Effect of GK921 in preparation of drug for preventing and treating rotavirus

Abstract

The invention belongs to the technical field of biological medicine, discloses an effect of GK921 in preparation of a drug for preventing and treating rotavirus, and finds that the GK921 can significantly inhibit RV replication, and finds that the GK921 not only inhibits transcription of rotavirus, but also can reduce expression of VP6 protein compared with the prior art. Therefore, GK921 can be used for preventing or treating rotavirus.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and specifically relates to the use of GK921 in the preparation of drugs for preventing and treating rotavirus. Background Art

[0002] Rotavirus (RV) is the most common cause of viral gastroenteritis in infants, young children and animals. Rotavirus is mainly transmitted through the fecal-oral route, and infected individuals usually show symptoms such as diarrhea, vomiting and loss of appetite. This kind of infection can be transmitted between humans and animals, posing a serious threat to human health and the livestock industry. At present, all 6 RV vaccines on the market globally are oral live attenuated vaccines, and 4 of them have been pre-certified by the WHO, including RotaTeq vaccine (Merck), Rotarix vaccine (GlaxoSmithKline), Rotavac vaccine (Bharat Biotech) and Rotasiil vaccine (Serum Institute). However, these vaccines are all targeted at specific serotypes, because it is difficult to provide effective cross-protection between different serotypes, resulting in limited protection of these vaccines. At present, there is no drug for rotavirus in clinical practice. Therefore, the development of a new antiviral drug is of great significance for the control and treatment of rotavirus.

[0003] The chemical name of GK921 is N-(4-cyanophenyl)-N-(4-methoxyphenyl)urea, its molecular formula is C21H20N4O, the molecular weight is 344.41, and the CAS number is 1025015-40-0. GK921 is an effective TGase2 inhibitor, which can specifically inhibit the activity of TGase2 and has oral activity. It effectively inhibits TG2-mediated I-KBα and p53 polymerization, induces growth arrest / cell death in renal cell carcinoma (RCC) cultures, eliminates RCC in mice, and increases the level of p53.

[0004] At present, the development of new drugs for preventing and treating rotavirus is a technical problem to be solved. Summary of the Invention

[0005] The purpose of this part is to outline some aspects of the embodiments of the present invention and briefly introduce some preferred embodiments.

[0006] As one aspect of the present invention, the present invention provides the use of GK921 in the preparation of drugs for preventing and treating rotavirus, wherein the molecular structural formula of the GK921 is: 。

[0007] As a preferred scheme of the application of the present invention: the GK921 further includes a pharmaceutically acceptable carrier and / or excipient of GK921.

[0008] As a preferred embodiment of the application of the present invention: The GK921 further includes a pharmaceutically acceptable salt of GK921.

[0009] As a preferred embodiment of the application of the present invention: The drug includes one or more of tablets, sprays, granules, capsules, oral liquids, injections, suspensions containing the GK921.

[0010] As a preferred embodiment of the application of the present invention: The GK921 can inhibit the replication of rotavirus.

[0011] As a preferred embodiment of the application of the present invention: The GK921 can inhibit the expression level of VP6 protein in the rotavirus gene.

[0012] Advantages of the present invention: The present invention discovers that GK921 can significantly inhibit RV replication, and also discovers that GK921 not only inhibits the transcription of rotavirus, but also can reduce the expression of VP6 protein. Therefore, GK921 can be used for preventing or treating rotavirus. Description of the Drawings

[0013] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Among them: Figure 1 It is a comparison chart of the toxic effects of different concentrations of compound GK921 on MA104 cells. In the figure, 0.5 μM, 1 μM, 5 μM, 7.5 μM, 10 μM indicate that MA104 cells are treated with GK921 at 0.5 μM, 1 μM, 5 μM, 7.5 μM, 10 μM respectively.

[0014] Figure 2 It is a comparison chart of the inhibition of the expression level of RV RNA by different concentrations of compound GK921.

[0015] Figure 3 It is a comparison chart of the inhibition of the expression level of RV VP6 protein by different concentrations of compound GK921.

[0016] Figure 4 It is a fluorescence image of the inhibition of rotavirus by different concentrations of compound GK921.

[0017] Figure 5 It is a line chart of the diarrhea scores, fecal virus loads, and virus loads in the lungs of different experimental groups.

[0018] Figure 6 It is a diagram of feces and autopsy of different experimental groups.

[0019] Figure 7Comparison diagrams of HE sections of the duodenum, jejunum, ileum and lungs of different experimental groups. Detailed implementation manners

[0020] To make the above objects, features and advantages of the present invention more obvious and understandable, the following detailed description of the specific implementation manners of the present invention will be given in conjunction with specific embodiments.

[0021] The present invention uses MA104 cells (monkey fetal kidney cells) and cultures them in an incubator at 37 °C with 5% CO2. BABL / c suckling mice are purchased from Qinglongshan Experimental Animal Center. The compounds used are purchased from Aladdin Reagent (Shanghai) Co., Ltd., and the molecular structural formula is shown as follows: The different concentrations of GK921 used in the present invention are first diluted to 29 mM with DMSO for storage, and then diluted to 0.5 μM, 1 μM, 5 μM, 7.5 μM and 10 μM concentrations with DMEM medium respectively. For other related reagents used, if not otherwise specified, they are commercially available agents, and for the methods involved, if not otherwise specified, they are well-known methods.

[0022] The rotavirus strain used: Rotavirus (G9P[7]), passaged and cultured on MA104 cells.

[0023] The experiments of the present invention are as follows: 1. Cytotoxicity test of GK921: The cytotoxicity of GK921 is detected on MA104 cells. Plate MA104 cells in a 96-well plate with DMEM medium containing 10% FBS. After the cells grow into a monolayer, add different concentrations of GK921 (0.5 μM, 1 μM, 5 μM, 7.5 μM, 10 μM and 15 μM) to the wells to treat the cells as the experimental group, add medium and DMSO to the blank control group, and add medium and DMSO to the cell wells as the negative control group. Place the 96-well plate in the incubator and incubate for 24 h, then add 10 μL of CCK-8 solution to each well of the plate. After continuing to place it in the incubator for 1 h, use an enzyme-linked immunosorbent assay (ELISA) reader to measure the absorbance at 450 nm, and calculate the cell survival rate of each concentration according to the formula [((OD 实验组 0D 空白组 )) / ((0D 阴性对照 0D 空白组 )) × 100%].

[0024] The results are as Figure 1As shown, compound GK921 has less toxicity to cells. When the drug concentration is 15 μM, the cell survival rate can still reach more than 90%. In summary, the compound GK921 of the present invention has a good inhibitory effect on porcine rotavirus and low cytotoxicity, and can be used to treat rotavirus.

[0025] 2. Effect of compound GK921 on RNA level during RV infection and replication MA104 cells were placed in a 24-well plate and cultured in DMEM medium containing 10% fetal bovine serum (FBS). In the experimental group, cells were first infected with rotavirus (RV) at a multiplicity of infection (M0I) of 0.01 for 2 hours, and then dilutions of GK921 at concentrations of 0.5 μM, 1 μM, 5 μM and dimethyl sulfoxide (DMSO) were added as cell maintenance fluids. The blank control group did not treat with rotavirus and only cultured cells with the medium. Then, the cell plate was placed in an incubator at 37°C and 5% carbon dioxide for 24 hours. After the culture, the cell supernatant was collected, the RNA in it was extracted and reverse transcribed into cDNA. Subsequently, targeting the RV NSP3 gene, the relative expression level of the viral gene was detected by relative fluorescence quantitative PCR. The total volume of the fluorescence quantitative PCR (RT-qPCR) reaction system was set to 20 μL, including 10 μL of Premix Ex Taq (SYBR qPCR), 0.4 μL of each upstream and downstream primer, and 2 μL of the template, and the insufficient part was made up to 20 μL with sterile deionized water. The reaction conditions were: 95°C, 30 s; 95°C, 5 s, 60°C, 30 s, for a total of 40 cycles. Among them, the upstream primer of RV-NSP3: ACCATCTACACATGACCCTCTATGAG; the downstream primer: ACATAACGCCCCTATAGCCATTTA. The upstream primer of β-actin: GTGATCTCCTTCTGCATCCTGTC; the downstream primer: CTCCATCATGAAGTGCGACGT.

[0026] The experimental results of the RV virus RNA level are as Figure 2 shown. The inhibitory effect of different concentrations of GK921 on RV replication. This figure shows that the addition of GK921 has an obvious inhibitory effect on the RV virus RNA expression, and the inhibition rate is as high as more than 80% at a concentration of 5 μM.

[0027] 3. Effect of compound GK921 on the expression level of VP6 protein of RV MA104 cells were placed in a 24-well plate and cultured in DMEM medium containing 10% fetal bovine serum (FBS). In the experimental group, cells were first infected with rotavirus (RV) at a multiplicity of infection (MOI) of 0.01 for 2 hours, and then dilutions of GK921 at concentrations of 0.5 μM, 1 μM, 5 μM and dimethyl sulfoxide (DMSO) were added as cell maintenance medium. The blank control group was not treated with rotavirus and cells were only cultured with the medium. Then, the cell plates were placed in an incubator at 37 °C with 5% carbon dioxide for 24 hours. Subsequently, the supernatant was discarded, and after washing with PBS, 100 μL of RIPA lysis buffer was added to the cell culture. The cells were lysed at 4 °C for 15 minutes, and then 5× SDS-PAGE loading buffer was added. The samples were denatured at 100 °C for 10 minutes. After the operation was completed, the samples were centrifuged, and 7 μL of the supernatant was added to the protein gel wells. The voltage was set at 120 V and the electrophoresis time was 60 minutes. After electrophoresis, the transfer membrane process was performed using a nitrocellulose (NC) membrane with a pore size of 0.2 μM, and a constant current of 330 mA was set for 60 minutes of continuous power supply. After the transfer membrane was completed, non-specific sites were blocked with a 5% skim milk solution at room temperature for 60 minutes. After the blocking was completed, the residual liquid was removed, and the membrane was rinsed three times with 1× PBST buffer (5 minutes each time). Subsequently, the diluted primary antibody working solution was added, and the membrane was incubated with shaking at 4 °C for 12 hours. After recovering the primary antibody, the membrane was washed three times with 1× PBST (10 minutes each time), and then incubated with the secondary antibody at room temperature for 60 minutes. After the final washing step was completed, ECL chemiluminescent substrate was used for development analysis, and the difference in the expression level of VP6 protein was quantitatively compared through an imaging system.

[0028] The experimental results are as Figure 3 shown. Compared with the infection control group (DMSO), the expression level of VP6 protein in the experimental group (GK921 + RV) was significantly decreased. The results indicate that compound GK921 can significantly inhibit the expression level of VP6 protein in the rotavirus gene.

[0029] 4. Observation of the effect of compound GK921 on RV infection and replication under fluorescence MA104 cells were placed in 96-well plates and cultured in DMEM medium containing 10% fetal bovine serum (FBS). After the experimental group was inoculated with rotavirus (MOI = 0.01) for 2 h, dilutions of GK921 at concentrations of 0.5 μM, 1 μM, 5 μM and dimethyl sulfoxide (DMSO) were used as cell maintenance fluids. The blank control group was not treated with rotavirus and the cells were only cultured with the medium. Then, the cell plates were placed in an incubator at 37 °C and 5% carbon dioxide for 24 h. Then, the supernatant was discarded, the cells were washed three times with PBS, fixed with ice-cold methanol for 15 min, blocked with 5% non-fat milk solution to block non-specific sites, reacted at room temperature for 60 min, the blocking solution was discarded, and the antibody (rotavirus VP6 monoclonal antibody, dilution ratio 1:200) diluted with 5% non-fat milk was added, and incubated overnight at 4 °C in the dark. Then, a fluorescein-labeled secondary antibody (FITC) was used and incubated at 37 °C for 1 h. After incubation, the antibody was discarded, the cells were washed three times with PBST, and the fluorescence change was observed under a fluorescence microscope.

[0030] The experimental results are as Figure 4 shown, Figure 4 indicating that the fluorescence was brighter in the infection control group (DMSO + RV), while the fluorescence gradually became darker after treatment with different concentrations of GK921. When treated with 5 μM GK921, the fluorescence almost completely disappeared. The above results indicate that compound GK921 can significantly inhibit the infection and replication of RV, and the inhibition becomes more obvious with the increase of the compound concentration.

[0031] 5. Verification of the effects of GK921 on diarrhea, viral load in feces and tissue viral load in suckling mice Five-day-old suckling mice were divided into 4 groups (PBS, RV, RV-low dose group and RV-high dose group), with 6 mice in each group. Except for the PBS group, the other groups were fed 100 μL of G9P[7] strain with a virus titer of 10 7.5 TCID50 / 0.1 ml. At 24 h after virus challenge, the low-dose group and the high-dose group were fed GK921 at 2 mg / kg and 4 mg / kg, respectively. The diarrhea condition of the suckling mice was observed and recorded every 12 h after virus challenge (0 points: normal; 1 point: paste; 2 points: loose stool; 3 points: watery). Feces were collected to detect the viral load in the feces. At 84 h after virus challenge, all suckling mice were dissected to detect the viral load in each tissue.

[0032] The experimental results are as Figure 5 shown, Figure 5 Panel A in Figure 5B in it indicates that RV could not be detected in the high-dose group at 48 h after GK921 administration, suggesting that compound GK921 can significantly inhibit the replication of rotavirus in vivo. Figure 5 C in it indicates that the viral load in the lungs of the high-dose group was significantly lower than that in the RV group, suggesting that compound GK921 can significantly inhibit the proliferation of rotavirus in the lungs.

[0033] 6. Verification of the in vivo efficacy of GK921 in neonatal mice Neonatal mice at 5 days old were divided into 4 groups (PBS, RV, RV-low-dose group, and RV-high-dose group), with 6 mice in each group. Except for the PBS group, the other groups were fed 100 μL of G9P[7] strain with a virus titer of 10 7.5 TCID50 / 0.1 ml. At 24 h after virus challenge, the low-dose group and the high-dose group were fed GK921 at 2 mg / kg and 4 mg / kg respectively. At 84 h after virus challenge, all neonatal mice were dissected, and HE sections of the duodenum, jejunum, ileum, and lungs were observed.

[0034] The experimental results are as Figure 6 shown. The feces of the high-dose group were normal at 84 h, while the positive control group was still suffering from diarrhea. It shows that compound GK921 can improve the diarrhea caused by rotavirus. As Figure 7 shown, the pathological changes in each tissue of the high-dose group were not obvious, indicating that compound GK921 can significantly improve the damage of rotavirus to the duodenum, jejunum, ileum, and lungs.

[0035] In summary, GK921 can be used as the sole active ingredient to prepare drugs for preventing and treating rotavirus. Of course, the prepared drugs not only contain GK921, but also include pharmaceutically acceptable carriers and / or excipients of GK921; the dosage forms of the drugs are one or more of tablets, sprays, granules, capsules, oral liquids, injections, and suspensions.

[0036] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not restrictive. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention, and they should all be covered by the scope of the claims of the present invention.

Claims

1. The use of GK921 in the preparation of a drug for preventing and treating rotavirus, characterized in that: The molecular structural formula of GK921 is as follows: 。 2. The application according to claim 1, characterized in that: GK921 further includes a pharmaceutically acceptable carrier and / or excipient of GK921.

3. The application according to claim 1, characterized in that: GK921 further includes a pharmaceutically acceptable salt of GK921.

4. The application according to claim 1 or 2, characterized in that: The drug includes one or more of tablets, sprays, granules, capsules, oral liquids, injections, suspensions containing GK921.

5. The application according to claim 1 or 2, characterized in that: GK921 can inhibit the replication of rotavirus.

6. The application according to claim 1 or 2, characterized in that: GK921 can inhibit the expression level of VP6 protein in the rotavirus gene.

Images