The role of GK921 in the preparation of drugs for the prevention and treatment of rotavirus

Abstract

The present invention belongs to the field of biomedicine and discloses the role of GK921 in the preparation of a medicament for the prevention and treatment of rotavirus. Compared with the prior art, the present invention finds that GK921 can significantly inhibit rotavirus replication and not only inhibit rotavirus transcription but also reduce VP6 protein expression. Therefore, GK921 can be used to prevent or treat rotavirus.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to the role of GK921 in preparing drugs for preventing and treating rotavirus. Background Art

[0002] Rotavirus (RV) is the most common cause of viral gastroenteritis in infants, young children, and animals. Rotavirus is primarily transmitted through the fecal-oral route, and infected individuals typically present with symptoms such as diarrhea, vomiting, and loss of appetite. The infection can be transmitted between humans and animals, posing a serious threat to human health and the livestock industry. Currently, six RV vaccines are marketed worldwide, all oral live attenuated vaccines, four of which have been prequalified by the World Health Organization: RotaTeq (Merck), Rotarix (GlaxoSmithKline), Rotavac (Bharat Biotech), and Rotasiil (Serum Institute). However, these vaccines are serotype-specific, and effective cross-protection between different serotypes is difficult to achieve, resulting in limited protective efficacy. Currently, there are no clinically available drugs specifically targeting rotavirus. Therefore, the development of new antiviral agents is crucial for the control and treatment of rotavirus.

[0003] GK921, chemically named N-(4-cyanophenyl)-N-(4-methoxyphenyl)urea, has a molecular formula of C21H20N4O and a molecular weight of 344.41, 1025015-40-0. GK921 is a potent and orally available TGase2 inhibitor that specifically inhibits TGase2 activity. It effectively inhibits TG2-mediated I-KBα and p53 aggregation, induces growth arrest / cell death in renal cell carcinoma (RCC) cultures, eliminates RCC in mice, and increases p53 levels.

[0004] Currently, developing new drugs to prevent and treat rotavirus is a technical problem that needs to be solved. Summary of the Invention

[0005] The purpose of this section is to summarize some aspects of embodiments of the present invention and to briefly introduce some preferred embodiments.

[0006] As one aspect of the present invention, the present invention provides the role of GK921 in the preparation of a drug for preventing and treating rotavirus, wherein the molecular structure of GK921 is:

[0007] .

[0008] As a preferred embodiment of the application of the present invention: the GK921 further comprises a pharmaceutically acceptable carrier and / or excipient for GK921.

[0009] As a preferred embodiment of the application of the present invention: the GK921 further comprises a pharmaceutically acceptable salt of GK921.

[0010] As a preferred embodiment of the application of the present invention, the medicine includes one or more of tablets, sprays, granules, capsules, oral solutions, injections, and suspensions containing the GK921.

[0011] As a preferred embodiment of the application of the present invention: the GK921 can inhibit the replication of rotavirus.

[0012] As a preferred embodiment of the application of the present invention: the GK921 can inhibit the expression level of VP6 protein in the rotavirus gene.

[0013] Beneficial effects of the present invention: The present invention found that GK921 can significantly inhibit RV replication and found that GK921 not only inhibits rotavirus transcription but also reduces the expression of VP6 protein. Therefore, GK921 can be used to prevent or treat rotavirus. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments, wherein:

[0015] Figure 1 This is a comparison of the toxic effects of different concentrations of compound GK921 on MA104 cells. In the figure, 0.5 μM, 1 μM, 5 μM, 7.5 μM, and 10 μM indicate that MA104 cells were treated with GK921 0.5 μM, 1 μM, 5 μM, 7.5 μM, and 10 μM, respectively.

[0016] Figure 2 This is a comparison chart of the inhibition of RV RNA expression levels by different concentrations of compound GK921.

[0017] Figure 3 This is a comparison chart of the inhibition of RV VP6 protein expression levels by different concentrations of compound GK921.

[0018] Figure 4 The fluorescence images show that compound GK921 inhibits rotavirus at different concentrations.

[0019] Figure 5 The figure shows the line graph of diarrhea scores, fecal viral load and lung viral load in different experimental groups.

[0020] Figure 6 Figures 1 and 2 show the feces and autopsy images of different experimental groups.

[0021] Figure 7Comparison of HE sections of duodenum, jejunum, ileum and lung in different experimental groups. DETAILED DESCRIPTION

[0022] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with specific embodiments.

[0023] MA104 cells (monkey fetal kidney cells) were cultured in a 37°C, 5% CO2 incubator. BABL / c suckling mice were purchased from the Qinglongshan Experimental Animal Center. The compound used was purchased from Aladdin Reagents (Shanghai) Co., Ltd., and its molecular structure is shown below:

[0024]

[0025] The different concentrations of GK921 used in the present invention were first diluted to 29 mM with DMSO for storage and then diluted to 0.5 μM, 1 μM, 5 μM, 7.5 μM, and 10 μM with DMEM medium. All other related reagents used, unless otherwise specified, were commercially available, and the methods involved, unless otherwise specified, were all well-known methods.

[0026] The rotavirus strain used was rotavirus (G9P[7]), subcultured on MA104 cells.

[0027] The present invention experiment is as follows:

[0028] 1. Cytotoxicity test of GK921:

[0029] GK921 was tested for cytotoxicity on MA104 cells. MA104 cells were plated in 96-well plates using DMEM medium containing 10% FBS. After the cells grew into a monolayer, different concentrations of GK921 (0.5 μM, 1 μM, 5 μM, 7.5 μM, 10 μM, and 15 μM) were added to the wells to treat the cells as experimental groups. The blank control group was treated with culture medium and DMSO, and the negative control group was treated with culture medium and DMSO. After the 96-well plates were placed in an incubator for 24 hours, 10 uL of CCK-8 solution was added to each well of the plate. After the plates were placed in the incubator for another hour, the absorbance at 450 nm was measured using a microplate reader. The absorbance was calculated according to the formula [(OD 实验组 0D 空白组 ) / (0D 阴性对照 0D 空白组 )×100%] to calculate the cell survival rate at each concentration.

[0030] The results are as follows Figure 1As shown, compound GK921 has low cytotoxicity. At a drug concentration of 15 μM, the cell survival rate can still reach over 90%. In summary, the compound GK921 of the present invention has a good inhibitory effect on porcine rotavirus and has low cytotoxicity, and can be used to treat rotavirus.

[0031] 2. Effect of compound GK921 on RNA levels during RV infection and replication

[0032] MA104 cells were plated in 24-well plates and cultured in DMEM supplemented with 10% fetal bovine serum (FBS). The experimental group was first infected with rotavirus (RV) at a multiplicity of infection (MOI) of 0.01 for 2 hours. GK921 was then added at concentrations of 0.5 μM, 1 μM, and 5 μM, along with dimethyl sulfoxide (DMSO) dilutions, as a maintenance medium. A blank control group was not treated with rotavirus and cultured with culture medium alone. The cell plates were then incubated at 37°C and 5% carbon dioxide for 24 hours. After incubation, the cell supernatant was collected, RNA was extracted, and reverse transcribed into cDNA. Subsequently, relative expression of viral genes was determined by quantitative PCR targeting the RV NSP3 gene. The total volume of the RT-qPCR reaction system was set at 20 μL, containing 10 μL of Premix Ex Taq (SYBR qPCR), 0.4 μL of upstream and downstream primers, and 2 μL of template. The remaining volume was made up to 20 μL with sterile deionized water. The reaction conditions were: 95°C for 30 s, 95°C for 5 s, and 60°C for 30 s, for a total of 40 cycles. The upstream primer for RV-NSP3 was ACCATCTACACATGACCCTCTATGAG; the downstream primer was ACATAACGCCCCTATAGCCATTTA. The upstream primer for β-actin was GTGATCTCCTTCTGCATCCTGTC; the downstream primer was CTCCATCATGAAGTGCGACGT.

[0033] The results of the RV virus RNA level experiment are as follows Figure 2 As shown, the inhibitory effect of different concentrations of GK921 on RV replication. The figure shows that the addition of GK921 has a significant inhibitory effect on RV viral RNA expression, and the inhibition rate is as high as more than 80% at a concentration of 5 μM.

[0034] 3. Effect of compound GK921 on RV VP6 protein expression level

[0035] MA104 cells were plated in 24-well plates and cultured in DMEM supplemented with 10% fetal bovine serum (FBS). In the experimental group, cells were first infected with rotavirus (RV) at a multiplicity of infection (MOI) of 0.01 for 2 hours. GK921 was then added at concentrations of 0.5 μM, 1 μM, and 5 μM, along with dimethyl sulfoxide (DMSO) dilutions, as a maintenance medium. A blank control group was not treated with rotavirus and cultured with culture medium alone. The plates were then incubated at 37°C and 5% carbon dioxide for 24 hours. The supernatant was discarded, the cells were washed with PBS, and 100 μL of RIPA lysis buffer was added to the cells. Lysis was performed at 4°C for 15 minutes. 5× SDS-PAGE loading buffer was then added, and the samples were denatured at 100°C for 10 minutes. After completion of the procedure, the samples were centrifuged, and 7 μL of the supernatant was added to the wells of a protein gel. Electrophoresis was performed at 120 V for 60 minutes. After electrophoresis, transfer was performed using a 0.2 μM pore size NC membrane at a constant current of 330 mA for 60 minutes. Following transfer, nonspecific sites were blocked with a 5% skim milk solution at room temperature for 60 minutes. After blocking, residual liquid was removed and the membrane was rinsed three times with 1× PBST buffer (5 minutes each). Diluted primary antibody working solution was then added and incubated at 4°C with shaking for 12 hours. After primary antibody recovery, the membrane was washed three times with 1× PBST (10 minutes each) and incubated with a secondary antibody for 60 minutes at room temperature. After the final wash step, the membrane was visualized using an ECL chemiluminescent substrate, and VP6 protein expression levels were quantitatively compared using an imaging system.

[0036] The experimental results are as follows Figure 3 As shown in the figure, the expression level of VP6 protein in the experimental group (GK921+RV) was significantly reduced compared with the infection control group (DMSO). The results show that compound GK921 can significantly inhibit the expression level of VP6 protein in the rotavirus gene.

[0037] 4. Observation of the effect of compound GK921 on RV infection and replication under fluorescence

[0038] MA104 cells were plated in 96-well plates and cultured in DMEM supplemented with 10% fetal bovine serum (FBS). Two hours after inoculation with rotavirus (MOI = 0.01), the cells were maintained with GK921 at concentrations of 0.5 μM, 1 μM, and 5 μM, along with dimethyl sulfoxide (DMSO) dilutions. A blank control group was not treated with rotavirus and cultured with culture medium alone. The plates were then incubated at 37°C in a 5% CO2 atmosphere for 24 hours. The supernatant was discarded, the cells were washed three times with PBS, and fixed with ice-cold methanol for 15 minutes. Nonspecific sites were blocked with 5% skim milk solution for 60 minutes at room temperature. The blocking solution was discarded, and an antibody (rotavirus VP6 monoclonal antibody, dilution 1:200) diluted in 5% skim milk was added. The cells were incubated overnight at 4°C in the dark. Fluorescein isothiocyanate (FITC)-conjugated fluorescent secondary antibody was then incubated at 37°C for 1 hour. After incubation, the antibody was discarded, the membrane was washed three times with PBST, and the fluorescence changes were observed under a fluorescence microscope.

[0039] The experimental results are as follows Figure 4 As shown, Figure 4 The results showed that the fluorescence in the infection control group (DMSO + RV) was brighter, but gradually dimmed after treatment with different concentrations of GK921. The fluorescence was almost completely eliminated after treatment with 5 μM GK921. These results indicate that compound GK921 can significantly inhibit RV infection and replication, and the inhibition becomes more pronounced with increasing compound concentration.

[0040] 5. Experiments in suckling mice to verify the effects of GK921 on diarrhea, fecal viral load, and tissue viral load

[0041] Five-day-old suckling mice were divided into four groups (PBS, RV, RV-low dose group and RV-high dose group), with 6 mice in each group. Except for the PBS group, the other groups were fed with 100 μL of 10 7.5 The G9P[7] strain was tested for TCID50 / 0.1 ml. Twenty-four hours after challenge, the low-dose and high-dose groups were fed GK921 at 2 mg / kg and 4 mg / kg, respectively. Diarrhea was observed and recorded every 12 hours after challenge (0: normal; 1: mushy; 2: loose stools; 3: watery). Feces were collected and tested for viral load. All mice were autopsied 84 hours after challenge, and viral load in various tissues was tested.

[0042] The experimental results are as follows Figure 5 As shown, Figure 5 A in the figure shows that the stool score of the GK921 high-dose group was significantly reduced at 48 h, indicating that compound GK921 can significantly alleviate the diarrhea symptoms caused by rotavirus. Figure 5B in the figure shows that RV was no longer detectable in the high-dose group after 48 h of GK921 treatment, indicating that compound GK921 can significantly inhibit the replication of rotavirus in vivo. Figure 5 C in the figure shows that the viral load in the lungs of the high-dose group was significantly lower than that of the RV group, indicating that compound GK921 can significantly inhibit the proliferation of rotavirus in the lungs.

[0043] 6. Neonatal Mouse Experiment Verification of GK921's In Vivo Efficacy

[0044] Five-day-old suckling mice were divided into four groups (PBS, RV, RV-low dose group and RV-high dose group), with 6 mice in each group. Except for the PBS group, the other groups were fed with 100 μL of 10 7.5 TCID50 / 0.1 ml of G9P[7] strain. 24 hours after the challenge, the low-dose group and the high-dose group were fed GK921 2 mg / kg and 4 mg / kg, respectively. 84 hours after the challenge, all suckling mice were autopsied and HE sections of the duodenum, jejunum, ileum, and lungs were observed.

[0045] The experimental results are as follows Figure 6 As shown in the figure, the stool of the high-dose group was normal after 84 hours, while the positive control group still had diarrhea. This indicates that compound GK921 can improve diarrhea caused by rotavirus. Figure 7 As shown, the pathological changes of various tissues in the high-dose group were not obvious, indicating that compound GK921 can significantly improve the damage of rotavirus to the duodenum, jejunum, ileum and lungs.

[0046] In summary, GK921 can be used as the sole active ingredient to prepare drugs for the prevention and treatment of rotavirus. Of course, the prepared drugs contain not only GK921, but also pharmaceutically acceptable carriers and / or excipients for GK921; the dosage form of the drugs is one or more of tablets, sprays, granules, capsules, oral solutions, injections, and suspensions.

[0047] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. The role of GK921 in the preparation of a medicament for treating rotavirus, characterized in that: The molecular structure of GK921 is: 。 2. The use according to claim 1, characterized in that: The GK921 further includes a pharmaceutically acceptable carrier and / or excipient for GK921.

3. The use according to claim 1, characterized in that: The GK921 also includes pharmaceutically acceptable salts of GK921.

4. The use according to claim 1 or 2, characterized in that: The medicine includes one or more of tablets, sprays, granules, capsules, oral solutions, injections, and suspensions containing the GK921.

5. The use according to claim 1 or 2, characterized in that: The GK921 can inhibit the replication of rotavirus.

6. The use according to claim 1 or 2, characterized in that: The GK921 can inhibit the expression level of VP6 protein in the rotavirus gene.

Images