Mouse model of fetal / neonatal isoimmune thrombocytopenia

Abstract

The invention relates to a mouse model of fetal / neonatal isoimmune thrombocytopenia. Transgenic mice comprising T30A, S32P, Q33L, N39D, and M470Q mutations in GPIIIa are described, as well as methods of making the transgenic mice and methods of screening test compounds using the transgenic mice.

Description

[0001] This application is a divisional application of Chinese Patent Application No. 201980101996.6.

[0002] Cross-reference to related applications

[0003] Not applicable.

[0004] Reference to the Sequence Listing submitted via the EFS-Web

[0005] The content of the ASCII text file of the Sequence Listing, named "160180_00134_ST25.txt", sized 29.0 kb, created on November 4, 2019, and submitted electronically via the EFS-Web, is hereby incorporated by reference in its entirety. Background of the Invention

[0006] Alloantibodies against platelet-specific antigens cause three clinically significant hemorrhagic disorders: Blood transfusion post Purple partum Platelet thrombocytopenic Injection purpura Effect (PTP), refractoriness Fetus to Birth platelet Allogeneic transfusion Immunity (RPT) and Platelet fetal / neonatal 1 alloimmune thrombocytopenia (FNAIT - variously called NATP or NAIT in the literature - see references for review 54 ). PTP is a rare syndrome in which multiparous women, after receiving a blood transfusion, inexplicably clear not only the transfused platelets but also their own platelets, resulting in severe thrombocytopenia, purpura, and petechiae. RPT is seen in patients who have received multiple platelet transfusions and remains a clinical challenge, leading to bleeding complications and prolonged hospital stays. RPT can be divided into immune and non-immune causes. Immune causes include alloimmunization to HLA and / or platelet-specific antigens due to prior pregnancy, blood transfusion, and / or transplantation exposure. Based on studies in patients with acute myeloid leukemia (AML) or hematopoietic progenitor cell transplantation, non-immune causes include fever, sepsis, splenomegaly, disseminated intravascular coagulation (DIC), hemorrhage, veno-occlusive disease (VOD), graft-versus-host disease (GVHD), and drug therapy 2，3 . Unlike PTP or RPT, FNAIT is a fairly common disorder that results in severe fetal and / or neonatal thrombocytopenia in approximately 1 / 1000 to 1 / 2000 live births 4However, the most devastating consequences of FNAIT are intracranial hemorrhage and intrauterine death as early as 20 - 24 weeks of gestation. 2，5，6 Despite the progress in treatment, FNAIT remains the leading cause of intracranial hemorrhage in full - term infants. 4，7-10 This usually results in lifelong disability.

[0007] Over the past 60 years, work carried out in many laboratories has identified more than 30 different heritable Human blood Small Platelet specific Allogeneic antigen (HPA) systems (HPA 1 - 30), which are located on five different glycoproteins and are currently recognized by the Platelet Nomenclature Committee of the International Society of Blood Transfusion (ISBT) and the ISTH. 11 Among them, the HPA - 1a (also known as Pl A1 ) epitope is the most common epitope that triggers PTP and FNAIT and is the cause of approximately 80% of the cases of detectable alloantibodies. 12 Therefore, it has been widely studied. However, there is a need in the art for improved models for studying the HPA - 1a / 1b epitope and for improved diagnostic, preventive, and therapeutic methods for PTP and FNAIT. SUMMARY OF THE INVENTION

[0008] Some of the main aspects of the invention are summarized below. Additional aspects are described in the Detailed Description, Examples, Drawings, and Claims sections of this disclosure. The descriptions in each part of this disclosure are intended to be read together with the other parts. In addition, the various embodiments described in each part of this disclosure can be combined in various different ways, and any and all such combinations of embodiments are intended to fall within the scope of the invention.

[0009] In a first aspect, the present invention provides transgenic mice whose genome contains nucleic acid encoding a variant platelet membrane glycoprotein IIIa (GPIIIa) having at least 95% identity with SEQ ID NO: 25, wherein the variant GPIIIa contains the mutations T30A, S32P, Q33L, N29D, and M470Q in SEQ ID NO: 25. In some embodiments, the mice express a variant GPIIIa comprising the sequence shown in SEQ ID NO: 26. In some embodiments, the variant GPIIIa further contains the mutation V22M relative to SEQ ID NO: 25. In some embodiments, the variant GPIIIa can bind to an anti - HPA - 1a antibody.

[0010] In a second aspect, the present disclosure provides an in vitro method for identifying a molecule capable of specifically binding to variant platelet membrane glycoprotein IIIa (GPIIIa), the method comprising: contacting a candidate molecule with platelets from the transgenic mice described herein; and determining whether the candidate molecule binds to the platelets; wherein if the candidate molecule binds to platelets from the transgenic mice but not to platelets from wild-type mice, the candidate molecule is capable of specifically binding to variant GPIIIa. In some embodiments, the candidate molecule is selected from the group consisting of antibodies, Fv, F(ab), F(ab′), F(ab′)2, and single-chain forms of any of the foregoing.

[0011] In a third aspect, the present disclosure provides an in vivo method for identifying a molecule capable of preventing a female mouse from mounting an anti-HPA-1a alloimmune response, the method comprising: administering a candidate molecule to a test mouse, wherein the test mouse is pregnant with a litter heterozygous for variant GPIIIa that comprises mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25 in wild-type platelet membrane glycoprotein IIIa (GPIIIa), and wherein the test mouse is negative for anti-HPA-1a antibodies; and measuring the anti-HPA-1a antibody titer of the test mouse; wherein if the anti-HPA-1a antibody titer of the test mouse is undetectable by single antigen bead assay two weeks postpartum, the candidate molecule is capable of preventing an anti-HPA-1a alloimmune response. In some embodiments, the anti-HPA-1a antibody titer in the test mouse is undetectable six weeks postpartum. In some embodiments, the candidate molecule is selected from the group consisting of antibodies, Fv, F(ab), F(ab′), F(ab′)2, and single-chain forms of any of the foregoing.

[0012] In a fourth aspect, the present disclosure provides an in vivo method of identifying a molecule capable of inhibiting the binding of anti-HPA-1a alloantibodies to fetal or neonatal platelets, the method comprising: administering a candidate molecule to a test mouse, wherein the test mouse is pregnant with a litter of pups that are heterozygous for a variant GPIIIa that is wild-type platelet membrane glycoprotein IIIa (GPIIIa) complex comprising mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25, and wherein the test mouse was immunized prior to pregnancy with (i) platelets from a transgenic mouse as described herein or (ii) a variant GPIIIa comprising mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25; and measuring the fetal or neonatal platelet count; wherein if the fetal or neonatal platelet count of the test mouse pups is higher than the fetal or neonatal platelet count of control mouse pups, the candidate molecule is capable of inhibiting the binding of anti-HPA-1a alloantibodies to fetal or neonatal platelets. In some embodiments, bleeding in the pups of the test mouse is reduced or prevented compared to the pups of control mice. In some embodiments, the candidate molecule is selected from the group consisting of antibodies, Fv, F(ab), F(ab′), F(ab′)2, and single-chain forms of any of the foregoing.

[0013] In a fifth aspect, the present disclosure provides an in vivo method of identifying a molecule capable of inhibiting the passage of anti-HPA-1a alloantibodies through the placenta of a pregnant mouse, the method comprising: administering a candidate molecule to a test mouse, wherein the test mouse is pregnant with a litter of pups that are heterozygous for a variant GPIIIa that is wild-type platelet membrane glycoprotein IIIa (GPIIIa) complex comprising mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25, and wherein the test mouse was immunized prior to pregnancy with (i) platelets from a transgenic mouse as described herein or (ii) a variant GPIIIa comprising mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25; and measuring the fetal or neonatal anti-HPA-1a antibody titer; wherein if the fetal or neonatal antibody titer of the test mouse pups is lower than the fetal or neonatal antibody titer of control mouse pups, the candidate molecule is capable of inhibiting the passage of anti-HPA-1a alloantibodies through the placenta of the pregnant mouse. In some embodiments, bleeding in the pups of the test mouse is reduced or prevented compared to the pups of control mice. In some embodiments, the candidate molecule is selected from the group consisting of antibodies, Fv, F(ab), F(ab′), F(ab′)2, and single-chain forms of any of the foregoing.

[0014] In a sixth aspect, the present disclosure provides a variant platelet membrane glycoprotein IIIa (GPIIIa) comprising the amino acid sequence set forth in SEQ ID NO: 26.

[0015] In a seventh aspect, provided herein is an in vitro method of identifying a molecule capable of competing with an anti-HPA-1a antibody for binding to a variant GPIIIa as described herein, the method comprising: contacting the variant GPIIIa with the anti-HPA-1a antibody to form a GPIIIa-antibody complex, wherein the variant GPIIIa is immobilized on a substrate and wherein the anti-HPA-1a antibody comprises a label; contacting the GPIIIa-antibody complex with a candidate molecule in solution; and determining whether the candidate molecule competes with the anti-HPA-1a antibody for binding to the variant GPIIIa by detecting the amount of label on the substrate or in the solution; wherein if the amount of label detected on the substrate after contacting the GPIIIa-antibody complex with the candidate molecule is reduced compared to the amount of label detected on the substrate before contacting the GPIIIa-antibody complex with the candidate molecule, the candidate molecule is capable of competing with the anti-HPA-1a antibody for binding to the variant GPIIIa; or wherein if the amount of label in the solution after contacting the GPIIIa-antibody complex with the candidate molecule is increased compared to the amount of label in the solution before contacting the GPIIIa-antibody complex with the candidate molecule, the candidate molecule is capable of competing with the anti-HPA-1a antibody for binding to the variant GPIIIa. In some embodiments, the anti-HPA-1a antibody is monoclonal antibody 26.4. In some embodiments, the label is selected from the group consisting of fluorophores, radioisotopes, chemiluminescent probes, and bioluminescent probes. In some embodiments, the substrate is selected from the group consisting of beads, resins, particles, membranes, and gels. In some embodiments, the candidate molecule is selected from the group consisting of antibodies, Fv, F(ab), F(ab′), F(ab′)2, and single-chain forms of any of the foregoing.

[0016] In an eighth aspect, the present disclosure provides a method of producing a transgenic mouse as described herein, the method comprising: injecting into the cytoplasm of a fertilized murine oocyte i) a Cas9 nuclease or a nucleotide encoding a Cas9 nuclease; ii) a gRNA targeting murine ITGB3 exon 3; iii) a gRNA targeting murine ITGB3 exon 10; iv) a single-stranded homology-directed repair (HDR) template oligonucleotide encoding the T30A, S32P, Q33L, and N39D mutations in GPIIIa relative to SEQ ID NO: 25; and ii) a single-stranded HDR template oligonucleotide encoding the M470Q mutation in GPIIIa relative to SEQ ID NO: 25; implanting a two-cell stage embryo produced from the injected oocyte into the oviduct of a pseudopregnant female mouse; and screening for mice that have the T30A, S32P, Q33L, N39D, and M470Q mutations in GPIIIa relative to SEQ ID NO: 25 among the mice born to the pseudopregnant female mouse. In some embodiments, the gRNA targeting ITGB3 exon 10 comprises SEQ ID NO: 7. In some embodiments, the single-stranded HDR template oligonucleotide encoding the M470Q mutation additionally encodes a diagnostic restriction site. In some embodiments, the single-stranded HDR template oligonucleotide encoding the M470Q mutation additionally encodes one or more silent mutations in ITGB3 exon 10 to silence repeated digestion of ITGB3 by Cas9 at exon 10. In some embodiments, the single-stranded HDR template oligonucleotide encoding the M470Q mutation comprises SEQ ID NO: 8. In some embodiments, the gRNA targeting ITGB3 exon 3 comprises SEQ ID NO: 1. In some embodiments, the single-stranded HDR template oligonucleotide encoding the T30A, S32P, Q33L, and N39D mutations additionally encodes a diagnostic restriction site. In some embodiments, the single-stranded HDR template oligonucleotide encoding the T30A, S32P, Q33L, and N39D mutations additionally encodes one or more silent mutations in ITGB3 exon 3 to silence repeated digestion of ITGB3 by Cas9 at exon 3. In some embodiments, the single-stranded HDR template oligonucleotide encoding the T30A, S32P, Q33L, and N39D mutations comprises SEQ ID NO: 4.

[0017] In a ninth aspect, the present disclosure provides a transgenic mouse whose genome contains a nucleic acid encoding a variant platelet membrane glycoprotein IIIa (GPIIIa) having at least 95% identity to SEQ ID NO: 27, wherein the variant GPIIIa contains the mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25. In some embodiments, the mouse expresses a variant GPIIIa comprising the sequence shown in SEQ ID NO: 27. In some embodiments, the variant GPIIIa can bind to an anti-HPA-1a antibody.

[0018] In a tenth aspect, the present disclosure provides a mouse bearing a wild-type platelet membrane glycoprotein IIIa (GPIIIa) complex heterozygous with a variant GPIIIa comprising the mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25. In some embodiments, the mouse is positive for anti-HPA-1a antibodies. In some embodiments, the mouse is immunized before pregnancy with (i) platelets from a transgenic mouse as described herein or (ii) a variant GPIIIa comprising the mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1A - 1B The three-dimensional structure of the human GPIIIa PSI and EGF1 domains is shown. Note that the PSI domain is located between the hybrid domain and the EGF1 domain of GPIIIa, and the polymorphic amino acid 33 that controls HPA-1a (P1 A1 ) epitope expression is in line with but conformationally close to the EGF1 domain. The alanine-to-Cys 435 mutation (which links the EGF1 domain to the PSI domain via a disulfide bond with Cys 13 ) has previously been shown to result in the loss of binding of some but not all maternal anti-HPA-1a alloantibodies, leading to the speculation that non-polymorphic amino acids in EGF1 form part of the epitope for these so-called type II antibodies.

[0020] Figure 2A - 2FShows the generation of CRISPR-mediated APLD humanized transgenic mice. Figure 2A: Three-dimensional structure of the GPIIIa PSI domain, showing the positions of residues mutated in the murine protein to humanize the 22-40 amino acid loop. Figure 2B: Schematic of the ITGB3 locus, showing the positions of the gRNA binding site (red bars), protospacer adjacent motif (PAM) sequence (magenta bars), and Cas9 cleavage site (red arrow). A 200 bp APLD homology-directed repair (HDR) template was designed to introduce four desired amino acid substitutions (mutated nucleotides marked in red) and a diagnostic BamH1 restriction site (silent mutation nucleotides marked in blue), flanked by 80 nucleotide homology arms. The HDR template also introduced nucleotides encoding silent mutations (green) to prevent re-cutting by Cas9. Figure 2C: The 20 bp gRNA designed in panel B to target the ITGB3 gene with Cas9 nuclease was cloned into the BbsI site of the CRISPR vector px459, which also encodes Cas9 and a puromycin resistance gene. The px459 plasmid together with the HDR template was microinjected into the pronuclei of C57BL / 6N fertilized eggs to generate humanized APLD mice. Figure 2D: Designed PCR strategy to report the incorporation of the HDR template within a 717 bp region surrounding the murine ITGB3 gene target site. The introduced BamH1 is marked with a blue box. Figure 2E: Genotyping of two representative pups: Genomic DNA from the tails of the pups was PCR amplified and digested with BamH1 to identify the correctly targeted APLD allele. Digestion of the PCR product from pup #1 with BamH1 demonstrated successful incorporation of the HDR oligonucleotide. Arrows indicate the expected BamH1 digestion products. Figure 2F: The ITGB3 locus surrounding the genomic editing site was PCR amplified from the genomic DNA of pup #1 and subjected to DNA sequence analysis, confirming precise homozygous integration of the human sequence into both alleles of murine ITGB3.

[0021] Figure 3A - 3BIt is shown that the APLD humanized mouse PSI domain supports the binding of some but not all human anti-HPA-1a alloantisera. Figure 3A: Flow cytometry analysis of the binding of the HPA-1a-selective murine mAb SZ21 to human and murine platelets. Note that SZ21 binds to human HPA-1a-positive human platelets but not to HPA-1b-positive human platelets, demonstrating its allo-selectivity, and binds to APLD but not to wild-type murine platelets. The PSI domain-specific mAb PSIB1, used as a positive control for GPIIb-IIIa expression, binds to all PSI domains as shown, regardless of species or HPA alloform. Figure 3B: Antigen capture ELISA analysis of the binding of anti-HPA-1a maternal alloantisera to human and murine forms of GPIIb-IIIa. Five different human FNAIT alloantisera were incubated with human or murine platelets of the indicated phenotypes. The platelet / antibody complexes were then lysed with detergent and added to microtiter wells that had been coated with anti-mouse CD41 to capture the immune complexes from murine platelets, or to microtiter wells coated with mAb AP2 to capture the immune complexes from human platelets. Note that human alloantisera 2, 3, and 4 reacted similarly with human GPIIb-IIIa and APLD murine GPIIb-IIIa, while alloantisera 1 and 5 did not react with murine APLD GPIIb-IIIa, indicating a more complex epitope requirement for the preponderance of HPA-1a-specific alloantibodies present in these polyclonal sera. As expected, none of the FNAIT alloantisera reacted with wild-type murine GPIIb-IIIa.

[0022] Figure 4A - 4B It is shown the structural requirements for binding to type II anti-HPA-1a antibodies. Figure 4A: Flow cytometry analysis of the reactivity of HPA-1a-specific monoclonal antibodies with human and murine platelets. Platelets from the indicated species and with the indicated phenotypes were reacted with mAbs SZ21, 26.4, and B2G1. Note that the type II mAb 26.4 requires the murine GPIIIa to be humanized from Met to Gln at residue 470 in the EGF1 domain, which is spatially close to the PSI domain, as shown in Figure 4B. Another type II HPA-1a-specific mAb B2G1 still did not react with APLD Q platelets, highlighting the complexity of the binding specificities that may exist in the polyclonal humoral response to the Leu33Pro polymorphism that controls HPA-1a epitope formation.

[0023] Figure 5A - 5CMultiple amino acids in I-EGF1 contribute to the binding of anti-HPA-1a type II antibodies. Figure 5A: Comparison of human and murine PSI and I-EGF1 domain sequences, with differences highlighted in red. Pay particular attention to the APLD sequence in the PSI domain and the differences Q470M, H446P, G463D, and P464Q in EGF1. Figure 5B: Structural model of the variable region of antibody B2G1 bound to β3 PSI and I-EGF1 domains. The antibody is shown as a tan surface with CDR loops as indicated, while the side chains of integrin β3 residues at the antigen-antibody interface are shown as sticks and dots. Note that the interface interaction residues include not only polymorphic amino acid 33 but also P in the PSI domain 32 and H in I-EGF1 446 and Q 470 . Also note that G 463 and P 464 are not near the interface. Figure 5C top panel: HEK293 cells transiently transfected with plasmids expressing human GPIIb and murine GPIIIa isoforms mutated to express the indicated humanized amino acid substitutions were incubated with the indicated antibodies and analyzed by flow cytometry. The PSI domain-specific mAb PSIB1 was used as a control for transfection efficiency. Note that the binding of mAb 26.4 requires Q 470 , while B2G1 requires Q 470 and H 446 , as predicted by the docking model in Figure 5B. Figure 5C bottom panel: Flow cytometry analysis of HEK293 cells transfected with plasmids expressing human GPIIb and human GPIIIa isoforms mutated to express the indicated murine amino acids using the indicated antibodies. Note that the Q 470 →M mutation results in the loss of binding of both 26.4 and B2G1, while the H 446 →P amino acid substitution only affects B2G1.

[0024] Figure 6A - 6DShows the generation of CRISPR-mediated APLDQ humanized transgenic mice. Figure 6A: Three-dimensional structure of the GPIIIa PSI domain, showing the position of residue M470 mutated to Q in the EGF1 domain of the APLD mouse GPIIIa protein. Figure 6B: Schematic of the ITGB3 locus, showing the positions of the gRNA binding site (red bars), protospacer adjacent motif (PAM) sequence (magenta bars), and Cas9 cleavage site (red arrow). A 167-bp homology-directed repair (HDR) template was designed to introduce the M-to-Q amino acid substitution (mutated nucleotides marked in red), flanked by 82- and 77-nucleotide homology arms. The HDR template also introduced silent mutations (nucleotides shown in green) to prevent recutting by Cas9. Figure 6C: Cytoplasmic microinjection of Cas-9 protein, gRNA, and the HDR template into APLD C57BL / 6N fertilized eggs to generate humanized APLDQ mice. Figure 6D: The ITGB3 locus surrounding the genome editing site was PCR amplified from genomic DNA of pups, and DNA sequence analysis confirmed precise heterozygous integration of the HDR sequence into one allele of the murine ITGB3.

[0025] Figure 7 Shows antigen capture ELISA analysis of anti-HPA-1a maternal alloantisera binding to human and murine forms of GPIIb-IIIa. Sixteen different human FNAIT alloantisera or PTP alloantisera were incubated with human or murine platelets of the indicated phenotypes. The platelet / antibody complexes were then lysed with detergent and added to microtiter wells coated with anti-mouse CD41 to capture immune complexes from murine platelets, or to microtiter wells coated with mAb AP2 to capture immune complexes from human platelets. Note that human FNAIT alloantisera 2, 3, 4, 7, 11, 12, 13 and PTP alloantisera 2 and 3 reacted similarly with human GPIIb-IIIa and APLD mouse GPIIb-IIIa, while human FNAIT alloantisera 1, 5, 9, 10 reacted poorly with APLD mouse GPIIb-IIIa, indicating more complex epitope requirements for the HPA-1a-specific alloantibodies present in these polyclonal sera. As expected, none of the FNAIT alloantisera reacted with wild-type mouse GPIIb-IIIa.

[0026] Figure 8It shows that type II, rather than type I, anti-HPA-1a alloantibodies inhibit the binding of PAC-1 to human αIIbβ3. HEK293FT cells were transfected with wild-type human αIIbβ3 plus EGFP. The cells were pre-incubated with the type I mAb SZ21, the type II mAb B2G1 and 26.4, or the purified IgG fractions from a previously characterized type I PTP antiserum (PTP-1) or a previously characterized type II FNAIT antiserum (FNAIT-5 and FNAIT-9). After pre-incubation, the fibrinogen ligand-mimicking mAb PAC-1 was added to a buffer containing 0.2 mM Ca +2 and 2 mM Mn +2 . The binding of EGFP-positive cells to PAC-1 was analyzed by flow cytometry. PAC-1 binding was normalized to total β3 surface expression and expressed as a percentage of the buffer control. Data are mean ± standard deviation (n≥2). Note that both monoclonal and polyclonal type II antibodies inhibited PAC-1 binding to varying degrees, while type I antibodies had essentially no effect.

[0027] Figure 9 It shows that pre-immunized wild-type females mated with APLD + / + males gave birth to severely thrombocytopenic pups. Mating control #1 was WT non-immunized Balb / c females crossed with APLD C57BL / 6 males. Mating control #2 was immunized Balb / c females crossed with WT C57BL / 6 males.

[0028] Figure 10A - 10D It shows that, although female animals were only immunized allogeneically once, fetal / neonatal thrombocytopenia persisted in at least five subsequent pregnancies. Maternal anti-APLD β3 integrin antibodies caused pup thrombocytopenia and bleeding.

[0029] Figure 11 It shows that, similar to the APLD model shown in Figure 9 , pre-immunized wild-type females mated with APLD Q males gave birth to severely thrombocytopenic pups. Mating control #1 was WT non-immunized Balb / c females crossed with APLD C57BL / 6 males. Mating control #2 was immunized Balb / c females crossed with WT C57BL / 6 males.

[0030] Figure 12A - 12D It shows that in the matings outlined in Figure 11 , pup thrombocytopenia and bleeding persisted in up to 4 pregnancies. Maternal anti-APLD β3 integrin antibodies caused pup thrombocytopenia and bleeding.

[0031] Figure 13It is shown that 4 μg / ml of mAb 26.4 effectively inhibits the binding of murine polyclonal anti-APLDQ antibody to murine APLDQ platelets in vitro. All concentrations tested between 2 μg / ml and 16 μg / ml effectively inhibited the binding.

[0032] Figure 14 Shown are the IVIG and mAb 26.4 treatment regimens. Intravenous (IV) administration of 1 g / kg of human IVIG on days 10 and 17 post-mating increased the platelet counts of the offspring of APLDQ-immunized females. Similarly, treatment with mAb 26.4 in the form of PG-LALA (30 μg / mouse) introduced on days 10 and 17 post-mating increased the platelet counts of the offspring of APLDQ-immunized females.

[0033] Figure 15 It is shown that both IVIG and PG-LALA 26.4 effectively increased the platelet counts of the offspring of APLDQ-immunized female mice.

[0034] Incorporated by reference

[0035] All publications, patents, and patent applications mentioned in this specification are hereby incorporated by reference as if each individual publication, patent, and patent application was specifically and individually indicated to be incorporated by reference. Detailed Description

[0036] FNAIT and PTP are hemorrhagic disorders caused by alloantibodies to platelet-specific antigens. The HPA-1a (also known as Pl A1 ) epitope is the human platelet alloantigen most frequently implicated in PTP and FNAIT and is the cause of approximately 80% of the cases of detectable alloantibodies. The HPA-1a / -1b alloantigen system is controlled by a Leu33Pro polymorphism in platelet membrane glycoprotein (GP) IIIa (= the β3 integrin subunit of the αIIbβ3 platelet fibrinogen receptor) 13，14 , Pro 33 homozygous individuals (= HPA-1b) also carry the HLA-DRB3*0101 allele of the major histocompatibility complex (MHC) and are most prone to mount an alloimmune response to the Leu 33 (HPA-1a) form of GPIIIa 15-17 . The polymorphic amino acid 33 is located within a heavy disulfide-bonded-like structure called the plexin, semaphorin, integrin (PSI) domain, which itself lies between the heterodimeric and integrin protein epidermal growth factor 1 (EGF, I-EGF1) domains of GPIIIa (see Figure 1A - 1B)。Interestingly, while some maternal anti-HPA-1a alloantibodies classified as type I antibodies typically bind to a mutant form of GPIIIa in which the disulfide bond linking the PSI and EGF1 domains has been disrupted, other antibodies (type II) lose reactivity 19 , suggesting (1) that the alloimmune response to HPA-1a is heterogeneous, and (2) that for at least some maternal anti-HPA-1a antibodies, sequences within the EGF domain of linear distance may be required to form high-affinity antibody binding sites on GPIIIa (as Figure 1A - 1B shown).

[0037] Based on the analysis of three-dimensional structural data of GPIIIa in the molecular region around polymorphic amino acid 33, transgenic mice expressing murine GPIIIa isoforms containing selected humanized residues within the PSI and EGF1 domains are described herein. Binding of a series of monoclonal and polyclonal HPA-1a-specific antibodies to GPIIIa isoforms containing selected humanized residues is also described. This binding shows the complex heterogeneity of the polyclonal alloimmune response to this clinically important human platelet alloantigen system. High-resolution mapping of this alloimmune response may improve the diagnosis of FNAIT and should facilitate the rational design, selection, and / or screening of prophylactic and therapeutic anti-HPA-1a drugs.

[0038] Currently, there is no animal model of FNAIT that can accurately reflect the binding of a wide range of monoclonal and polyclonal antibodies from anti-HPA-1a antisera to GPIIIa (as seen in human FNAIT). In addition, there is no animal model of FNAIT suitable for the design, selection, and screening of prophylactic and therapeutic reagents. This is due to sequence and structural differences between murine and human GPIIIa, resulting in altered binding of monoclonal and polyclonal antibodies.

[0039] This document provides transgenic mice containing humanized mutations of GPIIIa. Due to the mutations in GPIIIa, the mice express variant GPIIIa that binds to monoclonal and polyclonal antibodies from anti-HPA-1a antiserum. This document also provides cells and tissues derived from the transgenic mice. The wild-type mouse GPIIIa sequence is included herein as SEQ ID NO: 25. The transgenic mouse GPIIIa sequence contains at least the T30A, S32P, Q33L, N29D, and M470Q mutations in GPIIIa (SEQ ID NO: 25), resulting in variant GPIIIa being able to bind to anti-HPA-1a antibodies, and in some embodiments, variant GPIIIa being able to bind to monoclonal and polyclonal anti-HPA-1a antibodies. In some embodiments, the variant GPIIIa sequence contains at least one M470Q mutation and a mutation in amino acid residues 22-40 of SEQ ID NO: 25, wherein amino acid residues 22-40 are replaced by the sequence MCAWCSDEALPLGSPRCD (SEQ ID NO: 28), which corresponds to a loop region in the PSI domain and is adjacent to the EGF1 and EGF2 domains of human GPIIIa. In one embodiment, variant GPIIIa is able to bind to the monoclonal antibody 26.4. In some embodiments, the transgenic mice express variant GPIIIa containing the amino acid sequence of SEQ ID NO: 26. In some embodiments, the transgenic mice express variant GPIIIa containing the amino acid sequence of SEQ ID NO: 27. Murine GPIIIa (SEQ ID NO: 25)

[0040]

[0041] Humanized murine GPIIIa variant 1 (SEQ ID NO: 26)

[0042]

[0043]

[0044] Humanized murine GPIIIa variant 2 (SEQ ID NO: 27)

[0045]

[0046] As used herein, the term "variant" refers to a polypeptide having one or more amino acid substitutions, deletions, and / or insertions as compared to a reference sequence. For example, SEQ ID NO: 26 is a variant of SEQ ID NO: 25. The variant GPIIIa can have an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 25, and includes the T30A, S32P, Q33L, N29D, and M470Q mutations relative to SEQ ID NO: 25. In some embodiments, the variant GPIIIa includes the T30A, S32P, Q33L, N29D, and M470Q mutations relative to SEQ ID NO: 25 and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, up to 15, up to 20, up to 25, or up to 30 additional amino acid substitutions relative to SEQ ID NO: 25. In some embodiments, the amino acid substitutions are conservative substitutions.

[0047] As used herein, the term "conservative substitution" refers to the replacement of one or more amino acids with another biologically similar residue. Examples include substitutions of amino acid residues having similar characteristics, such as small amino acids, acidic amino acids, polar amino acids, basic amino acids, hydrophobic amino acids, and aromatic amino acids. For further information on phenotypically silent substitutions in peptides and proteins, see, e.g., Bowie et al., Science 247: 1306-1310 (1990). In the table below, conservative substitutions of amino acids are grouped according to physicochemical properties; I: neutral and / or hydrophilic, II: acids and amides, III: basic, IV: hydrophobic, V: aromatic bulky amino acids.

[0048] Table I

[0049] I II III IV V A N H M F S D R L Y T E K I W P Q V G C

[0050] In the table below, conservative substitutions of amino acids are grouped according to physicochemical properties; VI: neutral or hydrophobic, VII: acidic, VIII: basic, IX: polar, X: aromatic.

[0051] Table II

[0052]

[0053]

[0054] Methods for identifying conservative nucleotide and amino acid substitutions that do not affect protein function are well known in the art (see, e.g., Brummell et al., Biochem. 32:1180-1187 (1993); Kobayashi et al., Protein Eng. 12(10):879-884 (1999); and Burks et al., Proc. Natl. Acad. Sci. U.S.A. 94:412-417 (1997)).

[0055] In the context of two or more nucleic acids or polypeptides, the terms "identical" or "identity" percent refers to two or more sequences or subsequences that have the same or a specified percentage of the same nucleotide or amino acid residues when compared and aligned (introducing gaps if necessary) to obtain maximum correspondence, without regard to any conservative amino acid substitutions as part of sequence identity. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection. A variety of algorithms and software are known in the art for obtaining amino acid or nucleotide sequence alignments.

[0056] One such non-limiting example of a sequence alignment algorithm is described in Karlin et al., Proc. Natl. Acad. Sci., 87:2264-2268 (1990), modified as in Karlin et al., Proc. Natl. Acad. Sci., 90:5873-5877 (1993) and incorporated into the NBLAST and XBLAST programs (Altschul et al., Nucleic Acids Res., 25:3389-3402 (1991)). In certain embodiments, gapped BLAST can be used as described in Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997). BLAST-2, WU-BLAST-2 (Altschul et al., Methods in Enzymology, 266:460-480 (1996)), ALIGN, ALIGN-2 (Genentech, South San Francisco, California) or Megalign (DNASTAR) are additional publicly available software programs that can be used for sequence alignment. In certain embodiments, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (e.g., using the NWSgapdna.CMP matrix with a gap weight of 40, 50, 60, 70 or 90 and a length weight of 1, 2, 3, 4, 5 or 6). In certain alternative embodiments, the GAP program in the GCG software package, in conjunction with the algorithm of Needleman and Wunsch (J. Mol. Biol. (48):444-453 (1970)), can be used to determine the percent identity between two amino acid sequences (e.g., using the BLOSUM62 matrix or the PAM250 matrix and a gap weight of 16, 14, 12, 10, 8, 6 or 4 and a length weight of 1, 2, 3, 4, 5). Alternatively, in certain embodiments, the percent identity between nucleotide or amino acid sequences is determined using the algorithm of Myers and Miller (CABIOS 4:11-17 (1989)). For example, the ALIGN program (version 2.0) can be used with the PAM120 with a residue table (gap length penalty of 12 and gap penalty of 4) to determine the percent identity. Those skilled in the art can determine the appropriate parameters for maximum alignment through specific alignment software. In certain embodiments, the default parameters of the alignment software are used.Other resources for calculating identity include the methods described in the following literature: Computational Molecular Biology (edited by Lesk, 1988); Biocomputing: Informatics and Genome Projects (edited by Smith, 1993); Computer Analysis of Sequence Data, Part 1 (edited by Griffin and Griffin, 1994); Sequence Analysis in Molecular Biology (G. von Heinje, 1987); Sequence Analysis Primer (edited by Gribskov et al., 1991); and Carillo et al., SIAM J. Applied Math., 48: 1073 (1988).

[0057] As used herein, a "transgenic animal" refers to a non-human animal, such as a mammal, typically a rodent, such as a rat or a mouse, in which one or more (preferably all) cells of the animal contain a transgene as described herein. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, etc. As used herein, a "transgene" refers to foreign DNA that has been integrated into the genomic DNA of cells during the development of a transgenic animal and is thus retained in the genome of the mature animal, such that the encoded gene product is expressed in one or more cell types or tissues of the transgenic animal. Gene knockout animals are included within the definition of transgenic animals.

[0058] Methods for producing transgenic animals, particularly animals such as mice, by embryo manipulation and electroporation or microinjection of pluripotent stem cells or oocytes are known in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009, U.S. Patent No. 4,873,191, U.S. Serial No. 10 / 006,611, "Transgenic Mouse Methods and Protocols (Methods in Molecular Biology)" (Humana Press, Totowa, N.J., 2002) edited by Hofker and van Deursen; and "Manipulating the Mouse Embryo" (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2002) edited by Nagy et al., the entire contents of which are incorporated herein by reference.

[0059] Generally, transgenic mice as described herein are prepared by injecting a vector prepared as described herein into the pronucleus or cytoplasm of a fertilized mouse oocyte and used to generate transgenic mice having mutations of T30A, S32P, Q33L, N39D, and M470Q in GPIIIa relative to SEQ ID NO: 25 in all cells using standard transgenic techniques such as those described in "Transgenic Mouse Methods and Protocols (Methods in Molecular Biology)," edited by Hofker and van Deursen (Humana Press, Totowa, N.J., 2002); U.S. Patent Nos. 4,736,866 and 4,870,009, U.S. Patent Nos. 4,873,191 and 6,791,006, and in Hogan, "Manipulating the Mouse Embryo," edited by Nagy et al. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2002).

[0060] Methods of gene mutation are known in the art. See, for example, U.S. Patent No. 7,022,893 to Takeda et al., U.S. Patent No. 6,218,595 to Giros et al., and U.S. Patent No. 6,344,596 to W. Velander et al. (American Grey Cross); U.S. Patent No. 6,339,183 to T.T. Sun (New York University); U.S. Patent No. 6,331,658 to D. Cooper and E. Koren; U.S. Patent No. 6,255,554 to H. Lubon et al. (American National Grey Cross; Virginia Polytechnic Institute); U.S. Patent No. 6,204,431 to P. Prieto et al. (Abbott Laboratories); U.S. Patent No. 6,166,288 to L. Diamond et al. (Nextran Inc., Princeton, N.J.); U.S. Patent No. 5,959,171 to J.M. Hyttinin et al. (Pharming BV); U.S. Patent No. 5,880,327 to H. Lubon et al. (American Grey Cross); U.S. Patent No. 5,639,457 to G. Brem; U.S. Patent No. 5,639,940 to I. Garner et al. (Pharmaceutical Proteins Ltd.; Zymogenetics Inc); U.S. Patent No. 5,589,604 to W. Drohan et al. (American Grey Cross); U.S. Patent No. 5,602,306 to Townes et al. (UAB Research Foundation); U.S. Patent No. 4,736,866 to Leder and Stewart (Harvard); and U.S. Patent No. 4,873,316 to Meade and Lonberg (Biogen).

[0061] In some embodiments, transgenic mice as described herein are generated using CRISPR / Cas9-mediated homology-directed repair (HDR). See, e.g., Wang et al. (“One-step generation of mice carrying mutations in multiple genes by CRISPR / Cas-mediated genome editing”, Cell, 2013, 153(4): 910-918). To mutate GPIIIa and generate transgenic mice, a vector encoding i) Cas9 nuclease and ii) a guide RNA (gRNA) targeting the region of interest and located upstream of the protospacer adjacent motif (PAM) site and a single-stranded oligodeoxynucleotide (ssODN) homology-directed repair template are injected into the pronucleus or cytoplasm of fertilized murine oocytes. In some embodiments, the isolated gRNA, ssODN HDR template, and Cas9 nuclease are injected into the pronucleus or cytoplasm of fertilized murine oocytes. In some embodiments, the vector contains a reporter gene or a selectable marker.

[0062] In some embodiments, the gRNA targets murine ITGB3 exon 3 and the ssODN HDR template encodes GPIIIa T30A, S32P, Q33L, and N39D mutations. In some embodiments, the gRNA targeting murine ITGB3 exon 3 has the sequence 5′-TTCTCCTTCAGGTTACATCG-3’ (SEQ ID NO: 1). In some embodiments, the ssODN HDR template encoding GPIIIa T30A, S32P, Q33L, and N39D mutations has the sequence 5′-GCCAGGGGGAGGTGACTTACCAGGCAGGAGGCACAGCCGCCCTAGCTCTGATGTTGACCTTTCCCTCGGGCTCTTCTCTTCATAGGCCTTGCCTCTGGGATCCCCACGCTGTGACCTGAAGGAGAACCTGCTGAAGGACAATTGTGCTCCAGAGTCTATTGAGTTCCCAGTCAGTGAGGCCCAGATCCTGGAGGCTAGGC-3’ (SEQ ID NO: 4). In some embodiments, the ssODN HDR template encodes a silent mutation that introduces a diagnostic restriction site. In some embodiments, the ssODN HDR template encodes a silent mutation in the target gene of interest to silence repeated digestion of the resulting mutant gene by Cas9.

[0063] The murine ITGB3 gene sequence can be obtained from NCBI Gene ID: 16416 and GenBank NC_000077.6. Genomic nucleotide mutations corresponding to the A30, P32, L33, D39, and Q470 mutations in ITGB3 are outlined in FIGS. 2B and 6B.

[0064] In some embodiments, the gRNA targets exon 10 of ITGB3 and the ssODN HDR template encodes the GPIIIa M470Q mutation. In some embodiments, the gRNA targeting murine ITGB3 exon 10 has the sequence 5′-CTCCTCAGAGCACTCACACA-3′ (SEQ ID NO: 7). In some embodiments, the ssODN HDR template encoding the GPIIIa M470Q mutation has the sequence 5′-AGCCTTCCAGCCCACGCTGCAACAATGGGAACGGGACTTTTGAGTGTGGGGTGTGCCGCTGTGACCAGGGCTGGCTGGGGTCCCAATGCGAGTGCTCTGAGGAGGATTACCGACCCTCTCAGCAGGAAGAGTGCAGCCCCAAGGAGGGCCAGCCCATCTGCAGCCA-3′ (SEQ ID NO: 8). In some embodiments, the ssODN HDR template encodes a silent mutation that introduces a diagnostic restriction site. In some embodiments, the ssODN HDR template encodes a silent mutation in the target gene of interest to silence repeated digestion of the resulting mutant gene by Cas9.

[0065] Transgenic founder animals can be identified based on the presence of the T30A, S32P, Q33L, N29D, and M470Q mutations in GPIIIa. The presence of the mutations can be detected directly, for example, by PCR amplification or sequencing of the target region of the GPIIIa gene. The transgenic founder animals can then be mated with additional animals carrying the transgene. In addition, transgenic animals carrying the T30A, S32P, Q33L, N29D, and M470Q mutations in GPIIIa can be further mated with other transgenic animals carrying other transgenes.

[0066] The transgenic animals described herein, as well as cells and tissues derived from the transgenic animals, can be used to identify and study factors that are capable of binding to variant GPIIIa (e.g., monoclonal or polyclonal anti-HPA-1a antibodies or fragments thereof). In some embodiments, the transgenic animals described herein can be used to characterize test factors that are useful in the treatment or prevention of RPT, PTP, or FNAIT, for example, by monitoring platelet counts, platelet concentrations, bleeding, or the pharmacokinetics of the test factor.

[0067] Screening methods

[0068] The present invention provides in vitro and in vivo screening methods. One embodiment is an in vitro method for identifying molecules that can specifically bind to variant glycoprotein IIIa (GPIIIa). In one aspect of this embodiment, a candidate molecule is contacted with platelets from a transgenic mouse whose genome contains a nucleic acid encoding variant GPIIIa, wherein the variant GPIIIa contains the mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25. If the candidate molecule binds to platelets from the transgenic mouse but does not bind to platelets from a wild-type mouse or a mouse that does not contain variant GPIIIa, the candidate molecule can be considered to specifically bind to variant GPIIIa.

[0069] Platelet binding can be measured qualitatively or quantitatively by known methods, including flow cytometry, immunohistochemistry, radioimmunoassay, ELISA, fluorescence resonance energy transfer (FRET), biolayer interferometry, and surface plasmon resonance.

[0070] Another in vitro method can identify molecules that can compete with an anti-HPA-1a antibody for binding to the variant GPIIIa of the present invention. In one embodiment, the method includes (a) contacting the variant GPIIIa with the anti-HPA-1a antibody to form a GPIIIa-antibody complex, wherein the variant GPIIIa is immobilized on a substrate and wherein the anti-HPA-1a antibody contains a label; (b) contacting the GPIIIa-antibody complex with a candidate molecule in solution; and (c) determining whether the candidate molecule competes with the anti-HPA-1a antibody for binding to the variant GPIIIa by detecting the amount of label on the substrate or in the solution. The candidate molecule competes with the antibody by binding to the variant GPIIIa and preventing the binding of the antibody. A positive result in the assay indicates that the binding site of the candidate molecule to GPIIIa overlaps or contains the epitope on GPIIIa to which the antibody binds. In a specific embodiment, the variant GPIIIa contains the amino acid sequence shown in SEQ ID NO: 26.

[0071] A "label" is a detectable compound that can be conjugated directly or indirectly to a molecule to produce a labeled molecule. The label can be directly detectable (e.g., a radioisotope label or a fluorescent label) or can be indirectly detected, such as by catalyzing a chemical change in a detectable substrate compound or composition (e.g., an enzyme label) or by other indirect detection means (e.g., biotinylation). In one embodiment, the label is selected from the group consisting of fluorophores, radioisotopes, chemiluminescent probes, and bioluminescent probes.

[0072] Inhibition (i.e., competition) of a candidate molecule against HPA-1a antibody binding can be determined by detecting the presence or absence of a label. For example, if the method is carried out by chromatography, the presence of the label in the eluate indicates that the candidate molecule competes for binding to variant GPIIIa; the absence of the label indicates that the antibody remains / binds to immobilized GPIIIa (i.e., no competition or limited competition). Alternatively, it can be analyzed whether the label is present on a substrate to which the antibody is immobilized, where the presence of the label indicates limited or no competition by the candidate molecule, and the absence of the label indicates that the candidate molecule has bound to GPIIIa and prevented antibody binding (i.e., competition). I

[0073] In certain embodiments, the HPA-1a antibody is a monoclonal antibody selected from the group consisting of PSIB1, SZ21, and 26.4. In a specific embodiment, the anti-HPA-1a antibody is 26.4.

[0074] Variant GPIIIa can be immobilized on any porous or non-porous substrate known in the art. Non-limiting examples of immobilized substrates include beads, resins, particles, membranes, and gels. The substrate can be composed of a variety of materials, including agarose, alginate, glass, and magnetic materials. Any known method can be used to achieve immobilization, such as adsorption, affinity tag binding, or covalent bonding.

[0075] In the in vivo method provided by the present invention, there is a method for identifying a molecule capable of preventing anti-HPA-1a alloimmune response in female mice. In one embodiment, the method includes administering a candidate molecule to a test mouse, wherein the test mouse is pregnant with a wild-type platelet membrane glycoprotein IIIa (GPIIIa) complex containing variant GPIIIa heterozygous for mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25, and wherein the test mouse is negative for anti-HPA-1a antibody; and measuring the anti-HPA-1a antibody titer of the test mouse. If the anti-HPA-1a antibody titer in the test mouse is undetectable at the time of parturition, one week, two weeks, three weeks, four weeks, five weeks, six weeks, seven weeks, eight weeks, nine weeks, and / or ten weeks postpartum, the candidate molecule is capable of preventing anti-HPA-1a alloimmune response.

[0076] The present invention also provides an in vivo method for identifying a molecule capable of inhibiting the passage of anti-HPA-1a alloantibodies through the placenta of pregnant mice. In one embodiment, the method comprises administering a candidate molecule to a test mouse, wherein the test mouse is pregnant with pups that are heterozygous for a variant GPIIIa that is wild-type platelet membrane glycoprotein IIIa (GPIIIa) complex comprising the mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25, and wherein the test mouse is immunized prior to pregnancy with (i) platelets from a transgenic mouse as described herein or (ii) a variant GPIIIa comprising the mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25; and measuring the fetal or neonatal anti-HPA-1a antibody titer. If the fetal or neonatal antibody titer of the pups of the test mouse is lower than the fetal or neonatal antibody titer of the pups of a control mouse, the candidate molecule is capable of inhibiting the passage of anti-HPA-1a alloantibodies through the placenta of pregnant mice.

[0077] Also provided is an in vivo method for identifying a molecule capable of inhibiting the binding of anti-HPA-1a alloantibodies to fetal or neonatal platelets. In one embodiment, the method comprises administering a candidate molecule to a test mouse, wherein the test mouse is pregnant with pups that are heterozygous for a variant GPIIIa that is wild-type platelet membrane glycoprotein IIIa (GPIIIa) complex comprising the mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25, and wherein the test mouse is immunized prior to pregnancy with (i) platelets from a transgenic mouse as described herein or (ii) a variant GPIIIa comprising the mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25; and measuring the fetal or neonatal platelet count. If the fetal or neonatal platelet count of the pups of the test mouse is higher than the fetal or neonatal platelet count of the pups of a control mouse, the candidate molecule is capable of inhibiting the binding of anti-HPA-1a alloantibodies to fetal or neonatal platelets.

[0078] As used herein, "control mouse" refers to a mouse that includes the same conditions as the test mouse being compared and is evaluated in the same manner and over the same time period as the test mouse being compared, except that the control mouse is not treated with the candidate molecule. For example, when the test mouse is pre-immunized with platelets from a transgenic mouse of the present invention or with a GPIIIa variant of the present invention prior to pregnancy, the control mouse is pre-immunized under the same conditions. Similarly, in the method of the present invention, in which the test mouse bears a wild-type GPIIIa complex and heterozygous pups that are variant GPIIIa containing mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25, the control mouse also bears heterozygous pups. In cases where certain parameters and / or results are measured and / or compared between the test mouse and the control mouse, the measurements or evaluations are performed using the same technique / assay under the same conditions. To obtain pregnancies of heterozygous pups, wild-type female mice are mated with transgenic male mice of the present invention.

[0079] The method according to the present invention can screen a variety of candidate molecules. As used herein, a "candidate molecule" can be any chemical compound. Examples of candidate compounds include macromolecules such as peptides, polypeptides, protein complexes, glycoproteins, antibodies, oligonucleotides, and nucleic acids, as well as small molecules such as amino acids, nucleotides, organic compounds, inorganic compounds, and organometallic compounds. Candidate molecules can be naturally occurring, synthetic, or can include both natural and synthetic components.

[0080] Antibodies used or screened in the method of the present invention can include human antibodies, humanized antibodies, chimeric antibodies, monoclonal antibodies, polyclonal antibodies, recombinant antibodies, bispecific antibodies, multispecific antibodies, and antigen-binding fragments thereof. Antigen-binding fragments include Fv, F(ab), F(ab’), and F(ab’)2. Also included are single-chain forms of each of the foregoing antibodies and antigen-binding fragments.

[0081] In some embodiments, the candidate molecule can be a member of a library, such as an inorganic or organic chemical library, a peptide library, an oligonucleotide library, an antibody library, or a library of mixed molecules. In some embodiments, the method includes screening small molecules, such as members of a natural product or combinatorial chemistry library.

[0082] In cases where the candidate molecule is part of a library (such as a library comprising antibodies or antigen-binding fragments thereof), the variant GPIIIa of the present invention can be used in epitope binning assays. Epitope binning is a competitive immunoassay that can be used to characterize and sort libraries of monoclonal antibodies against a target antigen (such as a protein comprising the amino acid sequence shown in SEQ ID NO: 26). Antibodies against a similar target are tested against all other antibodies in the library in a pairwise manner to determine whether the antibodies block the binding to the antigen epitope from each other. For all other antibodies in the library, a competitive blocking pattern for each antibody is created. Closely related epitope binning profiles indicate antibodies that have the same or closely related epitopes and are "picked" together. (See, for example, Brooks B.D., Curr. Drug Discovery Technol. 11: 109-112 (2014); Estep P. et al., MAbs 5: 270-278 (2013)). Epitope binning is also known in the art as epitope mapping or epitope characterization.

[0083] The candidate molecule can be administered by methods known in the art, for example, by any of oral, parenteral, inhaled, or topical routes. Parenteral administration includes, for example, intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal, and vaginal administrations. Oral dosage forms include, for example, solid, liquid, and suspension formulations. Oral gavage is a preferred form of oral administration. Nasal aerosol or inhaled dosage forms can be prepared, for example, as saline solutions, using benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, and / or other conventional solubilizers or dispersants. The candidate molecule can be administered in a composition comprising a buffer (such as acetate, phosphate, or citrate buffer), optionally a surfactant (such as polysorbate), optionally a stabilizer (such as human albumin), etc. The form and characteristics of the carrier or diluent can be determined by the amount of the active ingredient combined therewith, the route of administration, and other well-known variables. Those skilled in the art can readily determine the appropriate route and dosage form according to the structure and properties of the candidate molecule. The dose of the candidate molecule can be determined empirically by a skilled person.

[0084] According to the method of the present invention, the candidate molecule can be administered one or more times at time points before pregnancy, during pregnancy, and after childbirth. For example, the candidate molecule can be administered one or more times between 1 to 14 days before mating, between 1 to 24 days after mating, and / or between 1 to 28 days after childbirth. In one embodiment, the candidate molecule is administered on the 10th and 17th days after mating. A person of ordinary skill in the art can determine the dosing regimen empirically, which depends on the candidate molecule and the specific effect for which it is being screened.

[0085] In some methods of the present invention, female mice are immunized with variant GPIIIa prior to pregnancy to induce the production of anti-HPA-1a antibodies. In some embodiments, the immunization comprises administering platelets from transgenic mice expressing variant GPIIIa, which variant GPIIIa comprises the mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25. In some embodiments, the immunization comprises administering variant GPIIIa (e.g., comprising the mutations T30A, S32P, Q33L, N29D, and M470Q relative to SEQ ID NO: 25). Administration is by known methods, preferably by injection. For example, one or more immunizations can be performed between 1 and 14 days prior to mating, during the gestation period of the mice, or after the pups are born. In some embodiments, one or more pre-immunizations are performed between 1 and 14 days prior to mating.

[0086] In certain methods of the present invention, maternal, fetal, and / or neonatal anti-HPA-1a antibody titers are measured. Antibody titers can be measured in samples from adult mice, neonatal mice, or fetal mice. Antibody titers can be measured by known methods, including chemiluminescent microparticle immunoassay (CMIA), enzyme immunoassay (EIA), radioimmunoassay (RIA), fluorescence-activated cell sorting (FACS), lateral flow chromatography, enzyme-linked immunosorbent assay (ELISA), and the like. For example, antibody titers can be measured by coating a surface (e.g., beads, microtiter plates, or microparticles) with an appropriate antigen (e.g., HPA-1a) that is labeled, reacting the antigen with the sample to be analyzed, and then measuring the intensity of the label. Indirect immunoassays can also be used. In one embodiment, antibody titers are measured using a single antigen bead assay. In one embodiment, antibody titers are expressed as mean fluorescence intensity (MFI) values.

[0087] According to the screening assay, antibody titers can be evaluated at one or more time points. For example, antibody titers can be measured between 1 and 14 days prior to mating, between 1 and 24 days after mating, and / or between 1 and 28 days postpartum in female mice. For example, antibody titers of neonatal pups can be measured immediately after parturition, at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 hours after parturition, and / or at 1, 2, 3, 4, 5, and / or 6 days after parturition, and / or at 1, 2, 3, and / or 4 days after parturition. For example, antibody titers of fetuses can be measured at gestational days 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, and / or 22. In some embodiments, antibody titers of adult, neonatal, or fetal mice are measured at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 16, 18, 20, 24, 30, 36, 42, and / or 48 hours, and / or at 1, 2, 3, 4, 5, and / or 6 days, and / or at 1, 2, 3, or 4 weeks after administration of the candidate molecule to the mother.

[0088] In some methods of the invention, fetal or neonatal platelet counts are measured in blood collected from dissected fetuses or from neonates. Platelet counts can be manually calculated using a hemocytometer or can be measured by automated methods such as optical light scattering / fluorescence analysis, flow cytometry, or impedance analysis. According to the screening assay, platelet counts can be determined at one or more time points. For example, platelet counts of neonatal pups can be measured immediately after parturition, at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 hours after parturition, and / or at 1, 2, 3, 4, 5, and / or 6 days after parturition, and / or at 1, 2, 3, and / or 4 days after parturition. For example, platelet counts of fetuses can be measured at gestational days 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, and / or 22. In some embodiments, platelet counts of fetal or neonatal pups are measured at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 16, 18, 20, 24, 30, 36, 42, and / or 48 hours, and / or at 1, 2, 3, 4, 5, and / or 6 days, and / or at 1, 2, 3, or 4 weeks after administration of the candidate molecule to the mother.

[0089] In some aspects of the invention, fetal or neonatal pup bleeding is evaluated. As used herein, "bleeding" means the accumulation of blood in the body cavities, extremities, or skull of a fetal or neonatal pup. In one embodiment, the bleeding is intracranial hemorrhage. Bleeding can be visually evaluated in dissected fetuses or neonates.

[0090] One of ordinary skill in the art can determine the evaluation protocol, such as the measurement of antibody titer, platelet count, bleeding, etc., which can be determined empirically and depends on the candidate molecule and its specific role being screened.

[0091] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. All definitions defined and used herein should be understood to control dictionary definitions, definitions in incorporated documents by reference, and / or the ordinary meaning of the defined terms.

[0092] All references, patents, and patent applications disclosed herein are incorporated by reference into each of the cited subject matter, and in some cases, such subject matter may cover the entire content of the entire document. Additionally, any manufacturer's instructions or catalogs for any product cited or mentioned herein are incorporated by reference. The documents or any teachings therein incorporated by reference can be used in the practice of this invention. The documents incorporated by reference herein are not admitted to be prior art.

[0093] The indefinite articles "a / an" used in the specification and claims should be understood to mean "at least one" unless clearly indicated to the contrary.

[0094] The phrase "and / or" used herein in the specification and claims should be understood to mean "either or both" of the elements so combined, i.e., the elements exist jointly in some cases and separately in other cases. Multiple elements listed with "and / or" should be interpreted in the same way, i.e., "one or more" of such combined elements. Other elements may optionally exist in addition to those specifically identified by the "and / or" clause, whether related or unrelated to those specifically identified. Thus, as a non-limiting example, when used in conjunction with open-ended language such as "comprising", a reference to "A and / or B" can, in one embodiment, refer only to A (optionally including elements other than B); in another embodiment, it can refer only to B (optionally including elements other than A); in yet another embodiment, it can refer to both A and B (optionally including other elements), etc.

[0095] As used in this specification and the claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" should be understood as inclusive, i.e., including at least one, and also including more than one of several or a series of elements, as well as optionally additional unlisted items. Only terms that explicitly indicate the contrary (such as "only one" or "exactly one") or when used in the claims, "consisting of" will refer to including exactly one element of several or a series of elements. Generally, the term "or" as used herein should only be understood to represent an exclusive alternative (i.e., "one or the other, but not both") before exclusive terms such as "either", "one of", "only one", or "exactly one". When used in the claims, "consisting essentially of" should have the ordinary meaning used in the field of patent law.

[0096] Whenever an embodiment is described in terms of "comprising", other similar embodiments described in terms of "consisting of" and / or "consisting essentially of" are included.

[0097] As used herein, the numerical terms "about" or "approximately" generally include numbers within 5% in either direction (greater than or less than) of the number, unless otherwise stated or apparent from the context (unless such a number exceeds 100% of the possible value).

[0098] Numeric ranges include the numbers defining the range, and any single value provided herein can be used as the endpoint of a range including other single values provided herein. For example, a set of values (such as 1, 2, 3, 8, 9, and 10) is also a disclosure of numeric ranges such as 1 - 10, 1 - 8, 3 - 9, etc. Similarly, the disclosed range is a disclosure of each individual value covered by the range. For example, the stated range of 5 - 10 is also a disclosure of 5, 6, 7, 8, 9, and 10.

[0099] The present invention has been described in accordance with one or more preferred embodiments, and it should be understood that many equivalents, alternatives, variations, and modifications are possible and within the scope of the present invention, in addition to those explicitly stated.

[0100] Example

[0101] Example 1

[0102] The embodiments described herein demonstrate the generation of a murine model of FNAIT using CRISPR / Cas9-mediated homology-directed repair. Specifically, this embodiment demonstrates the generation of transgenic mice containing mutations of T30A, S32P, Q33L, N29D, and M470Q in GPIIIa relative to SEQ ID NO: 25.

[0103] Materials and Methods

[0104] Antibodies - Three antibodies specific for the Leu 33 allelic variant of human GPIIIa were used in this study: murine monoclonal antibody (mAb) SZ21 20 , human mAb 26.4 21 (derived from immortalized B cells of an HPA-1a alloimmunized woman whose infant had FNAIT), and B2G1 22 (humanized IgG, derived from an scFv fragment isolated from an HPA-1a alloimmunized woman by phage display). Human maternal anti-HPA-1a antiserum was provided by Drs. Richard Aster, Dan Bougie, and Brian Curtis (Blood Research Institute, BloodCenter of Wisconsin, Milwaukee, WI). Murine mAb PSIB1, which binds both human and murine β3 integrin PSI domains and whose binding is not affected by the Leu33Pro polymorphism 23 , was kindly provided by Dr. Heyu Ni (University of Toronto). mAb AP2, which recognizes a complex-dependent epitope on GPIIb-IIIa but does not interfere with HPA-1a antibody binding 24 , was provided by Dr. Robert Montgomery (BloodResearch Institute, BloodCenter of Wisconsin).

[0105] One-step generation of mice expressing a humanized form of APLD for murine GPIIIa-gRNA was designed using the CRISPR design tool (crispr.mit.edu) to minimize off-target effects and selected before the 5'-NGG protospacer adjacent motif (PAM). To generate a vector co-expressing Cas9 and an sgRNA targeting exon 3 of ITGB3 (TTCTCCTTCAGGTTACATCG, SEQ ID NO: 1), a pair of oligonucleotides (5’-CACCGTTCTCCTTCAGGTTACATCG-3’ (SEQ ID NO: 2) and 5'-AAACCGATGTAACCTGAAGGAGAAC-3’ (SEQ ID NO: 3)) were annealed and cloned into the BbsI site of the Cas9 expression plasmid px459 (Addgene, Cambridge, MA). A single-stranded oligodeoxynucleotide (ssODN) with a length of 200 nucleotides having the sequence 5′-GCCAGGGGGAGGTGACTTACCAGGCAGGAGGCACAGCCGCCCTAGCTCTG-ATGTTGACCTTTCCCTCGGGCTCTTCTCTTCATAGGCCTTGCCTCTGGGATCCCCACGCTGTGACCTGAAGGAGAACCTGCTGAAGGACAATTGTGCTCCAGAGTCTATTGAGTTCCCAGTCAGTGAGGCCCAGATCCTGGAGGCTAGGC-3′ (SEQ ID NO: 4) was synthesized by Integrated DNA Technologies (IDT, Coralville, IA). This oligonucleotide corresponds to the antisense strand of the murine β3 gene and contains 5 nucleotide substitutions, resulting in the introduction of 4 human amino acid substitutions in the PSI domain of the murine β3 integrin subunit. The ssODN also contains four silent mutations, two of which introduce a diagnostic BamH1 restriction site into the plasmid and two mutant sequences to avoid repeated digestion of the humanized murine β3 gene by Cas9.

[0106] Superovulated C57BL / 6N female mice were mated with C57BL / 6N male mice, and fertilized eggs were collected from the oviducts. The px459 plasmid (10 ng / μl) and ssODN (5 ng / μl) were injected into the pronuclei of fertilized oocytes. The injected fertilized eggs were cultured overnight at 37 °C in potassium simplex optimized medium (KSOM) containing amino acids in 5% CO2 and 95% humidified air. Then, two-cell stage embryos were transferred into the oviducts of pseudopregnant female mice. Genomic DNA isolated from the tails of the pups was genotyped by PCR and subsequent sequence analysis. The region surrounding the target locus was amplified using GPIIIa fw1: 5′-AACCATGGAAGGACCATGAC-3′ (SEQ ID NO: 5) and GPIIIa rev1: 5′-CACCCCAGTCCTATCCTG-TG-3′ (SEQ ID NO: 6). The PCR reaction was carried out using Herculase II fusion polymerase (Agilent, Waldbronn, Germany). The PCR products were purified using QiaQuick spin columns, digested with BamHI (New England Biolabs Inc., Ipswich, MA), analyzed on a 2% agarose gel, and sequenced to confirm that the DNA double-strand break had been accurately repaired.

[0107] One-step generation of mice expressing the APLDQ humanized form of murine GPIIIa - The CRISPR / Cas9 microinjection mixture (including gRNA (CTCCTCAGAGCACTCACACA, (SEQ ID NO: 7)), ssODN 5′-AGCCTTCCAGCCCACGCTGCAACAATGGGAACGGGACTTTTGAGTGTGGGGTGTGCCGCTGTGACCAGGGCTGGCTGGGGTCCCAATGCGAGTGCTCTGAGGAGGATTACCGACCCTCTCAGCAGGAAGAGTGCAGCCCCAAGGAGGGCCAGCCCATCTGCAGCCA-3′

[0108] (SEQ ID NO: 8) and Cas-9 protein) was injected into the cytoplasm of fertilized APLD GPIIIa oocytes ( Figure 6A - 6D)。The mice born by microinjection were screened for the desired point mutations by PCR and subsequent sequencing analysis. The regions surrounding the target locus were amplified using GPIIIafw2: 5'-GAGAAGGAGCAGTCTTTCACTATCAAGCC-3' (SEQ ID NO: 9) and GPIIIa rev2: 5'-GCAGGAGAAGTCATCGCACTCAC-3' (SEQ ID NO: 10).

[0109] Amino acid substitutions were introduced into murine and human GPIIIa plasmids - the cDNA expression vector pCMV3 - murine ITGB3 encoding murine GPIIIa was purchased from Creative Biogene (Shirley, NY). Nucleotide substitutions were introduced into this plasmid using the Quick-Change site-directed mutagenesis kit (Stratagene, La Jolla, CA) to convert to T 30 →A, S 32 →P, Q 33 →L and N 39 →D, generating a plasmid encoding murine GPIIIa (containing a fully humanized PSI domain, designated APLD murine GPIIIa). Using this as a template, additional mutations were introduced into the codons encoding M 470 and P 446 in the murine EGF1 domain to humanize them to Q 470 and H 446 , respectively, and the resulting constructs were designated APLDQ, APLDH, and APLDQH. Conversely, G 463 P 464 →DQ, H 446 →P and Q 470 →M mutations were introduced into the human ITGB3 expression vector pcDNA3 - human ITGB3 to generate a plasmid encoding human GPIIIa that has D 463 Q 464 、P 446 or M 470 in the human EGF1 domain. The primers used to introduce these mutations are listed in Table 1. All constructs and mutations were confirmed by nucleotide sequencing.

[0110] Table 1: Oligonucleotide primers for site-directed mutagenesis

[0111]

[0112]

[0113] The altered sequences are shown in bold.

[0114] Expression of wild-type and mutant αIIbβ3 isoforms - HEK 293FT cells were transfected with a plasmid encoding human αIIb together with a plasmid encoding wild-type or mutant murine or human GPIIIa. One day before transfection, HEK 293FT cells were grown in 6-well plates of DMEM containing 10% FBS but no antibiotics to obtain 80%-90% confluence at the time of transfection. Cells were transfected with 1 μg of each plasmid and 5 μL of Lipofectamine 2000 (Invitrogen) in 250 μL of Opti-MEM I reduced-serum medium. After transfection, the cells were grown for an additional 48 hours at 37°C to allow protein expression.

[0115] Flow cytometry - At 48 hours after transfection, flow cytometry analysis of antibodies bound to transiently transfected HEK293 cells was performed using a FACSCanto II or Accuri C6 flow cytometer (BD Biosciences). Untransfected cells were used as negative controls. When appropriate, antibody binding was detected using FITC-labeled goat (Fab′)2 anti-human IgG, FITC-labeled goat (Fab′)2 anti-mouse IgG. Data were analyzed using FlowJo software (Tree Star Inc., Ashland, OR).

[0116] Inhibition of PAC-1 binding to human α IIb β3 by anti-HPA-1a alloantibodies - HEK293FT cells were transfected with wild-type human αIIbβ3 plus EGFP. The cells were pre-incubated with mAb SZ21, B2G1 or 26.4 (at 2.5 μg / ml), or with purified total IgG from normal control, PTP or FNAIT samples (at a dilution of 1:50) for 30 minutes at room temperature, and then incubated for an additional 30 minutes after adding 2.5 μg / ml PAC-1 containing 0.2 mM Ca +2 and 2 mM Mn +2 The cells were stained with murine mAb AP3 separately to detect total β3 surface expression, so as to normalize the binding and competition data. After staining with Alexa Fluor 647-conjugated goat anti-mouse IgM (for PAC-1) or Alexa Fluor 647-conjugated goat anti-mouse IgG (for AP3), EGFP-positive cells were analyzed by flow cytometry. The mean fluorescence intensity (MFI) of PAC-1 binding was normalized to β3 expression and expressed as a percentage of the control in the absence of anti-HPA-1a alloantibodies.

[0117] Modified antigen capture enzyme-linked immunosorbent assay - 8×10 7One washed human or murine platelet was incubated with human FNAIT allosera (diluted 1:5) for 1 hour at room temperature, washed, and then lysed in 200 μl of ice-cold lysis buffer [20 mM Tris (pH 7.4), 150 mM NaCl, 1% Triton V-100, 1 mM ethylenediaminetetraacetic acid, 10 mM N-ethylmaleimide] containing protease inhibitor cocktail (Thermo Fisher Scientific, Waltham, MA). The lysate was added to microtiter wells coated with anti-mouse CD41 (eBioscience, San Diego, CA) to capture immune complexes from murine platelets, or to microtiter wells coated with mAb AP2 to capture immune complexes from human platelets. Bound immune complexes were detected using alkaline phosphatase-conjugated anti-human IgG (Jackson ImmunoResearch Laboratories, West Grove, PA).

[0118] Molecular modeling and docking - Models of the B2G1 Fab variable regions were generated using the Rosetta Antibody Protocol 25-29 . The structures of the PSI and I-EGF1 domains from the crystal structure of αIIbβ3 30 (PDB code: 3FCS) were docked into the CDR loop regions of the antibody B2G1 using the ClusPro protein-protein docking server 31-35 . Residues A30, P32, and L33 were defined as the docking sites on integrin β3. The non-complementary determining regions were automatically masked using the "Antibody mode" 36 .

[0119] Statistical analysis - Data are shown as mean ± SEM. Statistical comparisons were performed using unpaired two-tailed Student's t-tests. Differences were considered statistically significant at P < 0.05.

[0120] Results

[0121] Reconstitution of the HPA-1a epitope in the PSI domain of murine platelet GPIIIa - As Figure 1A - 1B shown in and Figure 2A, the polymorphic amino acid Leu 33 is located at the end of a long flexible loop extending from the PSI domain of GPIIIa. Previous studies incorporated a series of amino acid substitutions into a small construct consisting of murine GPIIIa N-terminal residues 1-66, demonstrating the requirement for humanized T30 A , S32 P , Q33 L , and N39 D(as shown in Figure 2A) to reconstitute the binding of the type I HPA-1a selective mAb SZ21 to at least several human polyclonal anti-HPA-1a alloantisera 37 Based on these data, a CRISPR strategy was designed (Figure 2B) to introduce a repair template into exon 3 of the murine ITGB3 locus, which encodes these four amino acid substitutions. From 60 fertilized eggs microinjected with plasmid constructs encoding the gRNA, Cas9 endonuclease, and APLD HDR template shown in Figure 2B (Figure 2C), one female offspring gave the appropriate confirmed genotype (Figures 2D-2F) and was named APLD mouse.

[0122] Specific amino acids within the EGF1 domain of GPIIIa are required to support binding of type II HPA-1a antibodies - previous studies have shown that immune responses to HPA-1a are polyclonal and heterogeneous, requiring some isogenic antisera containing subsets, and that in addition to the polymorphic amino acid 33, discontinuous sequences within the region of the EGF1 domain to be characterized that are linearly distant are required 19，38 As shown in Figure 3A, the prototype type I HPA-1a-specific mAb SZ21 readily bound to APLD but not to wild-type murine GPIIIa (muGPIIIa), confirming the reconstitution of its epitope within the murine PSI domain. To gain further insight into the structural requirements necessary for binding of the antibody population that may be present in the more complex polyclonal human maternal anti-HPA-1a alloantisera, we examined the ability of five different human FNAIT alloantisera to bind to muGPIIIa, APLD muGPIIIa, or human GPIIIa immobilized in microtiter wells. As shown in Figure 3B, three of the five representative alloantisera reacted with APLD muGPIIIa, while the other two did not, consistent with the fact that these alloantisera contained a large number of so-called type II anti-HPA-1a alloantibodies that require residues outside the humanized PSI domain for binding. 19 The reactivity and specificity of other human anti-HPA-1a alloantisera are consistent with the concept of Figure 7 shown.

[0123] To determine the structural requirements for type II anti-HPA-1a antibody binding, we tested the binding of the prototype type II antibody mAb 26.4 to murine APLD platelets. As shown in Figure 4A, similar to human alloantisera 1 and 5 in Figure 3B, mAb 26.4 was unable to bind to murine platelets expressing APLD GPIIIa. Close examination of the interface between the PSI and EGF1 domains (Figure 4B) revealed that a loop extending from the EGF1 domain of human GPIIIa binds amino acids Q 470 Leu 33Very close. This residue is methionine in murine GPIIIa (Ser 469 is conserved in both species). To determine whether Q 470 forms part of the epitope recognized by type II anti-HPA-1a antibodies, starting from our APLD mice, we further modified the sequence of murine GPIIIa by introducing an HDR that would alter M470→Q in the murine EGF1 domain (see Methods). mAb 26.4 now binds readily to platelets from second-generation HPA-1a humanized transgenic mice, which we named APLD Q mice (Figure 4A). In contrast, the binding of mAb SZ21 was not enhanced by additional humanization of the EGF1 domain, consistent with its classification as a type I antibody with an epitope entirely contained within the PSI domain. Unexpectedly, platelets from APLDQ mice did not react at all with HPA-1a-specific mAbs (designated B2G1) isolated from HPA-1a-immunized women by phage display 22 , demonstrating additional unanticipated complexity in the antibody subset specificities that may be present in polyclonal maternal anti-HPA-1a alloantisera.

[0124] Figure 5A highlights the amino acid differences between murine and human PSI and EGF1 domains of GPIIIa. As shown, in addition to the Q470M difference that is spatially close to the polymorphic residue 33, there are six additional amino acid differences in EGF1 between the two species. Molecular docking analysis of B2G1 with the EGF1 and PSI domains of GPIIIa (Figure 5B) revealed that among these seven amino acids, only H 446 and Q 470 together with L 33 are located at the antibody / antigen interface. Thus, expression of the APLDQ isoform of murine GPIIIa with an additional Pro 446 →His amino acid substitution supports B2G1 binding. In contrast, substitution of the human H 446 with a proline residue results in complete loss of B2G1 binding, and if Q 470 is replaced with a methionine residue, both B2G1 and mAb 26.4 lose reactivity with human GPIIIa. In contrast, no HPA-1a-specific antibodies are affected by the G463D and P464Q mutations (Figure 5C), consistent with their absence from the antibody / antigen interface (Figure 5B). Collectively, these data demonstrate that variable numbers of spatially close non-polymorphic amino acids form multiple epitopes, each centered on the polymorphic residue 33, which together contain the target recognition sites recognized by subsets of polyclonal antibodies present in anti-HPA-1a antisera.

[0125] Discussion

[0126] Early studies aimed at characterizing the molecular properties of the HPA-1a epitope found that trypsin or chymotrypsin proteolytic fragments of GPIIIa (ranging in size from 17 kDa 39 to 66 kDa 40 ) could bind HPA-1a-specific alloantibodies. Subsequent studies by Beer and Coller 41 found that the 66 kDa polypeptide was composed of a 17 kDa amino-terminal fragment of GPIIIa (now known to contain the PSI domain) disulfide-bonded to a larger 50 kDa fragment containing residues 348 - 654 (now known to contain the EGF1 domain). After it was found that the formation of the HPA-1a epitope was controlled by the Leu33Pro amino acid substitution at the amino terminus of GPIIIa 13，14 small synthetic peptides surrounding this polymorphic residue were synthesized, but they could not bind HPA-1a alloantibodies 42 , probably because the linear peptides could not fold and adopt the appropriate tertiary conformation due to the presence of seven cysteine residues in the first 55 amino acids of GPIIIa that form a complex disulfide-bonded knot-like structure. Interestingly, a slightly larger recombinant protein composed of the first 66 amino acids of GPIIIa (i.e., the complete PSI domain) produced in the prokaryotic λgt22 phage plaque was able to react with four different anti-HPA-1a sera from PTP patients 43 , thus localizing the HPA-1a epitope to the 7 kDa amino terminus of GPIIIa around the polymorphic amino acid 33.

[0127] Two studies published in the mid-1990s indicated that the HPA-1 epitope recognized by a subset of HPA-1a antibodies might be more complex. Valentin et al. used site-directed mutagenesis to disrupt the disulfide bond connecting the PSI and EGF1 domains of GPIIIa and found that although some anti-HPA-1a alloantibodies continued to bind well, nearly one-third of the antibodies lost partial or all reactivity with the mutant protein 19 . Based on these findings, the authors proposed that HPA-1a antibodies could be classified as type I or type II depending on their dependence on non-contiguous linear sequences present in the PSI and EGF1 domains. The results of Stafford and his colleagues 44 supported this concept, as they found that approximately 20% of 121 maternal anti-HPA-1a alloantibodies reacted with a recombinant fragment of GPIIIa only when it contained both the PSI and EGF1 domains. Honda and his colleagues 38The presence of type II antibodies was detected, which react with chimeric proteins composed of Xenopus GPIIIa molecules with human GPIIIa sequences containing various fragments only when the Xenopus protein contains human amino acids 26 - 38 and amino acids 287 - 490.

[0128] Epitopes from the perspective of antibodies: It was found that the titer of the HPA-1a antibody alone was not always correlated with the severity of the clinical outcome 45，46 , and in addition, HPA-1a-specific alloantibodies were classified into type I and type II, which disappointingly provided neither diagnostic nor prognostic advantages 44 . However, recently, Santoso and his colleagues reported that when a specific population of anti-HPA-1a alloantibodies complexed with the integrin subunit αv (rather than αIIb) present on endothelial cells, they preferentially bind to GPIIIa, and such antibodies are closely associated with the development of intracranial hemorrhage in FNAIT 47 . These findings have several important implications. First, these findings strongly suggest that it is crucial to identify and distinguish different populations of anti-HPA-1a antibodies that are always present in all maternal polyclonal anti-HPA-1a antisera, which may be the key to predicting thrombocytopenia and bleeding risks in FNAIT cases. Second, these findings demonstrate that the influence of the local conformation around polymorphic amino acid residue 33 has a profound impact on determining the core target recognition site of alloantibody binding and its subsequent effector outcomes. We found that the binding of two different type II monoclonal anti-HPA-1a antibodies could be distinguished from each other by their requirements for different amino acids within the EGF1 domain of GPIIIa ( Figure 5A - 5C ), which further supports the view that antibody / epitope recognition involves more than just polymorphic amino acids and may vary between subsets of antibodies involved in almost any alloimmune response. Mapping the polyclonal immune response against HPA-1a using cells expressing murine GPIIIa (containing specific murine→human amino acid substitutions), together with the increasing number of HPA-1a-specific monoclonal antibodies, enables high-resolution analysis of alloantibody subsets, thus providing predictive diagnostic benefits. Interestingly, preliminary studies ( Figure 8 ) have shown that type I and type II alloantibody populations have a significant impact on the ability of platelets to interact with their ligands. Although the effect of type I antibodies is minimal, type II antibodies can significantly block the binding of the fibrinogen mimetic PAC-1 to the GPIIb-IIIa complex, which may be achieved by inhibiting the extension of GPIIIa during integrin activation 48 . Additional research in this area is the subject of extensive planned clinical studies.

[0129] Individual antibody populations within a given polyclonal serum have different surface morphological requirements, which explains why they are able to induce different pathophysiological effects. In the field of histocompatibility testing, there is increasing evidence that, in addition to the genotypic matching of cell surface antigens, the phenotypic determination of the receptor antibody / epitope repertoire, including these epitopes provided by discontinuous position residues that come together on the molecular surface, may be an important predictor of transplant success 49 . Structure-based matching has been demonstrated as a strategy to improve platelet transfusion support in patients with refractory thrombocytopenia 50，51 . Therefore, precise medicine-based diagnostic protocols will be required that not only consider polymorphic differences but also the contact area of alloantibody subsets in order to provide a more precise dissection of the polyclonal nature of the immune response and thus more accurately predict the risks of thrombocytopenia, bleeding, and intracranial hemorrhage

[0130] The polyclonal nature of the response generated by the clinically important Leu33Pro polymorphism in GPIIIa is complex and remains a fascinating area of research that is relevant to both prevention and treatment. Given the polyclonal nature of HPA-1-specific antibodies and the likelihood that any maternal antiserum contains antibodies with polymorphic amino acid 33 from different perspectives and binds with different morphological distributions and different affinities due to the involvement of additional residues, we suspect that a mixture of HPA-1-specific mAbs, rather than any single mAb, may be required to block the binding of polyclonal maternal antibodies and prevent the clearance of fetal platelets from the circulation. Identification of two residues (H 446 and Q 470 ) in EGF1 as necessary and sufficient for the binding of type II anti-HPA-1a alloantibodies does not exclude the possibility that residues either within or outside of EGF1 may be required to support the binding of type II alloantibodies that remain to be characterized. For example, it has been reported that D 39 within the PSI domain and R 93 at the hybrid / PSI interface both affect the binding of human anti-HPA-1a antibodies 37，52 , while other antibodies are specific for the bent conformation of integrin, presumably due to their requirement for both the PSI and EGF1 domains, as described in this study 53 Our atomic-level dissection demonstrated the presence of an increasingly broad antibody subset within the alloantisera of HPA-1a alloimmunized individuals, highlighting the challenge of developing single reagents with narrow epitope specificity to inhibit alloantibody-mediated platelet destruction. The prophylactic delivery of humanized anti-HPA-1a-specific mAbs into the maternal circulation during pregnancy or shortly after delivery can be used to clear neonatal platelets that have passed through the mother, thereby preventing or mitigating the development of alloimmune responses in the first place

[0131] Example 2

[0132] Intraperitoneal injection of anti-HPA-1a mAb induced severe thrombocytopenia in APLDQ mice but not in wild-type mice. Moreover, when platelets from APLDQ mice were introduced into wild-type mice, they elicited a strong polyclonal immune response that was specific for the epitopes generated by these humanized residues and importantly was restricted to these epitopes, demonstrating that the APLDQ humanized form of murine GPIIIa is immunogenic in mice. Wild-type female mice preimmunized with APLDQ platelets and mated to APLDQ male mice gave birth to severely thrombocytopenic pups, many of which exhibited an accompanying bleeding phenotype( Figure 11 and Figure 12A - 12D ). However, mAb 26.4 effectively inhibited the binding of murine polyclonal anti-APLDQ antibodies to murine APLDQ platelets( Figure 13 ).

[0133] IVIG (intravenous immunoglobulin) is a high-purity globulin preparation obtained from pooled plasma of 1000 to 15,000 healthy donors per batch. IVIG targets the cellular immune compartment at multiple levels, including innate and adaptive immune cells. IVIG interacts mainly with dendritic cells, macrophages, and granulocytes by activating and inhibiting FcγRs. The first case of maternal infusion of IVIG for the treatment of FNAIT was reported in 1988 (Bussel JB et al., New Engl J Med. 1988;319(21):1374-8), and since then IVIG has rapidly become the standard antenatal treatment strategy for FNAIT. A recent systematic review showed that weekly administration of IVIG, with or without the addition of corticosteroids, is the first-line antenatal management of FNAIT and helps reduce or mitigate the impact of FNAIT on the infant and decrease the severity of thrombocytopenia (Dian Winkelhorst et al. BLOOD. 2017;129(11):1538-1547).

[0134] Intravenous administration of immunoglobulin G (IVIG) or mAb 26.4 to pregnant female mice on days 10 and 17 after mating decreased the concentration of anti-APLDQ alloantibodies in maternal and fetal circulation and importantly normalized the platelet count of the pups( Figure 14 and Figure 15 ). Collectively, these data establish a novel murine model of FNAIT that recapitulates many clinically important features of FNAIT.

[0135] References

[0136] 1. Newman PJ, McFarland JG, Aster RH. The Alloimmune Thrombocytopenias. In: Loscalzo J, Schafer AI, eds. Thrombosis and Hemorrhage: Lippincott Williams and Wilkins; 2003: 441 - 456.

[0137] 2. Williamson LM, Hackett G, Rennie J, et al. The natural history of fetomaternal alloimmunization to the platelet - specific antigen HPA - 1a (P1A1, Zwa) as determined by antenatal screening. Blood. 1998; 92(7): 2280 - 2287

[0138] 3. Kjeldsen - Kragh J, Killie MK, Tomter G, et al. A screening and intervention program aimed to reduce mortality and serious morbidity associated with severe neonatal alloimmune thrombocytopenia. Blood. 2007; 110(3): 833 - 839.

[0139] 4. Bussel J. Diagnosis and management of the fetus and neonate with alloimmune thrombocytopenia. J Thromb Haemost. 2009; 7 Suppl 1: 253 - 257

[0140] 5. Giovangrandi Y, Daffos F, Kaplan C, Forestier F, Mac AJ, Moirot M. Very early intracranial haemorrhage in alloimmune fetal thrombocytopenia. Lancet. 1990; 336(8710): 310.

[0141] 6. Mueller-Eckhardt C, Kiefel V, Grubert A, et al. 348 cases of suspected neonatal alloimmune thrombocytopenia. Lancet. 1989; 1363 - 366.

[0142] 7. Bonacossa IA, Jocelyn LJ. Alloimmune thrombocytopenia of the newborn: neurodevelopmental sequelae. Am J Perinatol 1996; 13(4): 211 - 215.

[0143] 8. Dreyfus M, Kaplan C, Verdy E, Schlegel N, Durand-Zaleski I, Tchernia G. Frequency of immune thrombocytopenia in newborns: a prospective study. Immune Thrombocytopenia Working Group. Blood. 1997; 89(12): 4402 - 4406.

[0144] 9. Spencer JA, Burrows RF. Feto-maternal alloimmune thrombocytopenia: a literature review and statistical analysis. Aust N Z J Obstet Gynaecol. 2001; 41(1): 45 - 55.

[0145] 10. Tumer ML, Bessos H, Fagge T, et al. Prospective epidemiologic study of the outcome and cost-effectiveness of antenatal screening to detect neonatal alloimmune thrombocytopenia due to anti-HPA-1a. Transfusion. 2005; 45(12): 1945 - 1956.

[0146] 11. Curtis BR, McFarland JG. Human platelet antigens - 2013. Vox Sang. 2014;106(2):93 - 102.

[0147] 12. Davoren A, Curtis BR, Aster RH, McFarland JG. Human platelet antigen - specific alloantibodies implicated in 1162 cases of neonatal alloimmune thrombocytopenia. Transfusion. 2004;44(8):1220 - 1225.

[0148] 13. Newman PJ, Derbes RS, Aster RH. The human platelet alloantigens, P1A1 and P1A2, are associated with a leucine33 / proline33 amino acid polymorphism in membrane glycoprotein IIIa, and are distinguishable by DNA typing. J Clin Invest. 1989;83:1778 - 1781.

[0149] 14. Goldberger A, Kolodziej M, Poncz M, Bennett JS, Newman PJ. Effect of single amino acid substitutions on the formation of the P1A and Bak alloantigenic epitopes. Blood. 1991;78:681 - 687.

[0150] 15. Valentin N, Vergracht A, Bignon JD, et al. HLA - DRw52a is involved in alloimmunization against P1A1 antigen. Hum Immunol. 1990;27:73 - 79.

[0151] 16. Maslanka K, Yassai M, Gorski J. Molecular identification of T cells that respond in a primary bulk culture to a peptide derived from a platelet glycoprotein implicated in neonatal alloimmune thrombocytopenia. J Clin Invest. 1996;98:1802 - 1808.

[0152] 17. Ahlen MT, Husebekk A, Killie MK, Skogen B, Stuge TB. T-cell responses associated with neonatal alloimmune thrombocytopenia: isolation of HPA-1a-specific, HLA-DRB3*0101-restricted CD4+ T cells. Blood. 2009;113(16):3838 - 3844.

[0153] 18. Xiao T, Takagi J, Coller BS, Wang JH, Springer TA. Structural basis fbr allostery in integrins and binding to fib rinogen-mimetic therapeutics. Nature. 2004;432(7013):59 - 67.

[0154] 19. Valentin N, Visentin GP, Newman PJ. Involvement of the cysteine-rich domain of glycoprotein IIIa in the expression of the human platelet alloantigen, P1A1: evidence for heterogeneity in the humoral response. Blood. 1995;85(11):3028 - 3033.

[0155] 20. Weiss EJ, Goldschmidt-Clermont PJ, Grigoryev D, Jin Y, Kickler TS, Bray PF. A monoclonal antibody (SZ21) specific for platelet GPIIIa distinguishes P1A1 from P1A2. Tissue Antigens. 1995;46(5):374 - 381.

[0156] 21. Eksteen M, Tiller H, Averina M, et al. Characterization of a human platelet antigen-1a-specific monoclonal antibody derived from a B cell from a woman alloimmunized in pregnancy. J Immunol. 2015;194(12):5751 - 5760.

[0157] 22. Griffin HM, Ouwehand WH. A human monoclonal antibody specific for the lencine-33 (P1A1, HPA-1a) form of platelet glycoprotein IIIa from a V gene phage display library. Blood. 1995;86(12):4430 - 4436.

[0158] 23. Zhu G, Zhang Q, Reddy EC, et al. The integrin PSI domain has an endogenous thiol isomerase function and is a novel target for antiplatelet therapy. Blood. 2017;129(13):1840 - 1854.

[0159] 24. Pidard D, Montgomery RR, Bennett JS, Kunicki TJ. Interaction of AP-2, a monoclonal antibody specific for the human platelet glycoprotein IIb-IIIa complex, with intact platelets. J Biol Chem. 1983;258:12582 - 12586.

[0160] 25. Sivasubramanian A, Sircar A, Chaudhury S, Gray JJ. Toward high-resolution homology modeling of antibody Fv regions and application to antibody-antigen docking. Proteins. 2009;74(2):497 - 514.

[0161] 26. Marze NA, Lyskov S, Gray JJ. Improved prediction of antibody VL-VH orientation. Protein Eng Des Sel. 2016;29(10):409 - 418.

[0162] 27. Weitzner BD, Gray JJ. Accurate Structure Prediction of CDR H3 Loops Enabled by a Novel Structure-Based C-Terminal Constraint. J Immunol. 2017;198(1):505 - 515.

[0163] 28. Weitzner BD, Jeliazkov JR, Lyskov S, et al. Modeling and docking of antibody structures with Rosetta. Nat Protoc. 2017;12(2):401.416.

[0164] 29. Lyskov S, Chou FC, Conchuir SO, et al. Server verification of molecular modeling applications: the Rosetta Online Server that Includes Everyone (ROSIE). PLoS One. 2013;8(5):e63906.

[0165] 30. Zhu J, Luo BH, Xiao T, Zhang C, Nishida N, Springer TA. Structure of a complete integrin ectodomain in a physiologic resting state and activation and deactivation by applied forces. Mol Cell. 2008;32(6):849 - 861.

[0166] 31. Comeau SR, Gatchell DW, Vajda S, Camacho CJ. ClusPro: an automated docking and discrimination method for the prediction of protein complexes. Bioinformatics. 2004;20(1):45 - 50.

[0167] 32. Comeau SR, Gatchell DW, Vajda S, Camacho CJ. ClusPro: a fully automated algorithm for protein - protein docking. Nucleic Acids Res. 2004;32(Web Server issue):W96 - 99.

[0168] 33. Kozakov D, Brenke R, Comeau SR, Vajda S. PIPER: an FFT - based protein docking program with pairwise potentials. Proteins 2006;65(2):392 - 406.

[0169] 34. Kozakov D, Beglov D, Bohnuud T, et al. How good is automated protein docking? Proteins. 2013;81(12):2159 - 2166.

[0170] 35. Kozakov D, Hall DR, Xia B, et al. The ClusPro web server for protein - protein docking. Nat Protoc. 2017;12(2):255 - 278.

[0171] 36. Brenke R, Hall DR, Chuang GY, et al. Application of asymmetric statistical potentials to antibody - protein docking. Bioinformatics. 2012;28(20):2608 - 2614.

[0172] 37. Barron - Casella EA, Nebbia G, Rogers OC, King KE, Kickler TS, Casella JF. Construction of a human platelet alloantigen - 1a epitope(s) within murine glycoprotein IIIa: identification of residues critical to the conformation of the antibody binding site(s). Blood. 1999;93(9):2959 - 2967.

[0173] 38. Honda S, Honda Y, Bauer B, Ruan C, Kunicki TJ. The impact of three - dimensional structure on the expression of P1A alloantigens on human integrin beta 3. Blood. 1995;86(1):234 - 242.

[0174] 39. Newman PJ, Martin LS, Knipp MA, Kahn RA. Studies on the nature of the human platelet alloantigen, P1A1: localization to a 17,000-dalton polypeptide. Mol Immunol. 1985;22:719-729.

[0175] 40. Kornecki E, Chung SY, Holt JC, Cierniewski CS, Tuszynski GP, Niewiarowski S. Identification of P1A1 alloantigen domain on a 66 kDa protein derived from glycoprotein IIIa of human platelets. Biochim Biophys Acta. 1985;818(3):285-290.

[0176] 41. Beer J, Coller BS. Evidence that platelet glycoprotein IIIa has a large disulfide-bonded loop that is susceptible to proteolytic cleavage. J Biol Chem. 1989;264:17564-17573.

[0177] 42. Flug F, Espinola R, Liu LX, et al. A 13-mer peptide straddling the leucine33 / proline33 polymorphism in glycoprotein IIIa does not define the P1A1 epitope. Blood. 1991;77:1964-1969.

[0178] 43. Bowditch RD, Tani PH, Halloran CE, Frelinger AL, III, McMillan R, Ginsberg MH. Localization of a P1A1 epitope to the amino terminal 66 residues of platelet glycoprotein IIIa. Blood. 1992;79:559 - 562.

[0179] 44. Stafford P, Ghevaert C, Campbell K, et al. Immunologic and structural analysis of eight novel domain - deletion beta3 integrin peptides designed for detection of HPA - 1 antibodies. J Thromb Haemost. 2008;6(2):366 - 375.

[0180] 45. Ghevaert C, Campbell K, Stafford P, et al. HPA - 1a antibody potency and bioactivity do not predict severity of fetomaternal alloimmune thrombocytopenia. Transfusion 02007;47(7):1296 - 1305.

[0181] 46. Killie MK, Husebekk A, Kaplan C, Taaning E, Skogen B. Maternal human platelet antigen - 1a antibody level correlates with the platelet count in the newborns: a retrospective study. Transfusion. 2007;47(1):55 - 58.

[0182] 47. Santoso S, Wihadmadyatami H, Bakchoul T, et al. Antiendothelial alphavbeta3 Antibodies Are a Major Cause of Intracranial Bleeding in Fetal / Neonatal Alloimmune Thrombocytopenia. Arterioscler Thromb Vasc Biol. 2016;36(8):1517-1524.

[0183] 48. Zhou D, Thinn AMM, Zhao Y, Wang Z, Zhu J. Structure of an extended beta3 integrin. Blood. 2018;132(9):962-972.

[0184] 49. Duquesnoy RJ. The eplet load concept in clinical transplantation. Pediatr Transplant. 2016;20(7):884-885.

[0185] 50. Duquesnoy RJ. Structural epitope matching for HLA-alloimmunized thrombocytopenic patients: a new strategy to provide more effective platelet transfusion support? Transfusion. 2008;48(2):221-227.

[0186] 51. Brooks EG, MacPherson BR, Fung MK. Validation of HLA Matchmaker algorithm in identifying acceptable HLA mismatches for thrombocytopenic patients refractory to platelet transfusions. Transfusion. 2008;48(10):2159-2166.

[0187] 52. Watkins NA, Schaffner-Reckinger E, Allen DL, et al. HPA-1a phenotype-genotype discrepancy reveals a naturally occurring Arg93Gln substitution in the platelet beta 3 integrin that disrupts the HPA-1a epitope. Blood. 2002:99(5):1833-1839.

[0188] 53. Thinn AMM, Wang Z, Zhou D, Zhao Y, Curtis BR, Zhu J. Autonomous conformational regulation of beta3 integrin and the conformation-dependent property of HPA-1a alloantibodies. Proc Natl Acad Sci U S A. 2018.

[0189] 54. Hod E1, Schwartz J., Platelet transfusion refractoriness. Br J Haematol. 2008 Jul;142(3):348-60. Epub 2008 May 28.

Claims

1. An in vivo screening method for identifying a molecule capable of inducing thrombocytopenia in transgenic mice, the genome of the transgenic mice comprising a nucleic acid encoding a variant platelet membrane glycoprotein IIIa (GPIIIa) comprising the sequence shown in SEQ ID NO: 26, the method comprising administering a candidate molecule to the transgenic mice, wherein the candidate molecule is an anti-HPA-1a antibody, and determining whether the transgenic mice are thrombocytopenic.

2. The method according to claim 1, wherein the candidate molecule is selected from the group consisting of antibodies, Fv, F(ab), F(ab′), F(ab')2, and single-chain forms of any of the foregoing.

Images