 for the preparation of a drug for the treatment of insulin resistance. The present invention successfully achieves the use of RHOT1 protein in the treatment of insulin resistance in the form of exosomes, providing an important theoretical basis for the application of drugs in the clinical treatment of insulin resistance. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] Figure 1The results are shown for screening CD81 affinity peptides using phage ELISA in Example 1. *: p<0.05, **: p<0.01, ***: p<0.001.
[0031] Figure 2 Schematic diagram of two modes of connection between P15 and the end of RHOT1 in Example 1.
[0032] Figure 3 For the Co-IP detection N in Example 1 + and C + Protein binding of recombinant proteins to CD81.
[0033] Figure 4 The ELISA method for detecting the content of Flag and RHOT1 in cells and exosomes in Example 1 is as follows. Figure 4 A shows the Flag level in HepG2-RHOT1-transfected cells; B shows the Flag and RHOT1 levels in exosomes secreted by HepG2-RHOT1 cells; C shows the Flag level in HepG2 cells after 3 days of high-glucose co-culture with exosomes. *: p < 0.05, ns: p > 0.05 (n = 3).
[0034] Figure 5 This is the detection of engineered exosomes in Example 1. Figure 5 A is the microstructure image of Exo and RHOT1-Exo under transmission electron microscopy (scale bar = 100 nm); B is the BCA method to detect the secretion level of Exo and RHOT1-Exo, ns: p>0.05 (n=3); C is the particle size distribution of Exo and RHOT1-Exo detected by nanoparticle tracking; DE are Western blot detection of exosome markers and RHOT1 protein in Exo and RHOT1-Exo, and quantitative analysis of RHOT1 expression level based on band gray value. Among them, p # <0.05 vs HepG2, p***<0.001 vs Exo, (n=3).
[0035] Figure 6 The effects of different concentrations of glucose on the viability of HepG2 cells in Example 2, p*<0.05, p**<0.01 vs 0 mmol / L, (n=3).
[0036] Figure 7 is the glucose uptake by HepG2 cells in Example 2. ## <0.01 vs HepG2, p*<0.05vs high glucose-HepG2, (n=3).
[0037] Figure 8 The expression level of antioxidant enzymes, ROS and mtDNA content in Example 2 were detected. Figure 8 Figure (A) shows the activity of SOD1, SOD2, and CAT in normal HepG2 cells (Control group), insulin-resistant HepG2 cells (High glucose group), and insulin-resistant cells treated with RHOT1-Exo (High glucose-RHOT1-Exo group). Figures (B-C) show the determination of cellular ROS by staining with a CM-H2DCFDA probe and measuring it by immunofluorescence and FACS (Scale bar = 50 μm). Figure (D) shows the mtDNA content in IR cells after RHOT1-Exo treatment. P* < 0.05, P** < 0.01 (n = 3).
[0038] Figure 9 This is a graph showing the ATP level detected in Example 2. P** < 0.01.
[0039] Figure 10 This is a diagram of the fluorescence detection (Mito-Tracker Green fluorescent probe) of the mitochondrial network structure in Example 2. Figure 10 A in the figure is the mitochondrial network structure of HepG2 cells induced by high glucose; Figure 10 Figure B is the mitochondrial network structure diagram of IR cells after RHOT1-Exo treatment.
[0040] Figure 11 is the detection result of the insulin signaling pathway related proteins in Example 2. # <0.05 vsHepG2, p*<0.05 vs high glucose-HepG2, (n=3). DETAILED DESCRIPTION
[0041] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.
[0042] Unless otherwise specified, all reagents and materials used in the following examples were commercially available.
[0043] 1. Experimental Materials
[0044] Table 1 Cell sources
[0045] cell Feature Description source HepG2 human liver cancer cells Merck KGaA <![CDATA[HepG2-RHOT1(N + )]]> Human hepatoma cells, transfected with pcDNA3.1-RHOT1-P15-N plasmid The present invention is constructed <![CDATA[HepG2-RHOT1(C + )]]> Human hepatoma cells, transfected with pcDNA3.1-RHOT1-P15-C plasmid The present invention is constructed E. coli DH5α Plasmid construction host bacteria Laboratory collection
[0046] Table 2 Plasmid sources
[0047] plasmids Genetic markers and construction source pcDNA3.1-RHOT1-P15-N plasmid KpnI and XbaI restriction endonuclease sites were designed at both ends of the P15-Flag-RHOT1 sequence. Wuhan Jinkairui pcDNA3.1-RHOT1-P15-C plasmid pcDNA3.1-SDC4 plasmid KpnI and XbaI restriction endonuclease sites were designed at both ends of the RHOT1-Flag-P15 sequence. KpnI and XbaI restriction endonuclease sites were designed at both ends of the SDC4 sequence. Wuhan Jinkairui
[0048] DMEM powder was purchased from Gibco; antioxidant enzyme activity assay kits were purchased from Dojindo Molecular Technology Inc; fetal bovine serum (FBS) was purchased from ThermoFisher; and HepG2 cells were preserved in the laboratory.
[0049] 2. Experimental methods
[0050] 2.1 Cell Culture
[0051] (1) Preparation of the cell room: If the cell room is being disinfected with UV light, turn it off and turn on the fluorescent light. Turn on the 37°C water bath and place the DMEM culture medium and cell treatment PBS taken out of the 4°C chromatography cabinet into the water bath to heat; put on a white coat and slippers for the cell room, wear a mask and a hat, spray the sleeves of the white coat with 75% ethanol and disinfect your hands. Use an alcohol cotton ball to disinfect the microscope stage. After UV irradiation, start ventilation and fluorescent lighting, and pull the workbench glass to the appropriate position. Take out the DMEM culture medium and PBS that have returned to room temperature and disinfect them, then place them on the clean bench for use; take out the sterilized pipette tips from the 55°C oven, disinfect them with 75% ethanol, and place them on the left side of the clean bench for use. Turn on the cell room centrifuge. Carefully take out the cells to be processed and place them on the sterilized microscope stage to observe the cell growth status and whether there is contamination. When everything is ready, start processing the cells.
[0052] (2) Cell culture conditions: HepG2 cells are adherent cells and are cultured using DMEM medium. Add 50 mL of filtered fetal bovine serum (FBS) and 5 mL of penicillin-streptomycin (double-antibody) to every 445 mL of DMEM to prepare a complete culture medium. The cells are cultured in a sterile cell culture incubator at 37°C and 5% CO2. Observe cell growth regularly and decide whether to further process them. After the cells grow to an appropriate density, they are digested with sterile trypsin and then passaged, plated, and frozen for subsequent experimental needs.
[0053] (3) Cell recovery: Take a 15 mL centrifuge tube and add 3 mL of complete culture medium for later use. Remove the frozen cells from liquid nitrogen and heat them in a 37°C water bath. After thawing, disinfect the surface of the cryotube. Quickly transfer the thawed cell suspension to the prepared complete culture medium in a clean bench; centrifuge at 800 rpm for five minutes. After centrifugation, discard the supernatant in the clean bench and resuspend the cells in complete culture medium. Transfer the cells to a T25 cell culture flask at a 1:1 ratio, shake gently, and then culture in an incubator.
[0054] (4) Cell passaging: Remove the cell culture flask and discard the old culture medium, and wash it once with PBS; add an appropriate amount of trypsin, and after an appropriate time, observe under a microscope. If the cells slowly become independent spheres, immediately add 4 times the volume of trypsin to terminate the digestion; slowly and gently blow off the digested cells, transfer them to a 15 mL centrifuge tube, and centrifuge at 800 rpm for 5 min; retrieve the cells after centrifugation, discard the supernatant in the centrifuge tube in an ultra-clean workbench, add an appropriate amount of complete culture medium to resuspend, and gently blow evenly, and transfer them to a T25 cell culture flask at a ratio of 1:3 to continue culture.
[0055] (5) Cell freezing: Remove the cell culture flask and discard the old culture medium, wash once with PBS; add an appropriate amount of trypsin for digestion. After the digestion is terminated, gently blow the cells and transfer them to a 15 mL centrifuge tube, centrifuge at 800 rpm for 5 minutes; retrieve the cells after centrifugation, discard the supernatant in the centrifuge tube in the clean bench, add 1 mL of cell freezing solution (FBS: DMSO = 9:1) to resuspend, and gently blow evenly, then transfer to a pre-prepared cryopreservation tube; finally, perform a gradient cooling of the cells (4℃, 30 min; -20℃, 1.5h; -80℃, 12h) and transfer to liquid nitrogen for storage for later use.
[0056] Example 1 Preparation of engineered exosomes enriched in RHOT1
[0057] 1. Experimental Methods
[0058] 1. Targeting peptide screening
[0059] Targeted peptide screening was performed using a 15-peptide phage display library. This library contains billions of phage clones, each displaying a random exogenous peptide sequence at the N-terminus of the phage coat protein. The phage library was first incubated in a flask at 37°C for 1 hour to remove phage that specifically bound to the flask. Then, after pretreatment to remove nonspecifically bound phage, the remaining phage library was incubated with CD81 recombinant protein for 1 hour at room temperature. Unbound phage were washed 10 times with bovine serum albumin (BSA) / Tween wash buffer. Phage bound to CD81 were eluted for 10 minutes using a low-pH elution buffer (0.1 N HCl, 1 mg / mL BSA, adjusted to pH 2.2 with glycine). The elution buffer was immediately neutralized with 1 M Tris-HCl (pH 8.8). The eluate from the first round of elution was concentrated using a Centricon 100 kDa ultrafiltration device (Merck Millipore, Germany). The concentrated eluate was then transferred to E. coli culture medium and incubated at 37°C with constant shaking for 24 hours. Phage clones that internalized the CD81 protein were recovered using cell lysis buffer (2% sodium dodecyl sulfate, 10 mM Tris-HCl, 2 mM EDTA, pH 8.0). The cells were centrifuged at 130 g for 10 minutes, the supernatant removed, and cell lysis buffer added. The phage were then amplified and further screened, similar to the first round of screening described above. After the third round of screening, the eluted phage were titered, and 40 clones were randomly selected for sequencing to determine the sequence of the CD81-binding peptide.
[0060] 2. Affinity Verification
[0061] The binding capacity and specificity of the selected phages to CD81 were determined by enzyme-linked immunosorbent assay (ELISA). 150 μL of 100 μg / mL CD81 (dissolved in 0.1 M NaHCO3, pH 8.6) was prepared and coated on a 96-well plate, then incubated at 4°C with gentle shaking for 30 minutes, followed by overnight incubation at 4°C. Subsequently, 2×10 9 CFU-purified phage were incubated in blocking buffer at room temperature for 1 hour. The plates were then washed three times with PBS containing 0.5% Tween 20 and then three more times with PBS. The plates were then incubated with alkaline phosphatase-conjugated anti-FD phage IgG (Abcam, MA, USA) at room temperature for 1 hour. After washing, the substrate p-nitrophenol phosphate was added to the wells, and the absorbance was measured at 405 nm using a plate reader.
[0062] 3. Plasmid synthesis and transfection
[0063] Using the pcDNA3.1 plasmid as a template, KpnI and XbaI restriction endonuclease sites were designed at both ends of the P15-Flag-RHOT1 and RHOT1-Flag-P15 sequences. Recombinant plasmids, designated pcDNA3.1-RHOT1-P15-C (i.e., pcDNA3.1-RHOT1-Flag-P15) and pcDNA3.1-RHOT1-P15-N (i.e., pcDNA3.1-P15-Flag-RHOT1), were constructed and named pcDNA3.1-RHOT1-P15-N (i.e., pcDNA3.1-P15-Flag-RHOT1). HepG2 cells were evenly seeded in 6-well plates and cultured to a cell density of 30%–50%. In a 1.5 mL centrifuge tube, 200 μL of serum-free medium and 3 μg of plasmid were added. In another centrifuge tube, 200 μL of serum-free medium and 6 μL of transfect-mate were mixed. Transfection was performed using Lipofectamine 2000 at room temperature for 5 minutes. The contents of the two tubes were then combined and the reaction continued for 20 minutes. The transfection complex was added to a pre-laid 6-well plate containing 2 mL of serum-free medium and shaken. The cells were cultured in a cell culture incubator for 5 hours, then replaced with complete medium. After 48 hours of continuous culture, the cells were collected and used for subsequent experiments. The cells transfected with pcDNA3.1-RHOT1-P15-N were named N + The cells transfected with pcDNA3.1-RHOT1-P15-C were named C + (Same as the subsequent HepG2-RHOT1).
[0064] 4. Co-immunoprecipitation (Co-IP)
[0065] Transfected cells were lysed, proteins were extracted, and incubated with the primary antibody (anti-Flag) overnight at 4°C. Incubation was continued for 4 hours at 4°C according to the manufacturer's instructions (Invitrogen, Carlsbad, CA, USA). After immunoprecipitation, the beads were washed three times with 1× phosphate-buffered saline (PBS). Proteins were then eluted from the beads with 40 μL of elution buffer and used for immunoblotting. Samples were supplemented with sample buffer containing 5% β-mercaptoethanol and heated at 55°C for 15 minutes. Binding to the target protein was then detected by western blotting. The target proteins tested were RHOT1 (diluted 1:1000 in TBST buffer), CD81 (diluted 1:1000 in TBST buffer), and Flag (diluted 1:1000 in TBST buffer).
[0066] 5. Exosome Extraction
[0067] After incubating HepG2-RHOT1 and HepG2 cells in exosome-free medium for 48 hours, the culture supernatants were collected. First, the samples were centrifuged at 300 g for 10 minutes, followed by ultracentrifugation at 2000 g for 10 minutes. Next, ultracentrifugation was performed at 10,000 g for 30 minutes. The resulting cell pellet, membranes, and debris were discarded, and the supernatant was filtered through a Merck Millipore 0.22 μm filter. Finally, exosomes were isolated by ultracentrifugation at 120,000 g for 90 minutes. These exosomes were then resuspended in PBS and washed at 120,000 g for 90 minutes. Exosomes extracted from normal HepG2 cells were designated Exo, while exosomes extracted from plasmid-transfected HepG2-RHOT1 cells were designated RHOT1-Exo.
[0068] 6. ELISA detection of mitochondrial internalization
[0069] High-glucose-induced HepG2 cells (serving as target cells) were seeded into culture dishes and cultured to an appropriate confluence (70%-90%) to ensure optimal cell growth and exosome uptake during co-culture. Exosomes extracted from the engineered N+ and C+ cells were added to the high-glucose-induced HepG2 cell culture system, respectively. Co-culture was performed in a cell culture incubator. After co-culture, the transfected cells (N+ and C+ engineered cells) and target cells (high-glucose-HepG2 cells) were harvested. Mitochondrial proteins were extracted from both transfected and target cells using a mitochondrial extraction kit. Proteins were then extracted from the transfected cells, exosomes, and target cells.
[0070] The Flag and RHOT1 protein levels in each sample were determined using the Flag and RHOT1 ELISA kit instructions. The absorbance of the ELISA plate was read using a microplate reader, and the concentrations of Flag and RHOT1 in each sample were calculated based on the standard curve.
[0071] 7. Western Blot
[0072] (1) After one cell passage, Western Blot analysis was performed, and some protein lysates were extracted from the cells for Western Blot analysis. First, the cells were washed with pre-cooled PBS at 4°C for 1 minute each time, and a total of 3 times to ensure the complete removal of residual liquid. Then, lysis buffer was prepared according to the ratio of 1 mL RIPA plus 10 μL PMSF (100 mM), and the mixture was shaken and placed on ice. Subsequently, 400 μL of lysis buffer was added to each bottle of cells and lysed on ice for 30 minutes, with the culture bottle shaken intermittently during the period to promote sufficient cell reaction. After the lysis was completed, the cells were quickly scraped to the side of the culture bottle on ice using a cell scraper, and the cell fragments and lysate were transferred to a 1.5 mL EP tube using a pipette. Then, these EP tubes were centrifuged at 8000 g for 10 minutes at 4°C. After centrifugation, the supernatant was taken and stored at -20°C for subsequent detection.
[0073] (2) Subsequently, the BCA protein concentration was determined. First, BSA was dissolved in PBS to prepare a series of standard concentrations, including 5, 2.5, 1, 0.5, 0.25, 0.125, 0.05, and 0.025 mg / mL. Then, 20 μL of each concentration of standard and total protein sample were taken and added to a 96-well plate. Two replicate wells were set for each standard and sample. Next, the A solution and B solution of the BCA kit were mixed in a volume ratio of 50:1 to form a working solution. After adding 200 μL of the working solution to each well, the 96-well plate was placed in a 37°C incubator and incubated for 30 minutes. Finally, the OD value at a wavelength of 562 nm was read using a microplate reader, and a standard curve was drawn based on the OD value and concentration of the standard to obtain the protein concentration of the total protein sample.
[0074] (3) Next, an SDS-PAGE gel was prepared, consisting of a 15% separation gel and a 5% stacking gel. First, the separation gel was injected into the gap between the glass plates to a depth of 1.5 cm from the upper edge, and an appropriate amount of 75% ethanol was added to the upper layer. After the separation gel solidified, the upper layer of ethanol was poured out and the stacking gel was injected. Then, a comb was inserted and allowed to dry naturally.
[0075] (4) Before electrophoresis, heat the total protein sample in a 95°C water bath for 5 minutes and mix with the protein loading buffer. Then, pour the electrophoresis buffer into the electrophoresis tank and add 10 μL of protein maker to the lanes on both sides, and add 15 μL of sample to each lane. During the electrophoresis process, first use 90 V voltage for 30 minutes in the stacking gel stage, and then use 160 V voltage for electrophoresis in the separation gel stage until the bromophenol blue runs to the bottom of the gel.
[0076] (5) After electrophoresis, transfer was performed. First, filter paper of appropriate size and 0.22 μm PVDF membrane were cut and the PVDF membrane was activated with methanol for 1 minute. Then, the transfer clamp was assembled in the order of "sponge-filter paper-gel-PVDF membrane-filter paper-sponge", and it was ensured that there were no bubbles. After assembly, the transfer clamp was inserted into the transfer tank and the transfer solution was poured in. Under ice bath conditions, the transfer operation was performed at a constant current of 200 mA for 60 minutes.
[0077] (6) After the transfer, the antibody incubation was performed. First, the membrane was washed with TBST solution for 5 minutes and blocked with 5% skim milk powder (prepared with PBS solution) at room temperature for 1 hour. Subsequently, the membrane was washed with TBST solution 3 times, each time for 5 minutes. Next, the primary antibody diluted with primary antibody diluent was added and incubated overnight at 4°C. The next day, the membrane was washed with TBST solution 3 times, each time for 5 minutes, and then the secondary antibody diluted with secondary antibody diluent was added and incubated on a shaker at room temperature for 1 hour. Finally, the membrane was washed with TBST solution again 3 times, each time for 5 minutes.
[0078] (7) Finally, luminescence detection was performed. After adding ECL luminescence solution and incubating for 3 minutes, exposure imaging was performed. Finally, the grayscale values of the internal reference gene and the target gene were determined using ImageJ software, thus completing the entire Western Blot detection process.
[0079] According to the recommendations of the "Exosome Information Standards (MISEV2018)", the present invention uses Western Blot to detect exosome positive markers RHOT1, CD9, and ALIX, and the corresponding antibodies used are diluted at ratios of 1:1000, 1:500, and 1:1000, respectively.
[0080] 8. Nanoparticle Tracking Analysis
[0081] Nanoparticle tracking analysis (NTA) was performed using a ZetaView PMX 110 (Particle Metrix) and its software (ZetaView 8.02.28). Exosomes were diluted in particle-free PBS and placed in the sample chamber. Size and concentration were then measured at a wavelength of 405 nm, and the exosome size was quantified and recorded.
[0082] 9. Transmission Electron Microscopy
[0083] 10 μL of exosome sample was dropped onto a copper grid and incubated at room temperature for 10 minutes. The sample was then negatively stained with 2% uranyl acetate and allowed to dry on the edge of the filter paper. The prepared sample was imaged using an H-7650 transmission electron microscope (Hitachi) at 80 kV. Mitochondria were detected using the same method as described above.
[0084] 10. Statistical analysis
[0085] Continuous variables are expressed as mean ± standard deviation. Statistical analyses were performed using GraphPad Prism 10.0. Comparisons between groups were analyzed using independent sample t-tests or one-way ANOVA. Differences were considered statistically significant when p < 0.05.
[0086] 2. Experimental Results
[0087] 1. Four peptide sequences were screened from a 15-peptide phage peptide library, which were able to produce affinity with CD81 recombinant protein. The peptide sequences and binding frequencies are shown in Table 3. After phage ELISA detection, the peptide with the sequence GCSMMKYCATCAGCM had stronger binding ability. Figure 1 This polypeptide sequence was named P15.
[0088] Table 3 Phage screened peptide sequences and peptide binding frequencies to CD81
[0089] Peptide sequence Peptide binding frequency GCSMMKYCATCAGCM (SEQ ID No.1) 29 GCMMTKYASCLCMPA (SEQ ID No.2) 20 AGTCYASMCMKCMGA (SEQ ID No.3) 15 GCMSCASMTCMKYPG (SEQ ID No.4) 6
[0090] 2. After confirming that P15 can bind to CD81, the P15 sequence, Flag tag, and RHOT1 protein coding sequence were connected to the recombinant plasmid, and the RHOT1-P15 recombinant protein was expressed in cells to allow the protein to bind to CD81 in a targeted manner. Since previous studies have not reported whether the RHOT1-linked polypeptide has an effect on its protein structure, it is planned to connect Flag and P15 from the end of the protein sequence, but it is not certain whether to connect to the N-terminus or C-terminus of RHOT1. Therefore, these two connection methods were studied. P15 connected to the N-terminus of RHOT1 is named N + Group, connected to the C end is named C + Group, such as Figure 2 shown.
[0091] 3. After constructing the above recombinant plasmid and transfecting HepG2 cells, the protein-protein interaction in the cells was detected by Co-IP. The results are as follows Figure 3 As shown in the figure, there is no Flag band in the untransfected cells (HepG2 group), and the RHOT1 content is significantly less than that in the N + and C +The reason is that the RHOT1-P15 with Flag was overexpressed after plasmid transfection. After separation using Flag magnetic beads, the 104kDa RHOT1-CD81 complex was found in N + and C + The results indicate that P15 can bind to CD81 no matter which end of RHOT1 it is connected to, which clarifies the polypeptide role of P15.
[0092] 4. In order to clarify N + and C + The content of RHOT1 in transfected cells (engineered gene cells), exosomes (engineered exosomes), and target cells (target cells) was analyzed. + and C + Exosomes were extracted from the cells of the target group, and the exosomes were co-cultured with HepG2 cells induced by high glucose, and the mitochondria of the transfected cells and target cells were extracted. The ELISA results of Flag and RHOT1 are shown in Figure 2. Figure 4 As shown: In the transfected cells, there was no significant difference in the total Flag content between the two groups. + The Flag in the mitochondria of group A was slightly higher than that of group B + groups, but there was no statistically significant difference ( Figure 4 In exosomes, the levels of Flag and RHOT1 were not statistically different ( Figure 4 B in the target cell). However, in the target cell, C + The number of Flag in group mitochondria was significantly higher than that in group N + group, indicating that RHOT1-P15 molecules in exosomes enter mitochondria in large quantities ( Figure 4 The above results suggest that C-terminal connection of P15 peptide may promote the translocation of RHOT1 to mitochondria in target cells, so theoretically C + group is more conducive to mitochondrial targeted therapy.
[0093] 5. In subsequent experiments, the recombinant plasmid pcDNA3.1-RHOT1-P15-C with P15 linked to the C-terminus will be used. Under transmission electron microscopy, exosomes exhibit vesicle-like structures, and double-layer membrane structures can be seen in some fields of view, such as Figure 5 As shown in A. The level of cell secretion of exosomes was detected by BCA method, and the results were as shown in Figure 5 As shown in Figure B, in a T25 culture flask with a cell density of 80%, 38.46±4.13 μg of Exo can be isolated per 1 mL of culture medium, while the yield of RHOT1-Exo is 36.35±6.89 μg / mL, with no significant statistical difference between the two. Figure 5As shown in Figure C, the particle size range of Exo and RHOT1-Exo is 60~200 nm, and there is no significant difference in the particle size concentration between the two. The markers contained in the exosomes were detected by Western blot. The results are as follows Figure 5 As shown in Figure D, in HepG2 and HepG2-RHOT1 cells, the expression levels of cell-related markers CD9 and ALIX were lower, while the expression level of housekeeping protein (GAPDH) was higher, compared with Exo and RHOT1-Exo. This is because at a unit concentration, exosomes contain more related markers (CD9 and ALIX), while exosomes basically do not contain housekeeping protein (GAPDH). RHOT1 protein in HepG2-RHOT1 cells was affected by plasmid overexpression and was 39.25% higher than that in HepG2 cells. In exosomes, the RHOT1 content in RHOT1-Exo exosomes was 12.5 times that of Exo ( Figure 5 This result indicates that the peptide P15-based strategy has successfully constructed RHOT1-enriched engineered exosomes.
[0094] Example 2 In vitro study of RHOT1-Exo improving the high glucose-induced insulin resistance model in HepG2 cells
[0095] 1. Experimental Methods
[0096] 1. Establishment of cell model
[0097] HepG2 cells were plated at a density of 5×10³ / mL in 96-well culture plates. After adding DMEM complete medium supplemented with 10% fetal bovine serum, the cells were transferred to a constant temperature incubator containing 5% CO2 for routine culture. After the cells were fully attached, they were gently rinsed three times with pre-cooled PBS buffer to remove the residual culture medium. Subsequently, serum-free and antibiotic-free DMEM basal culture medium was used to prepare a gradient of 0, 5, 20, 35 and 50 mmol / L hypertonic glucose treatment solutions (the specific concentration was adjusted according to the experimental design). Each concentration of treatment solution was pipetted into the corresponding well and incubated for 24 hours. The relative cell viability was determined using a CCK-8 kit to screen the optimal treatment concentration for high glucose induction. Finally, the model was verified by quantitative analysis of cellular glucose uptake. When the uptake rate of the experimental group was significantly higher than that of the blank control group (p<0.05), the insulin resistance cell model was determined to be successfully constructed. The cells with successful model construction were cultured at a density of 2.0×10 6 cells / 100 mm 2 The cells were seeded in culture dishes at a density of 100 μg / mL and RHOT1-Exo were added for culture.
[0098] The cell experiment was divided into three groups: HepG2 group (Control), high glucose-induced HepG2 group (high glucose-HepG2), and high glucose-induced HepG2 followed by the addition of RHOT1-Exo group (high glucose-RHOT1-Exo).
[0099] 2. Determination of cell viability
[0100] After removing the high-glucose solution inducing HepG2 cells, the cells were thoroughly washed with PBS. 10 μL of CCK-8 solution was then added to each well and incubated for 2 hours. The CCK-8 solution was then removed with a pipette. The absorbance was measured at 490 nm using a microplate reader.
[0101] 3. 2-NBDG glucose uptake determination verification model was successfully established
[0102] The cells of each group were collected by centrifugation, added to sugar-free DMEM medium and cultured for 5 h, then added with 100 nM insulin and cultured for 20 min, and finally added with 50 nM 2-NBDG and incubated for 30 min. The cells were washed with PBS to terminate the reaction, and the fluorescence values were measured at 475 and 550 nm using a fluorescence microplate reader.
[0103] 4. Antioxidant enzymes, ROS detection and mtDNA detection
[0104] RHOT1-Exo exosomes were added to high glucose-induced HepG2 cells at a final concentration of 1 mg / mL. The SOD1, SOD2, and CAT activities of each group of cells were determined according to the kit instructions (Dojindo Molecular Technology Inc.). The production of intracellular ROS was quantified using the cell-permeable, oxidation-sensitive fluorescent probe CM-H2DCFDA (Molecular Probes). Each group of cells was cultured at 2.5 × 10 5 Cells were seeded into six-well plates in complete culture medium at a density of 100 cells / mL and pretreated with DMEM containing 1 μM CM-H2DCFDA for 30 minutes at 37°C. Cells were harvested, washed twice with DMEM, resuspended in DMEM, and analyzed on a FACSCalibur flow cytometer (BD Biosciences). Cells were cultured in 11 cm 2 Cells were plated in normal culture medium (BD Biosciences) and treated with 1 μM CM-H2DCFDA for 30 minutes. The cells were washed three times in normal culture medium and analyzed using a Leica laser scanning confocal microscope at 37°C using an excitation wavelength of 488 nm and an emission wavelength of 500–540 nm.
[0105] Total cell DNA was extracted according to the kit instructions. mtDNA was amplified based on the ND1 gene encoding the ND1 subunit of NADH dehydrogenase, and nDNA was amplified based on β-actin. qPCR was performed using the LightCycler 480 II Fluorescence Quantitative PCR System. The primers used were shown in Table 4, the reaction system was shown in Table 5, and the reaction conditions were shown in Table 6. -△△CT The relative content of the gene was calculated, and 3 replicate wells were set up in each group to calculate the average value.
[0106] Table 4 ND1 gene qPCR primers
[0107] Target Forward primer (5'-3') Reverse primer (5'-3') ND1 TCAGGGGAGAGTGCGTCATA CCCTAAAACCGCCACATCT β-actin TCGGGAGCGTTTAGCCTTAC ATGTCTGCCAACTTCCTGGG
[0108] Table 5 PCR reaction system
[0109] Components Volume / μL SYBR® Premix Ex Taq™ II10 μM Forward primer 100.8 10 μM reverse primer 0.8 Template DNA 1.0 ddH2O Up to 20
[0110] Table 6 PCR reaction conditions
[0111] Pre-denaturation transsexual Annealing / Extension Number of cycles ND1 95°C, 1 min 95 ℃,5 s 60 ℃,25 s 40 β-actin 95°C, 1 min 95 ℃,5 s 60 ℃,25 s 40
[0112] 5. ATP level detection
[0113] Follow the ATP assay kit instructions. First, aspirate the culture medium and add 200 μL of lysis buffer to each well of a 6-well plate. After repeated pipetting, lyse the cells and centrifuge at 12,000 g for 5 minutes at 4°C. Remove the supernatant for subsequent measurement. Thaw the reagents on ice and dilute the ATP standard solution with ATP assay lysis buffer to concentrations of 0.01, 0.03, 0.1, 0.3, 1, 3, and 10 μM. Add 100 μL of ATP assay working solution to a dark-protected 96-well plate and let it stand at room temperature for 3-5 minutes to deplete background ATP and reduce background. Add 20 μL of the test solution or standard solution to each well and quickly mix. Detect chemiluminescence using a full-wavelength multi-function microplate reader using the luminometer function. Plot a standard curve and calculate the ATP content of each cell group based on the luminescence values.
[0114] 6. Fluorescence detection of mitochondrial network structure (Mito-Tracker Green fluorescent probe)
[0115] Use anhydrous DMSO to prepare Mito-Tracker Green solution into a 1 mM stock working solution and store it at -20 °C in the dark for future use. 5The cells were transferred to culture dishes at a density of 100 μg / mL and cultured in a conventional manner. After culturing for 24 h, the culture medium was removed and Mito-Tracker Green staining solution preheated to 37°C was added for incubation for 2 h. After the incubation, the staining solution was replaced with fresh culture medium and the mitochondrial network structure was observed under a laser confocal microscope.
[0116] 7. Expression detection of proteins related to the insulin signaling pathway
[0117] The expression levels of PI3K and GLUT4 proteins in each group of cells were detected according to the ELISA kit instructions.
[0118] 8. Statistical processing
[0119] Continuous variables are expressed as mean ± standard deviation. Statistical analyses were performed using GraphPad Prism 10.0. Comparisons between groups were analyzed using independent sample t-tests or one-way ANOVA. Differences were considered statistically significant when p < 0.05.
[0120] 2. Experimental Results
[0121] 1. Selection of glucose concentration
[0122] In order to determine the optimal concentration of glucose solution to induce IR in HepG2 cells, this experiment selected 0, 5, 10, 20, 35, and 50 mmol / L glucose solutions and incubated them with HepG2 cells for 24 h, and the cell survival rate was measured ( Figure 6 As glucose concentrations increased within the 0–50 mmol / L range, HepG2 cell viability decreased. When glucose concentrations exceeded 35 mmol / L, cell survival was significantly reduced. Therefore, a 24-hour treatment with 35 mmol / L glucose solution was selected as the protocol for establishing an insulin resistance model.
[0123] 2. Glucose uptake by model cells
[0124] Insulin resistance in cells will directly manifest as abnormal glucose uptake. Therefore, we used the 2-NBDG method to detect glucose uptake in HepG2 cells. Compared with the normal HepG2 cell group, the glucose uptake in the high glucose-induced HepG2 group was significantly reduced ( Figure 7 ), indicating that the insulin resistance model of HepG2 cells was successfully established. The introduction of RHOT1-Exo reversed this change, with glucose uptake significantly increasing in the high-glucose-RHOT1-Exo group. This suggests that the RHOT1 protein in RHOT1-Exo exosomes can improve insulin sensitivity in insulin-resistant cells.
[0125] 3. RHOT1-Exo activates antioxidant enzymes, reduces ROS levels and increases mtDN content
[0126] In order to study the effect of RHOT1-Exo on the antioxidant activity of mammalian cell mitochondria, HepG2 cells were first treated with high glucose to establish an insulin resistance cell model, and then RHOT1-Exo was added to the model cell culture. Figure 8 As shown in Figure 2, after RHOT1-Exo treatment, the activities of antioxidant enzymes SOD1, SOD2, and CAT in the high glucose-RHOT1-Exo group were significantly increased compared with the high glucose-HepG2 group ( Figure 8 A in the figure); CM-H2DCFDA probe staining was used to detect cell ROS, and the quantitative analysis graph showed that ROS in the high glucose-RHOT1-Exo group was significantly reduced ( Figure 8 Therefore, our data suggest that RHOT1-Exo can clear ROS in insulin-resistant cells by upregulating the expression of antioxidant enzymes.
[0127] Intracellular mtDNA is also susceptible to ROS attack and damage, so we used qPCR to detect the mtDNA content in each group of cells. Compared with the insulin resistance model cells, after DRP1-Exo treatment, the mtDNA content increased significantly ( Figure 8 D). This indicates that RHOT1-enriched exosomes can increase the mtDNA content in insulin resistance model cells and help restore mitochondrial dysfunction.
[0128] 4. RHOT1-Exo promotes oxidative phosphorylation and increases ATP content
[0129] Due to mitochondrial dysfunction, the oxidative phosphorylation pathway of cells is impaired, the glycolysis pathway of cells is enhanced, and the ATP content decreases accordingly. Therefore, we studied whether RHOT1-Exo increases oxidative phosphorylation and increases ATP content. To this end, RHOT1-Exo was transferred into insulin-resistant cells. ATP levels in cells were measured using an ATP kit. The results are shown in Figure 2. Figure 9 As shown, the ATP level in insulin-resistant cells was significantly increased after co-culture with RHOT1-Exo, indicating that RHOT1-Exo enhanced cellular oxidative phosphorylation, increased the ATP content in insulin-resistant cells, and helped to improve insulin resistance.
[0130] 5. RHOT1-Exo improves mitochondrial network structure
[0131] Mitochondrial dysfunction can lead to the destruction of mitochondrial network structure, and the mitochondrial morphology usually changes from an elongated tubular structure to a fragmented spherical structure. After we performed Mito-Tracker Green fluorescence staining on each group of cells, we observed the following under a fluorescence microscope: Figure 10 As shown in A, the mitochondria of HepG2 cells induced by high glucose were fragmented and the structure was incomplete. However, when RHOT1-Exo was transferred into high glucose-HepG2 cells, it was found that the mitochondria were interconnected and showed a network shape, as shown in Figure 1. Figure 10 As shown in Figure B, RHOT1-Exo can significantly improve the mitochondrial network of insulin-resistant cells and restore mitochondrial dysfunction. The present invention successfully achieves the use of RHOT1 protein in the form of exosomes to improve the mitochondrial network structure of insulin-resistant cells.
[0132] 6. Expression of proteins related to the insulin signaling pathway
[0133] Damage to the insulin signaling pathway can lead to IR, which can be manifested as a decrease in the expression of insulin signaling-related proteins. To further explore whether exosomes enriched with RHOT1 protein can improve the IR state of HepG2 cells, we tested the expression of proteins related to insulin signaling in each group of HepG2 cells. The results showed that compared with HepG2 insulin-resistant cells in a high-glucose environment, after RHOT1-Exo treatment, the PI3K protein level and the GLUT4 protein content on the plasma membrane were significantly increased ( Figure 11 This indicates that in insulin-resistant cells, proteins whose expression levels were previously reduced due to impaired insulin signaling are now increased by exosomes enriched with RHOT1 protein. This demonstrates that exosomes enriched with RHOT1 protein can enhance the activity of proteins involved in the insulin signaling pathway, increasing the sensitivity of IR model cells to insulin and potentially providing therapeutic applications in the treatment of insulin resistance.
Claims
1. An engineered exosome enriched with RHOT1, characterized in that: The method for preparing the engineered exosomes enriched in RHOT1 is to connect the gene encoding the polypeptide P15 whose amino acid sequence is shown in SEQ ID No. 1 to the 3' end or 5' end of the RHOT1 protein encoding gene to obtain a chimeric gene, then construct a recombinant plasmid expressing the chimeric gene, and then transfect the recombinant plasmid into cells for expression, and extract exosomes to obtain the obtained exosomes.
2. The engineered exosomes enriched with RHOT1 according to claim 1, characterized in that The coding gene of the polypeptide P15 is connected to the 3' end of the coding gene of the RHOT1 protein.
3. The engineered exosomes enriched with RHOT1 according to claim 1, characterized in that The coding gene of the polypeptide P15 is connected to the coding gene of the RHOT1 protein via a Flag tag.
4. The engineered exosomes enriched with RHOT1 according to claim 1, characterized in that The amino acid sequence of the polypeptide P15 is shown in SEQ ID No.
1.
5. The engineered exosomes enriched with RHOT1 according to claim 1, characterized in that The template plasmid used in the recombinant plasmid is pcDNA3.
1.
6. Use of the engineered exocrine enriched in RHOT1 according to any one of claims 1 to 5 in the preparation of a drug for improving insulin resistance.
7. The application according to claim 6, characterized in that The drug promotes mitochondrial oxidative phosphorylation in the subject's cells, regulates the activity of mitochondrial antioxidant enzymes, and clears ROS, thereby increasing ATP and mtDNA content, enhancing mitochondrial network generation and restoring mitochondrial function, increasing the expression of proteins related to the insulin signaling pathway, and improving insulin resistance, thereby achieving application in drugs for treating insulin resistance.
Citation Information
Patent Citations
Construction of engineered fat exosome for targeted central delivery of siRNA to improve insulin resistance of diabetes
CN113082042A
Low-immunogenicity targeted vesicle delivery system as well as preparation method and application thereof
CN117919197A