A molecular marker associated with the sixth dorsal plate length of honey bees
By screening SNP sites related to the length of the sixth dorsal plate of honeybees through genome sequencing and GWAS analysis, molecular markers were developed and PCR amplification was performed to detect them. This solved the problem of inaccuracy in measuring the length of the sixth dorsal plate of honeybees and enabled efficient and accurate honeybee breeding.
Patent Information
- Application Number
- CN202510202864.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-24
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2045-02-24
AI Technical Summary
In existing technologies, the morphological measurement methods for the length of the sixth dorsal plate of honeybees are greatly affected by external factors during the development process, and the measurement accuracy and standards are not uniform, resulting in large human errors and making it difficult to achieve effective identification through first-generation sequencing.
By using genome sequencing and GWAS analysis, SNP sites associated with the length of the sixth dorsal plate of honeybees were screened, molecular markers associated with the length of the sixth dorsal plate of honeybees were developed, and PCR amplification and fluorescence detection were performed using primer pairs to achieve the detection of molecular marker polymorphism.
It enables efficient and accurate identification of the sixth dorsal plate length trait in bees, reduces human error, simplifies the measurement process, and allows for the selection of bee varieties with high honey-collecting ability based on the test results.
Smart Images

Figure CN120158514B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of animal breeding technology, and particularly relates to a molecular marker related to the length of the sixth notum of honeybee. BACKGROUND
[0002] The Chinese honeybee (Apis cerana cerana) has formed a rich local resource type (ecotype) in diverse geographical environments, showing different morphological characteristics, biological properties and production performance. Apis cerana Effective evaluation of the morphological traits of the Chinese honeybee is an important means of tapping, protecting, identifying and utilizing bee species resources, and is also a necessary method for evaluating the performance of bee species in bee production.
[0003] Traditional and classic methods of bee species identification and performance evaluation focus on morphological markers. Although morphological markers have the advantages of low cost and simple operation, they have inherent shortcomings and are not suitable for the Chinese honeybee. First, morphological markers are directly related to the individual development of honeybees and are easily affected by external interference factors such as nutritional conditions during development. Second, morphological measurement of the Chinese honeybee is precise, and strict requirements are placed on the precision of the measuring instrument and the proficiency of the person measuring the morphology. Moreover, the workload of honeybee morphological measurement is huge, and the operability is not strong. Finally, the morphological measurement standards of the Chinese honeybee are not unified, and there are serious human errors between measurement personnel, which seriously affect the result interpretation. The length of the sixth notum is one of the important morphological traits of honeybees. The sixth notum is located in the abdomen of the honeybee, and the honey storage sac is also located in the abdomen of the honeybee. The length of the sixth notum indirectly reflects the honey collecting ability of the honeybee. Therefore, developing a molecular marker related to the length of the sixth notum is beneficial to the breeding of high-quality honeybee species.
[0004] First-generation sequencing molecular means technology is mature and simple to operate. At present, the market environment can quickly realize the sequencing of the target gene fragment, and the cost is low and not easily subject to technical limitations. Through genome sequencing and GWAS analysis of the length of the sixth notum of the Chinese honeybee, the SNP site associated with the length of the sixth notum of the Chinese honeybee can be found out, which can replace the complex length measurement of the sixth notum and realize the identification of the length of the sixth notum of the Chinese honeybee by first-generation sequencing. However, the SNP site associated with the length of the sixth notum of the Chinese honeybee is not clear at present, and the length of the sixth notum of the Chinese honeybee cannot be identified by simple first-generation sequencing. SUMMARY
[0005] In order to solve the problems existing in the prior art, the present application provides a molecular marker related to the length of the sixth notum of honeybee.
[0006] In a first aspect, the present application provides a molecular marker related to the length of the sixth notum of honeybee, wherein the molecular marker comprises a nucleotide sequence as shown in SEQ ID NO. 1, and the 301th position of the nucleotide sequence is a polymorphic site, and the polymorphism is A or G.
[0007] a nucleotide sequence as shown in SEQ ID NO. 1:
[0008] TCATTATAGTTTAAGATTCAATAATAAGGATTTTTTGTAACAATTGTTTGAGTTCTCGCCTCTCTATTAAAATAAAAAAATTTTATTATAAACTAATTCTTAGAATATTATTCCTAGAAGAAATATTACCGTAACATTGTTGCTCCAATGAGTATCATTGTCAATTGCTCATTTAATCATGAATGATTCAACACTAGCTGCTGCTCGCAAAAAATATGCAAATGTAGAAACGATCTTCATTCCTGTATCAAGCAAATTATTTAGTAAAATATTTTGAAAAAAAAAGATATTGAATAAATAATTTTATCATACATTCATTCATTAAAAATTTTTATGCTGTCCATTTAACTGCGATAATTTATAATCACATTAAGTATAACGCATTGTTATATTATAACAAATATATATCAATCAATTTTATATGCGAGAAAATGACATTTCGATCGTTAATTTTATTGTGCGCATTTTGATCGTTTCCAGTGCTAAGAAAGTGAAAGTGGTAAACATATGAATATAAACGATATCTAGTTTGTATGAACCGATTCAATTCGATTTTTTTTTATCATGAACATCATGTATATTTTCACATTCTCGCACATTT.
[0009] In a second aspect, the present application provides a primer pair for amplifying the molecular marker, comprising the following nucleotide sequences:
[0010] F1: 5'-TGAAAAAAAAAGATATTGAATAAATAA-3',
[0011] F2: 5'-TGAAAAAAAAAGATATTGAATAAATAG-3',
[0012] R: 5'-TGGACAGCATAAAAATTTTTAATGAATGA-3'.
[0013] Further, the F1 and F2 respectively carry different fluorescent markers (also referred to as fluorescent tags), which include one or more of FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC, or Texas Red.
[0014] For example, F1 is connected with GAAGGTGACCAAGTTCATGCT (FAM) at 5', and F2 is connected with GAAGGTCGGAGTCAACGGATT (HEX) at 5'.
[0015] In a third aspect, the present application provides a kit comprising the molecular marker or the primer pair.
[0016] In a fourth aspect, the present application provides an application of the molecular marker or the primer pair or the kit in identifying the sixth sternum length trait of honeybees.
[0017] The present application further provides an application of the molecular marker or the primer pair or the kit in breeding honeybees with high honey-collecting ability, improving the germplasm resources of honeybees, or molecular marker-assisted breeding of honeybees.
[0018] Further, the application includes:
[0019] For a honeybee to be tested, the polymorphism of the aforementioned molecular marker is detected, and the sixth sternum length trait of the honeybee to be tested is determined according to the detection result.
[0020] Further, the detection includes one or more of gene sequencing, PCR, or probe detection.
[0021] Further, the determination of the sixth sternum length trait of the honeybee to be tested according to the detection result includes:
[0022] The honeybee with the detection result of A / A has a shorter sixth sternum length compared to the honeybee with the detection result of A / G.
[0023] The sixth sternum length is one of the important morphological traits of honeybees. The sixth sternum is located on the abdomen of the honeybee, and the honey sac, which is the most important internal organ of the honeybee for collecting honey, is located on the abdomen of the honeybee. The sixth sternum length indirectly reflects the extensibility of the honey sac when storing honey, and can reflect the honey-collecting ability of the honeybee to a certain extent.
[0024] The present application has the following beneficial effects:
[0025] The present application is based on the sixth tergite length data obtained by sequencing the Apis cerana genome, a SNP site is screened by genome data association analysis, and a corresponding molecular marker is provided. The molecular marker is related to the sixth tergite length of the honeybee, and the detection result of the polymorphism can reflect the sixth tergite length of the honeybee, which is of great significance for detecting the honey collecting ability of the honeybee. BRIEF DESCRIPTION OF DRAWINGS
[0026] In order to more clearly illustrate the technical solutions in the present application or prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced as follows. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.
[0027] Figure 1 is the sixth tergite length trait comparison result of the honeybees with different genotypes of SNP site Chr7_5649194 provided by embodiment 1 of the present application. DETAILED DESCRIPTION
[0028] In order to make the purpose, technical solutions and advantages of the present application clearer, the technical solutions in the present application will be described clearly and completely in combination with the drawings in the present application. Obviously, the described embodiments are some embodiments of the present application, not all embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application.
[0029] The experimental methods involved in the following embodiments can be realized by using conventional experimental methods in the art if not particularly limited, for example, can refer to experimental manuals in the art or refer to manufacturer's instructions.
[0030] The experimental materials and reagents involved in the following embodiments can be commercially available if not particularly limited.
[0031] Embodiment 1
[0032] The present application provides a screened SNP site (Chr7_5649194), and the screening process is as follows:
[0033] 1. The application is based on 110 Chinese honeybee samples, and the length of the sixth notum is detected. After the above dissection of the worker bee, the worker bee thoracic tissue genomic DNA is extracted, and then the Truseq Nano DNA HT kit (Illumina, USA) is used to construct the library. The DNA is randomly broken into 350 bp fragments, and after end repair, poly A tail addition, sequencing adapter addition, amplification, purification and other steps, the DNA library is obtained, the insert size of the library is detected by Agilent 2100, and the effective concentration of the library is accurately quantified by qPCR method, and the DNA library construction is completed after the quality is up to standard.
[0034] 2. Genomic sequencing, alignment and SNP identification: After successful construction of the sample library, the sample library is sequenced based on the Illumina HiseqPE150 platform (Illumina, USA). In the sequencing process, low-quality reads are deleted to ensure the quality of the results [quality control standards: delete reads containing more than 10% unknown nucleotides, delete reads containing adapter sequences, delete reads with low-quality (phred quality <5) base content more than 50% of the length], and finally a single honeybee sample generates more than 4.5G high-quality paired-end clean reads, Q20, Q30 is more than 90%, 85% respectively.
[0035] 3. The obtained high-quality paired-end clean reads are aligned to the reference genome Apis cerana (Genbank accession number: PRJNA738447) by BWA 0.7.8 software. The alignment results are removed by SAMTOOLS 1.15 software, and the average alignment rate of the population sample is guaranteed to be more than 95%, and the average sequencing depth of the genome is more than 20X.
[0036] 4. The Bayesian model in SAMTOOLS 1.15 software is used for group SNP detection, and high-quality SNPs are screened out according to the quality control standards [delete SNPs with sequencing error rate >1% (Q20 quality control), delete SNPs with adjacent SNP site interval base number <5, delete SNPs with coverage depth exceeding average depth 1 / 3~5 times]. The detected SNPs are annotated by using ANNOVAR 20130520 software, and the exon region, intron region, alternative splicing site, upstream and downstream region of gene, intergenic region, synonymous mutation SNP and non-synonymous mutation SNP are identified.
[0037] 5、genome-wide association studies: genome-wide association studies (GWAS) were carried out based on mrMLM 1.3 software to determine the association between the sixth dorsal plate length trait and SNP sites, and the SNP quality control standard was referred to MAF>5%, and a multi-site random mixed linear model was selected.
[0038] 6、Results analysis
[0039] Table 1 Association between the sixth dorsal plate length phenotype of honeybees and SNPs
[0040]
[0041] Finally, the present application obtains a plurality of SNP sites associated with the sixth dorsal plate length trait, wherein the site Chr7_5649194 (located at position 5649194 of chromosome 7 of the honeybee, with polymorphism A / G) is more significant. Based on the site, a molecular marker is developed, which is located at position 301 of the nucleotide sequence shown in SEQ ID NO. 1, with polymorphism A / G.
[0042] Example 2
[0043] 1、The present application selects 107 Apis cerana samples to carry out verification work, verifies the effect of the SNP site involved in example 1, and specifically sequences the 107 Apis cerana, and measures the sixth dorsal plate length of the 107 honeybees by using a microscopic measurement system, to obtain the sixth dorsal plate length data and SNP data of the 107 honeybees;
[0044] According to the genotype type on the SNP site, the sixth dorsal plate length data of different groups are analyzed for significant difference by using SPSS 16.0 software, and whether there is a difference in the sixth dorsal plate length between different genotypes is compared.
[0045] The final result shows that 21 Apis cerana exhibit A / A genotype, 52 Apis cerana exhibit G / G genotype, and 34 Apis cerana exhibit A / G genotype, and through LSD, Duncan data analysis, A / A genotype and A / G genotype exhibit significant difference (P<0.05), as shown in Table 2 and Table 3, wherein the sixth dorsal plate length of A / A genotype is significantly lower than that of A / G genotype. P <0.05), as Figure 1 , Table 2 and Table 3.
[0046] Table 2 Comparison of sixth dorsal plate length of Apis cerana individuals with different genotypes at Chr7_5649194 site
[0047]
[0048] * indicates P <0.05, significant difference.
[0049] Comparison of the sixth tergite length of individuals with different genotypes of the Apis mellifera Chr7_5649194 locus in Table 3
[0050]
[0051] It can be seen that the molecular marker provided by the application can identify the genotype of the Apis mellifera locus as A / A, A / G or G / G through gene sequencing, and according to the identification result, it can be determined whether the sixth tergite of the Apis mellifera is long or short. Based on this feature, in actual Apis mellifera breeding, Apis mellifera with a specific length of the sixth tergite can be bred, and Apis mellifera with high honey harvesting efficiency can be bred.
[0052] 2. The application further provides a KASP primer pair for the SNP locus, comprising:
[0053] F1: 5'-TGAAAAAAAAAGATATTGAATAAATAA-3',
[0054] F2: 5'-TGAAAAAAAAAGATATTGAATAAATAG-3',
[0055] R: 5'-TGGACAGCATAAAAATTTTTAATGAATGA-3'.
[0056] F1 is connected with GAAGGTGACCAAGTTCATGCT (FAM) at 5', and F2 is connected with GAAGGTCGGAGTCAACGGATT (HEX) at 5'.
[0057] The primer pair is labeled with a fluorescent dye before actual detection, and then PCR amplification and fluorescence detection are performed, and the fluorescence level detection results of the FAM and HEX fluorescence channels can be used to determine the polymorphism of the SNP locus.
[0058] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the application, and not to limit them; although the application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the application.
Claims
1. Use of a molecular marker, or a primer pair for detecting the molecular marker, or a kit in identifying the sixth sternum length trait of Apis cerana; the molecular marker is a nucleotide sequence as shown in SEQ ID NO. 1, wherein the 301th position is a polymorphic site, and the polymorphism is A or G; the nucleotide sequence as shown in SEQ ID NO. 1 is: TCATTATAGTTTAAGATTCAATAATAAGGATTTTTTGTAACAATTGTTTGAGTTCTCGCCTCTCTATTAAAATAAAAAAATTTTATTATAAACTAATTCTTAGAATATTATTCCTAGAAGAAATATTACCGTAACATTGTTGCTCCAATGAGTATCATTGTCAATTGCTCATTTAATCATGAATGATTCAACACTAGCTGCTGCTCGCAAAAAATATGCAAATGTAGAAACGATCTTCATTCCTGTATCAAGCAAATTATTTAGTAAAATATTTTGAAAAAAAAAGATATTGAATAAATAATTTTATCATACATTCATTCATTAAAAATTTTTATGCTGTCCATTTAACTGCGATAATTTATAATCACATTAAGTATAACGCATTGTTATATTATAACAAATATATATCAATCAATTTTATATGCGAGAAAATGACATTTCGATCGTTAATTTTATTGTGCGCATTTTGATCGTTTCCAGTGCTAAGAAAGTGAAAGTGGTAAACATATGAATATAAACGATATCTAGTTTGTATGAACCGATTCAATTCGATTTTTTTTTATCATGAACATCATGTATATTTTCACATTCTCGCACATTT; the primer pair comprises the following nucleotide sequences: F1: 5'-TGAAAAAAAAAGATATTGAATAAATAA-3', F2: 5'-TGAAAAAAAAAGATATTGAATAAATAG-3', R: 5'-TGGACAGCATAAAAATTTTTAATGAATGA-3'; the kit comprises the primer pair.
2. Use according to claim 1, characterized in that, the use comprises: detecting the polymorphism of the molecular marker in the Apis cerana to be tested, and judging the sixth sternum length trait of the Apis cerana to be tested according to the detection result.
3. Use according to claim 2, characterized in that, the detection comprises one or more of gene sequencing, PCR or probe detection.
4. Use according to claim 2 or 3, characterized in that, the judging the sixth sternum length trait of the Apis cerana to be tested according to the detection result comprises: As described for the polymorphism of the molecular marker, the bees with the result A / A have a shorter sixth tergite length than the bees with the result A / G.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker and application thereof in identifying honeybee shin length character
CN119331981A
SNP (Single Nucleotide Polymorphism) site related to wing width character of bee and application of SNP site
CN119351565A